Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-CABG6884.3.5                         88 END     1           1        1                novel protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012154843 Xt7.1-TTpA010m18.5.5 - 68 ESTs
                                                                       -60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA010m18.5.5                                                             AGTGGGCTGTGCGGACTGAATGGGAGGGGAGTGTGAGCCCAGGCATGTTGCTATTACACAACTTGCTATAGGAAACAGCTAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCACTTGAGCTTACTAAAAGGCTCTTGGCTCTAGATCCAAACCATGATCGAGCTGTAAACAATCTGAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAACAAAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGGCCAAATGAGTATATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCAAAAAAAAAA
                                                  Xt7.1-CHK-1008266573                                                                   CTGTGCGGACTGAATGGGAGGGGAGTGTGAGCCCAGGCATGTTGCTATTACACAACTTGCTATAGGAAACAGCTAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCACTTGAGCTTACTAAAAGGCTCTTGGCTCTAGATCCAAACCATGATCGAGCTGTAAACAATCTGAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATxxxCAxAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCxTxGxACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAACAAAAAAAxxCTGCCAAAAGCCAGAAATATTTTCCAGTAGxxxxxATGAGTATxxCxCCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTxxxxxCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCxxxxxCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCAAAA
                                                      consensus depths                                                                  2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     5     7     8     8     9     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    11    11    11    11    10    11    11    11    10    11    10    11     9    10     8    10     8    10     7     9     7     9     7     9     7     9     7     9     7     9     7     9     6     7     6     7     6     7     5     6     4     6     4     6     4     6     3     5     3     4     3     3     4     4     4     4     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     7     7     7     7     6     6     6     6     6     6     7     7     8     8     8     8     8     8     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    12    10    12     9    11     9    12     9    12     5    12     5    12     5    12     5    13     5    14     7    14     8    14     9    14     9    14     9    14     9    14     8    13     8    13     8    14     8    14     8    14     9    15     9    15     9    15     9    15     9    14     8    14     8    13     8    13     8    14     8    14     6    11     7     9     4     8     4     8     4     8     4     7     4     7     4     7     5     8     5     8     5     8     5     8     5     7     4     8     4     9     5    10     5    10     5    10     5     9     5    10     5    10     5    11     5    11     5    11     6    13     6    13     6    16     6    16     6    17     7    18     7    18     7    17     8    18     8    18     8    18     8    18     8    19     8    19     8    20     8    20     8    20     8    20     8    20     9    21     9    20     9    20     9    20    12    20    12    20    12    20    12    20    12    20    12    20    12    20    12    20    11    19    11    19    11    19    11    19    11    19    11    19    10    18     9    18    10    18     9    17     9    17     8    16     8    16     8    16     8    16     8    16     8    16     8    16     8    17     8    17     8    17     8    17     7    16     7    16     7    16     7    16     7    16     7    16     7    16     6    16     5    15     5    15     9    15     7    14     8    14     8    14     3     9     3     5     2     6     2     6     3     6     2     5     2     5     2     5     2     5     2     5     2     5     4     7     3     6     4     7     4     9     4     9     5     9     5    10     5    11     8    13     8    13     8    13     9    14    10    15    10    14    10    14    10    14    10    14    10    14    10    14    10    14    10    15    11    15    11    15    12    17    15    19    15    19    15    19    15    19    14    18    14    18    13    18    13    19    14    19    14    19    14    19    13    19    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    12    17    12    17    11    17    11    17    11    17    11    17    11    17    11    17    11    17    11    17    10    17    10    17    11    17    11    17    11    17    11    17    11    17    11    17    11    17    11    16    11    16    10    16    11    16     9    12     4     5
  5   1   2  SIG                                      Xt7.1-CABJ9790.5                                                    TCAGGATACAGTGGGCTGTGCGGACTGAATGGGAGGGGAGTGTGAGCCCAGGCATGTTGCTATTACACAACTTGCTATAGGAAACAGCTAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCACTTGAGCTTACTAAAAGGCTCTTGGTTCTAGATCCAAACCATGATCGAGCTGTAAACAATCTGAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCCTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACAAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGC
