Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 97%

 1012154848 Xt7.1-CAAK10981.3.5 - 26 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                   2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     5     7     5     7     4     7     4     8     4     8     3     7     3     7     2     6     3     6     3     6     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     5     7     5     7     5     7     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     7     9     8    10     8    10     8    10     8    10     8    10     8    10    10    12    10    12    10    12    11    13    12    13    12    13    12    13    13    13    13    14    13    14    13    14    13    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    11    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13     9    12     9    12     2     5
  5   1   2      ests                                Xt7.1-CAAK10981.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATATTTTTGTTCACGGTGCGGCGTTGGGGTCCATAAGGAGTGCCTGGAAACAATTCACGCCTGCAAAATCGGTGGCTCTACGGATGATGTGGATTCTCTAATCACAGTGTCAGGGCCTAAAATGGTTGCGGTACAGAACTACTTTGGAAACCCGGCGCCTCCAGGGAAACCCGTGTTAACGTTTCAGAAAGACGATGTGATCGAGTTGCTGCGAGGTGACCCCAATTCTCAGTGGTGGGAGGGACGGCTATTGCTTACTAAGAAGTCTGGTTATTTCCCAAGTTCCTCGGTGGAGCCATGTCCTGTGGAACCACTTGTGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCTGAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                               BLH ATG     261    1956                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN     261     230                                                                                                                                                                                                                                                                                                                                              
                                               BLH OVR     261    1204                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bb ---- 9e-007     BAC16745.1 calponin [Branchiostoma belcheri] --------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 7e-013     BAE93296.1 zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN --- Sc ---- 3e-015     NP_009359.1 Cdc24p [Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 3e-018     NP_506293.1 common-site lymphoma leukemia guanine nucleotide exchange factor like (5N754)[Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Cs ---- 2e-025     BAA36290.1 PEM-2 [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 2e-057     XP_001193356.1 PREDICTED: similar to vav 2 oncogene, partial [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 8e-096     NP_573372.1 CG7893-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---= 9e-180     XP_683615.1 PREDICTED: similar to vav 2 oncogene [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 0          NP_033526.1 Vav2 oncogene [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 0          NP_003362.2 vav 2 oncogene; oncogene