  5   1   2  SIG                                      Xt7.1-XZG58304.5                                                                                                                                            GAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTACTCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGACCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCAGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAATTACCCGGAACAATTAATTTCATCTTTTCTGCGGATACAGCTTGGCATGGGGAGATGCCTACCTGAGGTGATTATACACACGTACTTGGAGCGCAGCATGAGCAATGATGAAGGAGATGCTGATATAGTGATGCTGATACTCATCCTGCTCACTGTGAGCCAGCCTGACTCAAGCTGTCGTCACTGTACTGAATGATTTGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTTTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGC
  5   1   2  SIG                                        Xt7.1-st7n19.5                                                                                                                                                       CCGGGGTGAGAACACAGGAGCACCCAGCTTAAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGATGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATGTAAGTACCTATCTGCATGCCTAGACCCCTTGAGGTCTTCATTCTCACATTTAATTTTATAGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTAGTGGATTAACAGAAGTCGACTGATGTCCAAATAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TTpA010m18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGACCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCCAGGACTTTAACATAAGCTCCACAGATGCAGGATGGGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTTGGTACCTATCTAGCACCATTATTCCTTTATTTAGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAAAAAAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGGGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACACATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCAAAAAAAA
  5   1   2  SIG                                 Xt7.1-IMAGE:6998758.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGATAGTTTGGCCCGGAATTCCGGGATCGGCATGGGAGGGCAATATGAGCCCCACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTATTTTTATTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAANAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTGTTCNC
  5   1   2  SIG                                      Xt7.1-XZT60735.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCGTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAACAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGAGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTTGTTCTTGTTTGAGAAAAATAAACATGTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAGTGAATAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGGTACCTATCTAGCACCATTATTCCTTTATTTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTTTTAATAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAATTCATATCTTGATAGAAAGAGTTGCAGAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTTGTTCTTGTTTGAGAAAAATAAACATGT
                                                                   SNP                                                                                                                                                                                                                                     -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             G-----------
                                               BLH ATG     149    2112                                                             
                                               BLH MIN     143     256                                                             
                                               BLH MPR     140     256                                                             
                                               BLH OVR     149    1035                                                             
                                               EST CLI      79       4                                                             
                                               ORF LNG     149     136                                                             
                                                                                                                                                                                                                                                                               PREDICTED = Sp ==== 2e-115     XP_001181606.1 PREDICTED: similar to ENSANGP00000018738 [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 5e-129     NP_502317.1 proline HYdroxylase (61.5 kD) (phy-2) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 1e-132     NP_733371.1 prolyl-4-hydroxylase-alpha EFB CG31022-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 0          NP_001007286.1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide 2 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_004190.1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alphapolypeptide II; prolyl 4-hydroxylase, alpha polypeptide, type 2;prolyl-4-hydroxylase, alpha polypeptide, type II [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 0          NP_035161.1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alphaII polypeptide [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 0          NP_001006155.1 similar to Prolyl 4-hydroxylase alpha IIa subunit [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAH81114.1 MGC83530 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001087703.1 MGC83530 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          AAH80485.1 P4ha2-prov protein [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTpA010m18.5.5                                                                                                         ATG---------------------TAG---------------TAG------TGA---------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------TAA------------TAG---------TAG------------------------------TGA---------------------TAG------------------------TAG---ATG------------------------------TAG------------------------------------------------------TAG---------------TGA---------------------------------ATG---------------------------------------------------ATG---------------ATG---TAA---------------------------------TGA---------------------------------------------------------ATG------TAG---------------------TAG---------------------TAA---------------------------------------------------------------------------TAG---------------------TAA------------------------------------------ATG------------------------------------------------------------------TGA---------ATG------------------------------------TAATAA------TAA------------------------------------------------------------------------------ATG---------------TAATAA---------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TGATAG------------------------------------------------------------------------ATG------------------TGA---------------------------------------------------------------TAA------------------------------------------------------ATG---------TAA------------------------------ATG---------------ATG---------------------------------------TAG---------------------------------------------------TAA---------------ATG------------------------------------TAG------------------------------TAA---------------------------------------------------------------------------TGA------TAGATG------------------------------------TAA---TGA------------------------------------TGA---------------------------------------------TGA------------------------------------------------------------------------------------------TGA---ATG---------------------------------TAGTAATAA------------------------------------------------------------------------------------------------------TGA------TAA
                                                                   ORF                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2  SIG                                      Xt7.1-CABJ9790.5                                                    TCAGGATACAGTGGGCTGTGCGGACTGAATGGGAGGGGAGTGTGAGCCCAGGCATGTTGCTATTACACAACTTGCTATAGGAAACAGCTAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCACTTGAGCTTACTAAAAGGCTCTTGGTTCTAGATCCAAACCATGATCGAGCTGTAAACAATCTGAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCCTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACAAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGC
                                                  Xt7.1-CHK-1008284524                                                          TACAGTGGGCTGTGCGGACTGAATGGGAGGGGAGTGTGAGCCCAGGCATGTTGCTATTACACAACTTGCTATAGGAAACAGCTAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCACTTGAGCTTACTAAAAGGCTCTTGGTTCTAGATCCAAACCATGATCGAGCTGTAAACAATCTGAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCCTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACAAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTT
  5   1   0       chi Te3  5g3  in                         CAAM7718.5p ATGGGTCCCTACATTACCATCCATCCAGGGTCGGACTGGGGGGTGCAGGGCCCACCAGGACTATCGCCCCACAACACCCAAGGTGCCTCCTCTGGCTAGTTACCCCGCAGGGGGCCCCGCCACGCACCCGAGGACATCGGAGGCCATAGGAAGCAGCAATAGGGTTGGGTCTGGGCCACTGGGGCCCACAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCACTTGAGCTTACTAAAAGGCTCTTGGCTCTAGA
  5   1   2       ext Gas  5g3  in                   TGas081i16.p1kSP6                         GGGGAGCCGTCGGCGCCGGATAGGACGTCAGGATACAGTGGGCTGTGCGGACTGAATGGGAGGGGAGTGTGAGCCCAGGCATGTTGCTATTACACAACTTGCTATAGGAAACAGCTAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTACTCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCAT
  5   1   3        nb Gas  5g                        TGas004f12.p1kSP6                                                    TCAGGATACAGTGGGCTGTGCGGGCTNGATGGGAGGGGAGTGTGAGCCCAGGCATGTTGCTATTACACAACTTGCTATAGGAAACAGCTAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCA
  5   1   3        nb      FS                         IMAGE:7028754.5p                                                                                                                                                GCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCATATGGATGAAAGGGAAGATGCTGGTATTTAAAAAAGTGGATGTCCTGGATTATCTCAGTTACACCTGTCTTTCAGCTTGGGGATGTCCCC
  5   1   3        nb Neu       in                  TNeu067n09.p1caSP6                                                                                                                                                                   ACAGGAGCACCCAGCTTAAGTGGCTGAGATTGAGCTGTGGTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGGGGAGAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAGAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATG
  5   1   3        nb TbA  5g                        TTbA055i06.p1kSP6                                                                                                                                                                              CAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATANAGTGGATGTCCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCACTTGAGCTTACT
  5   1   4   10 seed Hrt1 5g3  in                         CAAQ9885.5p .............................................................................................................................................................................................................GAAGATGGAGCTACATGCTATCTCATTACTCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGACCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCAGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTTACACTGTCTTTCAGCTTGGTGATGTCCCCAGGGCACTTGAGCTTACTAAAAGGCTCTTGGTTCTAGATCCAAACCATGATCGAGCTGTAAACAATCTGAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTG
  5   1   3        nb HdA       in                   THdA032j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATATTATTGGGCACCCTGTTAATGCCTATAGTCTTGTAAATAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTTCGCGACTCTGCCAAAGGATTTATTGCCAACTTCACGTTTCACAGAGAATATTTTCCCACTGAATAAGATGAAACTGGAGCGGCCAAGGCTCTGATGCGCATTCAGGACACATACAATCTTGATCCTGATGTCATAGCTAACGGAAAATTACCCGGACCAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCTGCACGCATTGAAACAGATGGATGAAGGGGAGGAT
  3   1   2       ext Gas  5g3  in                    TGas081i16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGGCACTTGAGCTTACTAAAAGGCTCTTGGCTCTAGATCCAAACCATGATCGAGCTGTAAACAATCTGAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCCTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACAAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu067n09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGACCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAAAAAAA
  5   1   2       ext Ski1      in                         CABJ9790.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACG
  3   1   2       ext Ski1      in                         CABJ9790.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCC
  3   1   4      seed Hrt1 5g3  in                         CAAQ9885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATCTCCAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCC
  3   1   2       add Te3  5g3  in                         CAAM7718.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTGNAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAAAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCC
  3   1   3        nb HdA       in                    THdA032j19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTTATACAATCTCGGGCCACGAGGTGGGGTAAAGAGTGTTTTTGACATTGGCCAAGCCTTGGTACGTATTTAGCACCATTATT
  5   1   2  SIG                                      Xt7.1-XZG58304.5                                                                                                                                            GAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTACTCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGACCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCAGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAATTACCCGGAACAATTAATTTCATCTTTTCTGCGGATACAGCTTGGCATGGGGAGATGCCTACCTGAGGTGATTATACACACGTACTTGGAGCGCAGCATGAGCAATGATGAAGGAGATGCTGATATAGTGATGCTGATACTCATCCTGCTCACTGTGAGCCAGCCTGACTCAAGCTGTCGTCACTGTACTGAATGATTTGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTTTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGC
                                                  Xt7.1-CHK-1008284514                                                                                                                                                  ATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTACTCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGACCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCAGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAATTACCCGGAACAATTAATTTCATCTTTTCTGCGGATACAGCTTGGCATGGGGAGATGCCTACCTGAGGTGATTATACACACGTACTTGGAGCGCAGCATGAGCAATGATGAAGGAGATGCTGATATAGTGATGCTGATACTCATCCTGCTCACTGTGAGCCAGCCTGACTCAAGCTGTCGTCACTGTACTGAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAAxxxxCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTTTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTT
  5   1   2       ext 1030 5g                         IMAGE:7093683.5p                                                                                                                                            GAGTTCATAGGAGCGCTGAGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTACTCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGACCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCAGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAATTACCCGGAACAATTAATTTCATCTTTTCTGCGGATACAGCTTGGCATGGGGAGATGCCTACCTGAGGTGATTATACACACGTACTTGGAGCGCAGCATGAGCAATGATGAAGGAGATGCTGATATAGTGATGCTGATACTCATCCTGCTCACTGTGAGCCAGCCTGACTCAAGCTGTCGTCACTGTACTGAATGATTTGA
  5   1   4      seed Neu  5g3  in                   TNeu066o13.p1cSP6                                                                                                                                                              AGAACACAGGAGCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATG
  5   1   2       ext Gas7      ?                          XZG58304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCCAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTAAATATTCCTGATATA
  3   1   4      seed Neu  5g3  in                    TNeu066o13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTTTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                        Xt7.1-st7n19.5                                                                                                                                                       CCGGGGTGAGAACACAGGAGCACCCAGCTTAAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGATGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATGTAAGTACCTATCTGCATGCCTAGACCCCTTGAGGTCTTCATTCTCACATTTAATTTTATAGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTAGTGGATTAACAGAAGTCGACTGATGTCCAAATAAAAAAAA
                                                  Xt7.1-CHK-1008284528                                                                                                                                                             TGAGAACACAGGAGCACCCAGCTTAAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGATGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATGTAAGTACCTATCTGCATGCCTAGACCCCTTGAGGTCTTCATTCTCACATTTAATTTTATAGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTAGTGGATTAACAGAAGTCGACTGATGTCCAAATAAAAAAAAAAAAAA
  5   1   2       ext Neu  5g3  in                   TNeu085d01.p1cSP6                                                                                                                                                       CCGGGGTGAGAACACAGGAGCACCCAGCTTAAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCTGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTG
  5   1   4      seed Gas8 5g3  in                           st7n19.5p                                                                                                                                                                         GCACCCAGCTTAGAGTGGCTGAGATTGAGCTGTGTTGGAAGATGGAGCTACATGCTATCTCATTAATCCTGCTTAGTCTTTGCTGCATATGGGAAGTCCAGACGGAGGTCTTCACCTCAACAGGTCAGATGACCGATCTGATATTTAGGGAAAGAGATCTTTTACAATCTTTAAAAGAATACATCAGGGAAGAAGAGGAACGTCTTTCTAAAATAAAACGCTGGGCATCTGAAGTTGATGAACTATCTAGCAGATCAACTGCTGACCCAGAAGGATATCTTGGGCACCCAGTTAATGCATATAAACTTGTGAAGAGATTTAACACTGACTGGTCATCCTTAGAGAACCTTGTGCTTCAAGACTCAGCCAAAGGATTTATTGCCAACTTCACGTTTCAGAGAGAATATTTTCCCACTGAAGAAGATGAAACTGGAGCGGCCAGGGCTCTGATGCGCATTCAGGACACATACAAACTTGATCCTGATGTCATAGCTAAAGGAAAATTACCCGGAACAAATTATATTTCATCTTTATCTGCGGATGACAGCTTTGGCATGGGGAAGATTGCCTACCATGATGGTGATTATTACCACACAGTACTTTGGATGCAGCAGGCATTGAAGCAGATGGATGAAGGGGAGGATGCTGTAGTTAATAAAGTGGATGTCCTGGATTATCTCAGTTA
  3   1   2       ext Neu  5g3  in                    TNeu085d01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGATGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATGTAAGTACCTATCTGCATGCCTAGACCCCTTGAGGTCTTCATTCTCACATTTAATTTTATAGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTAGTGGATTAACAGAAGTCGACTGATGTCCAAATAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Gas8 5g3  in                           st7n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATGTAAGTACCTATCTGCATGCCTAGACCCCTTGAGGTCTTCATTCTCACATTTAATTTTATAGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCA
  5   1   2  SIG                                    Xt7.1-TTpA010m18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGACCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCCAGGACTTTAACATAAGCTCCACAGATGCAGGATGGGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTTGGTACCTATCTAGCACCATTATTCCTTTATTTAGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAAAAAAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGGGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACACATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCAAAAAAAA
                                                  Xt7.1-CHK-1008284522                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGACCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCCAGGACTTTAACATAAGCTCCACAGATGCAGGATGGGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTTGGTACCTATCTAGCACCATTATTCCTTTATTTAGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAAAAAAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGGGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACACATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCAA
  5   1   2       ext Neu                            TNeu064d23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCACTTGAGCTTACTAAAAGGCTCTTGGCTCTAGATCCAAACCATGATCGAGCTGTAAACAATCTGAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTCATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGA
  3   1   2       add Egg                             TEgg036l03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTATTTTGAGAAAATGCAGGAGAAACAGAAAGCAGAACTAAAGCAGAATGAGAGCACTAACACAGAGTCAGCCACAAGGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGACCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATAAAAAAAAAAAAAAAAAAA
  3   1   0       add Egg                             TEgg036j01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTATTGCTGCATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAAAGGTTCCATGAAAGAGGACAAGACTTCCTAAAGGCGAGTGGATTAACAGAAGTCGACTGATGTCCAAATAAAAAAAAAAAAAAAA