VAV2 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 0          NP_989473.1 vav 2 oncogene [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAH57726.1 MGC68892 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 0          NP_001079955.1 Vav2 oncogene [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 0          CAJ81576.1 vav 2 oncogene [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAK10981.3.5                                                                                                                                                                                                                                                                                                                                                                                        TAATAG------------------TGA---------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---ATG---ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------ATG------------ATG------------ATG---ATG------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       bld Gas0 5g3  in                         dad35h01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGGGATTCCTTGCCTGGCTTGCCAACATGACCGAGGGTTGGCGGCAGTGCGGACGCTGGCTCATAGACTGCAAAGTTCTCCCAGTGGACCACCGGGTCGTGTGGCCTTCTGCCGTGGTCTTTGACCTGGCCCAAGCTCTGCGGGATGGAGTCCTGCTCTGTCAGCTGCTCCACAACCTGTCCCCTGGATCTATCGACCTCAAGGACATCAACTTCAGGCCCCAGATGTCACAGTTCTTGTGCCTGAAGAACATTCGAACATTCCTCAAAGTTTGCCACGACAAGTTTGGATTACGGAACTGCGATCTCTTCGACCCCTTCGACCTGTTCGACGTCCGGGATTTCGGAAAGGTGATTGCCGCTTTGTCCAAGGTGTCCTACCACAACATTGCCCAAACCAAGGGGATTCGGCCTTTCCCTTCTGAGGACACCGCAGAGAACGATGATGACATCTACAGGAGCCTGGAGGAACTTGCCGACGAGCACGACCTGGGGGAGAATGATACGTACGACGTCCCGTGCGAAGAGGATGATATCTACGAAGACATCATCAAAGTTGAGAACCAGCAACCGATGAAAATGGGC
  5   1   2       add In66                            IMAGE:8965073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCATTAATTGTTTAGGAACACTCCGCATTCGAATTCGTCCCCGAAGACATCATCAAAGTTGAAAACCAGCAACCGATGAAAATGGGCATGACGGAGGACGACAAAAGGAATTGCTGCTTACTGGAGATTCGGGAAACGGAAGACCGGTATTACAGAACGTTAGAGGATATTAAGACTTATTACATGATCCCCCTCAAGCAGATACTGAGTGTGCAGGAGATCTCCACCATATTCATTAATTTAGAGGAACTCATCAAGGTGCATTTTAATTTCCTTCGGACCATCGAGCTCTCGGTCATGTCGGGGGGCAGCACCATCGGGCAGGTGTTTCTGGATTATAAGGAAAAGCTGCTCATCTACGGGGAGTACTGCAGCCATATTGAATATTCCCAGAAGACCCTGGACCAGCTCATAGCAACCCGTGAAGATGTGCGTACTAAACTGGAGGAATGTTCCCTCAAGGTTCAGGAAGGGAAGTTCAAGCTGCAAGATTTGCTGGTGATCCCCATGCAGAGAGTCCTGAAGTACCATCTCCTGCTCAAAGAACTTCTCAGCCACACAGCAGACAGCCCAGAGAGACAGACGCTAAAGGAAGCCCTGGACGCCATGCAGGACCTTGCCATGTACATTAATGAAGTGAAACGGGACAAGGAAACGTTAAAGAAAATTAGCGAGTTCCAGAACTCCATAGAGAACCTGCAAGTCAACCTGGAAGAATTTGGGCGGCCCAAGATAGATGGGGAGTTAAAGTTCCGTTCCATGGTCACCAGGCCAACAGGACAGTTTCTCTTTCTTGTTCGACAAGTAGTGATTGTTCTTGCCAAAGAGAAGCTACAACTACGAGCTGAGGAATTATTCAACTTCCTGTTGTTCACAAGATTGACGACGACCCCCATGTGACACACAAGATGTGTTTAAAAGTTCCCATATGGAA