  5   1   4      seed Te4       in                         CAAN1255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAACCAGGAGTCTATAGCAGGCCATTGGACTACTTGCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAAGATTCCC
  3   1   3        nb Gas8      out                        st106c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAGAGCGGGATGTCTATGAAGCCTTGTGCCGGGGAGAGGGAGTCAAAATGAATCCACGAAGGCAAAGGAGACTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGACC
  5   1   3        nb Egg                            TEgg129k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGGCTTTTCTGTAGGTATCATAACGGAAACAGAAGTCCTTACCTTATCTTGAGTCCAGTTAAAGTGGAAGACGAATGGGATAGTCCACGTATTGTCAGATATCTTAATGCCTTATCTGATGAAGAAATTGCGAAAATAAAGGAACTGGCAAAACCAAAGTTAGCAAGAGCCACAGTGCGGGATCCTAAGACTGGTGTTCTATCAGTGGCCAACTACAGAGTATCTAAAAGTGCATGGCTTGAAGAAAATGATGACCCAGTAATAGCACGTGTGAATCTTCGTATGCAGGCAATAACAGGGCTTACAGTAGACACAGCAGAATTGCTTCAGGTTGCCAATTACGGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGAAAGACGAACCTGATGTTTTCAAGCGTTTAGGGACTGGAAATCGTGTGGCCACTTTTTTAAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATG
  5   1   2       add Te5       in                         CAAO9234.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAGTCtgcagctctctcccctctcctgcgcccccctccctcaagaatgctaagaactcccccacccccttaggaatgtgtgatttgagccaatcagcaggaagcttcctaatagtcttacaaactgggcatgtacaggggtcttggtcttggtggaggagcatggcattttgggaattttgtttaaagaccgcagccttttttttttcctatgaggattctgatcatctgaacaggtgaaatatagggagacttaagggcactattgagagaactgaaggtatgcctgcagcttgagattaactccttatttgcctttccttcttctttTAAAATCAACTTTAGCCGCCCCTACTATATTGTATGTTCCTGTTGTGTCATGTTAATTAATGATGCTTCAACTTTTCTTAGATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATGGAATCATGGTAGGGATTGGCAATATGTCCGATCCTGTTTTTAAACT
  5   1   2       add Neu5      in                         ANHP1146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAGCCTGTAGATTGTATAAAGAGTTCTACAACTTTACCTGAAATCCTGTAATGCTTGTGGAAGTCAATGATAGCCTGAGCCTATTCTGATCCATTGTGTTTCCATTCATATCTGCTTAAATCATAACCATTTCTATGACAAACCATTCCTCATTTCCGATATTAAATACTCATTATGTATATTTTTTTTTTGTTTTGTCAGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAAAGATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGGGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAAAT
  5   1   2       ext Tbd1      in                        CBXT12650.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGACCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCCAGGACTTTAACATAAGCTCCACAGATGCAGGATGGGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATC
  5   1   3        nb Gas6      in                         ANBT2031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCAGGATGGGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGNCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCC
  5   1   3        nb Neu       in                   TNeu053b10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGGGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTG
  3   1   3        nb Gas8      in                          st37a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTACAATGGAAAGT
  5   1   3        nb Gas8      in                          st37a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu053b10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCACTTACTGTATGTTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTTGGTACCTATCTAGCAAAATTATTCCTTTATTTAGTTTTAATATTCCTGATATACAAGGGTGAGCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas6      in                         ANBT2031.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTTGGTACCTATCTAGCACCATTATTCCTTTATTTAGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCC
  3   1   2       add Te5       in                         CAAO9234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTGGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTATTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCC
  3   1   2       ext Tbd1      in                        CBXT12650.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTTATTTTTATTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGTTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTCAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAGACGCTGCCATTTCAGAGGCGCCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGCATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTTGGTACCTATCTAGCACCATTATTCCTTTATTTAGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAAAAAAAA
  3   1   2       add Neu5      in                         ANHP1146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATTTATTTTTATTTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCC
  5   1   2       add Tad5      in                         XZT13490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAACAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGAGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGGTATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCC
  5   1   2       add Te1       in                         CBWN8571.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGTTTTTGTATATCACATTATGGAAGTATAGGTAGAACACTGGCTGCTCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAACAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAG
  3  -1   2       ext Lun1                                 CABD4405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAATGGAAAGTTTATGGAGAAAAAAACAAGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCACGAAACAGCAAACCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTTGGTACCTATCTAGCACCATTATTCCTTTATTTAGTTTTAATATTCCTGATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAAAAAAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGGGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACACATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAAC
  5   1   2       ext Gas                            TGas009h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAAAAACAAAAAAACTGCCAAAGCCANAAATTTTTCCAGTAGAAGCCAAATGAGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAACTTTCGGCT
  5   1   2       ext TpA       out                  TTpA010m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTGTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCAANNNNNNNNNNNNNAAAAAAAAAAAAAANGGCGGCCGCTTTTTTTTTTTTTTTTT
  3   1   4      seed Te4       in                         CAAN1255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTGTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTC
  3   1   2       add Tad5      in                         XZT13490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTCACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCTCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTCACATT
  5   1   2       ext HdA       in                   THdA033c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAATGTGCAGAACATAACNCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTGTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTT
  5   1   2       ext Gas7                                 XZG65678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAATTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAAGGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGTAGTTGTTCTTGTTTTAGAAAAATAAACATGTATTTTCAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                 XZG65679.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAATTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAAGGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGTAGTTGTTCTTGTTTTAGAAAAATAAACATGTATTTTCAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext HdA       in                    THdA033c12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGTAGGTTTAATGCTGTGTCTGGTTAAAATCTTTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATTTCAGGCTGTCAAAGCGATTGTAGTGGTTTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGTTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTTTGCAAAGTGCTGGTGGATTCAGTATTTGACAAATGTTTATTTATTGTTTTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTTTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTTTTGTTTGAGAAAAATTAAACCATGTATTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5  -1   0       chi Te3                                  CAAM7304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGACAAAAGGTAAAAGCTGTGGTTATGTTCTGCACATTTTTCTCTTATTTATGTCAGACTTCCATATGCTGTGACTGGGACTCAAAATGTTAGTTAGCCAGCAAACATGCGTGGGGGTGCAAGATAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTGTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAAT
  3   1   2       add Te1       in                         CBWN8571.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCAGGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAACATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCAAAAAAAAAAAAAAA
  3  -1   3        nb Gas5                                   XZF691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACTCTCAGCGAGCACGGACTTTTGTAAACATACAGAACCAATATAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTGTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTT
  5   1   3        nb Neu                            TNeu024g14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATACATAACCAATAAACAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGCGAAGTACAAATCTCACGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTATATGGGAACCAAGTTTCCGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAACTTCATACTCCGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTT
  5   1   3        nb Limb      in                        CBSU1247.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTC
  3   1   3        nb Limb      in                        CBSU1247.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGCACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCGAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGAGAGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACAAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTTGTGCAGACAGATTTTTCTATTTTTCTGTGAAATTTATTGTTTTTTTTCAGGAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTC
  5   1   2  SIG                                 Xt7.1-IMAGE:6998758.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGATAGTTTGGCCCGGAATTCCGGGATCGGCATGGGAGGGCAATATGAGCCCCACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTATTTTTATTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAANAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTGTTCNC
                                                  Xt7.1-CHK-1008284518                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTTGGCCCGGAATTCCGGGATCGGCATGGGAGGGCAATATGAGCCCCACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTATTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAANAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGT
  5   1   4      seed AbdN      in                       IMAGE:6998758                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   NNGGCTCTGTGGTTGGATAGTTTGGCCCGGAATTCCGGGATCGGCATGGGAGGGCAATATGAGCCCCACTTTGATTTTTCAAGGCGTCCCTTTGACTCCAATCTCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTGGAGATTATTTTTATTTTTTTG
  3   1   3        nb Egg  5x3  out                   TEgg025h12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCATGGGAGGGCAATATGAGCCACACTTTGATTTTTCAAGGCGTCCCTTGGACTCCAATCTCTAAGCGGACGGAAATAGACTTGCAGCATTTCTTAAAAATATGAGTAAGGTCGAGGCTGCAGGAGTGCCGGTATTTCATGACTTTGGAGCAGCAATTGTGGCCAAAGAAGGGTACTTCTGTATTATGGTATAACCTCTTCAGAAGTGGAGGGGGTGATTCCAGAACAGGACACGCAGCTTGTCTGGTATTAGCAGGTAGTAAATGGGTTTCCAATGAAATGGTTCCATGAAAGAGGACAGGAATTCTGGAGGCATTGAGGATAAACAGAAGTCGATTGATGTCCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu024n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAAAACGGATGGAAATAGACTTGCAACATTTCTTAACTATATGAGTGACGTCGAGGCTGGAGGAGCGACGGTATTTCCTGACTTTGGAGCAGCAATTTGGCCAAAGAAGGGTACTGCTGTATTCTGGTATAACCTCTTCAGAAGTGGCGAGGGAGATTACAGAACACGACACGCAGCTTGTCCTGTATTAGTAGGTAGTAAATGGGTTTCCAATAAATGGTTCCATGAAAGAGGACAAGAATTCCTGAGGCCTTGTGGATTAACAGAAGTCGACTGATGTCCAAATATAAAAAAAAAAAATATTCCCTTTTAATTATGCTGGTGCTAGTTGGTTACCTAGGACTTTAACATAAGCTCCACAGATGCAGGATGAGTTGGTACTACTAAGCTACTGTAGCAGAATGAGCCATTGAAGTCATTATAGGACATGCAGCTTTTATTCACAGATAGAATCATGGTAGGGATTGGCAATATGTTCCGATCCTGTTTTTAAACTGTACAACAACAGAGCCCAATAGGGAGACAGTGGGATCTGACTGCCACATTGTGCTTCATCTTTCACTTACTGTATATTTGCTCCTGCAGCTGTGGAGCTGTTACTCTTTTATCAGTGGCATTCATGGATGGGAATATATCAATGTATGTCATAATCTTGGCTG
  3   1   4      seed AbdN      in                       IMAGE:6998758                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAANAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTGTTCNCNNGGAAAANACACCTGTTAAAN
  5   1   3        nb Neu                            TNeu024g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATT
  5   1   2  SIG                                      Xt7.1-XZT60735.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCGTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAACAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGAGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTTGTTCTTGTTTGAGAAAAATAAACATGTAT
                                                  Xt7.1-CHK-1008284526                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCGTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAACAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGAGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCAC
  5   1   2       ext Liv1      in                        CAAR13223.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCGTTTTTTGGTTGAGGGGAAATAGCAGTTCACTGGGTTAACCTTTCAGGGACTTGGGTTTTTGTATATCACATGGAAGTATAGGTAGAACACTGGCTGCCCATCTAGGGATTTTTTCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAACAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGAGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACGCATGTTTGCTGGCTAAA
  5   1   4      seed Tad5      in                         XZT60735.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCAAAGCAAAATTAATTTAAAACATGCATTATTAAGACAGCTTTAGCTTCAGAAAAAAAAGATGCTGCCATTTCAGAGGCACCTAGGGGCCTAGCTCAAAGCTAGTCATTTTGTGTAAGTGCCACTTTCAAATGGCCCTGCCAAGAATCAGATCAACCAAATGCTCCCAGTGGAATTACAACATGCTCTAGCAGGCAGGCCTTGCCTCCAACCCCCATGTATTCTGCTGTGACTTTTTACAATGGAAAGTTTATGGAGAAAAAAACGAATTAAGTGAATAATAAAGAGAATAACGACAGAGCCAAGAGCCAAGCAACAGCTGCAAACATTGGAGCAAAACTCTAGTTTTTTATTTATTTCCATCAAATAAAATGGGAAAATGTAATACTTAATAACCCCTGAATCTAGCATTCCATGAAACAGCAAAGCGTGATACAATCTCTGGCCAAGATGTGCTGTAAAGAGTGATTTTGACATTTGCCAAGCCTTGGTACCTATCTAGCACCATTATTCCTTTAGTGCACATTTCTGCTGTTTTAATATTCCTAATATACAGACAATTCATATCTTGATAGAAAGAGTTGCAGAGTTCCAAAAAAAAACAAAAAAACTGCCAAAAGCCAGAAATATTTTCCAGTAGAAGCCAAATGAGTATCACCCCTTATTTGAAGGATAACATTATACTTTAAGCAGAGAGGTTTATCTTGCAGTCCCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTNCTGTTATGTATGCCTGTCAACTTTTATATGGGAAGTAATGTGCTG
  3   1   4      seed Tad5      in                         XZT60735.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGTCCCACGCATGTTTGCTGGCTAAATAAGATTTTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTC
  3   1   2       ext Liv1      in                        CAAR13223.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTCCCACGCATGTTTGCTGGCTAAATAAGATTNTGAGTCCCAGTCACAGCATATGGAAGTCTGACATAAATAAGAGAAAAATGTGCAGAACATAACCACAGCTTTTACCTTTTGTCTTGTTATGTATGCCTGTCAACTTTTATATGGAAGGTAATGTGCTGATAGAGCTAAATGTGCCCATAAATTAGTCTAGTGACAAAGATAAGGGCCCTCGTGGCATGTTTAATGCTGTGTCTGGTTAAAATCTCTCAGCTAGCATGGACTTTTGTAAAAATACAGAACCAATAAAGAAACCATAGAAAGTTTCTCCAGGAAAGAAATTTAATGTATAACTGATAACCGGAAACAGCTATCCTGCTTACTTTGTGAAGTACAAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTC
  5   1   2       ext Gas7                                 XZG16186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATCTCAGGCTGTCAAAGCGATTGTAGTGGTCTGAGCAGAGTAGATGGGAACCAAGTTTCGGCTGTATAACCAAAGACCATTTTAAAACTGAAGCATTCCCCCAAATCCCAATGAATTTCATACTCGGTGATTGTTACTTGATACTGACCTTGGTGCCCAACTTTCAAAAGGAGCCTGCGTGGGCAGGTATTGCTGCTAGGGGAAGCTCCTATTCATTGCCATATTTGTCCCCTCCCTCTGCAAAGTGCTGGTGGATTCAGTATCTGACCAATGTCTATTTATTTTTCTACTAAAATTCACTTCCTTTAGTAATAAACAGTCAGGAGAGTGTGTTTAAGATGCCCCCCTTTTTGGTGCAGACAGATTTTCTATTTTTCTGTGAAATGTATTGTTTTTTTCAGAAGTTGTTCTTGTTTGAGAAAAATAAACATGTATTTTCACAANANAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)