  5   1   2       add In54                            IMAGE:8943382.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCACCGGATACCTACGATCCCCCCGACTCGAATTCGTCCCCAAAGTTGAAAACCAGCAACCGATGAAAATGGGCATGACGGAGGACGACAAAAGGAATTGCTGCTTACTGGAGATTCGGGAAACGGAAGACCGGTATTACAGAACGTTAGAGGATATTAAGACTTATTACATGATCCCCCTCAAGCAGATACTGAGTGTGCAGGAGATCTCCACCATATTCATTAATTTAGAGGAACTCATCAAGGTGCATTTTAATTTCCTTCGGACCATCGAGCTCTCGGTCATGTCGGGGGGCAGCACCATCGGGCAGGTGTTTCTGGATTATAAGGAAAAGCTGCTCATCTACGGGGAGTACTGCAGCCATATTGAATATTCCCAGAAGACCCTGGACCAGCTCATAGCAACCCGTGAAGACGTGCGTACTAAACTGGAGGAATGTTCCCTCAAGGTTCAGGAAGGGAAGTTCAAGCTGCAAGATTTGCTGGTGATTCCCATGCAGAGAGTCCTCAAGTACCATCTCCTGCTCAAAGAACTTCTCAGCCACACAGCAGACAGCCCAGAGAGACAGACGCTAAAGGAAGCCCTGGACGCCATGCACGACCTTGCCATGTACATTAATGAAGTGAAACGGGACAAGAAACCTTAAAGAAAATTAGCGAGTTCCAGAACTCCATAGAGAACCTGCAAGTCAACCTGGAGAATTTGGGCGGCCACAGATAGATGAGGGGAGTTAAAAGTTCGTTCCATGGGTCACCAAGCCAAACAGACAGGTATCTCTTTCTGTCGACAAAGTATGAATGTCTGCCAAGGAAAGCTACACTACCGAGCCTGAAGAAATCATCGAACTGTCTGTGTCCCGAGATGAAGCGACTAGCCACTGCATACACACAAGA
  5   1   2      skin Gas7                                  XZG8799.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTAATTTCCTTCGGACATCGAGCTCTCGGTCATGTCGGGGGGCAGCACCATCGGGCAGGTGTTTCTGGATTATAAGGAAAAGCTGCTCATCTACGGGGAGTACTGCAGCCATATTGAATATTCCCAGAAGACCCTGGACCAGCTCATAGCAACCCGTGAAGACGTGCGTACTAAACTGGAGGAATGTTCCCTCAAGGTTCAGGAAGGGAAGTTCAAGCTGCAAGATTTGCTGGTGATTCCCATGCAGAGAGTCCTCAAGTACCATCTCCTGCTCAAAGAACTTCTCAGCCACACAGCAGACAGCCCAGAGAGACAGACGCTAAAGGAAGCCCTGGACGCCATGCAGGACCTTGCCATGTACATTAATGAAGTGAAACGGGACAAAGAAACCTTAAAGAAAATTAGCGAGTTCCAGAACTCCATAGAGAACCTGCAAGTCAACCTGGAAGAATTTGGGCGGCCAAAGATAGATGGGGAGTTAAAAGTTCGTTCCATGGTCAACCAGGCCAAACAGGACAGGTATCTCTTTCTGTTCGACAAAGTAGTGATTGTCTGCAAAAGGAGAGGCTACAACTACGAGCTGAAGGAAATCATCGAACTGCTGTGTCACAAGATGAGCGACGACCCCATGAACAACAAAGATGTTAAAAAGTGGTCCTATGGGTTCTTCCTGATCCATCTCCAGGGCAAGCAGGGCTTCCAGTTCTTTTGCAAGACGGAAGAGATGAAGAGGAAGTGGATGGAGCAGTTTGAAATGGCAATGTCAAACATAAAGCCCGACAAGGCCAACGCCAACCACCCACACTTCCAGATGTTTACATTCGACAAAACCACCAACTGCAAAGCCCTGC
  3  -1   2       bld Int1      in                         CAAP7243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGTCATGTCGGGGGGCAGCACCATCGGGCAGGTGTTTCTGGATTATAAGGAAAAGCTGCTCATCTACGGGGAGTACTGCAGCCATATTGAATATTCCCAGAAGACCCTGGACCAGCTCATAGCAACCCGTGAAGACGTGCGTACTAAACTGGAGGAATGTTCCCTCAAGGTTCAGGAAGGGAAGTTCAAGCTGCAAGATTTGCTGGTGATTCCCATGCAGAGAGTCCTCAAGTACCATCTCCTGCTCAAAGAACTTCTCAGCCACACAGCAGACAGCCCAGAGAGACAGACGCTAAAGGAAGCCCTGGACGCCATGCAGGACCTTGCCATGTACATTAATGAAGTGAAACGGGACAAAGAAACCTTAAAGAAAATTAGCGAGTTCCAGAACTCCATAGAGAACCTGCAAGTCAACCTGGAAGAATTTGGGCGGCCAAAGATAGATGGGGAGTTAAAAGTTCGTTCCATGGTCAACCAGGCCAAACAGGACAGGTATCTCTTTCTGTTCGACAAAGTAGTGATTGTCTGCAAAAGGAGAGGCTACAACTACGAGCTGAAGGAAATCATCGAACTGCTGTGTCACAAGATGAGCGACGACCCCATGAACAACAAAGATGTTAAAAAGTGGTCCTATGGGTTCTTCCTGATCCATCTCCAGGGCAAGCAGGGCTTCCAGTTCTTTTGCAAGACGGAAGAGATGAAGAGGAAGTGGATGGAGCAGTTTGAAATGGCAATGTCAAACATAAAGCCCGACAAGGCCAACGCCAACCACCACAACTTCCAGATGTTTACATTCGACAAAACCACCAACTGCAAAGCCTGCAAGATGTTCCTAAGGNGCACTTTTTACCAGGGATATTTTTGTT
  5   1   2      ests                                Xt7.1-CAAK10981.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATATTTTTGTTCACGGTGCGGCGTTGGGGTCCATAAGGAGTGCCTGGAAACAATTCACGCCTGCAAAATCGGTGGCTCTACGGATGATGTGGATTCTCTAATCACAGTGTCAGGGCCTAAAATGGTTGCGGTACAGAACTACTTTGGAAACCCGGCGCCTCCAGGGAAACCCGTGTTAACGTTTCAGAAAGACGATGTGATCGAGTTGCTGCGAGGTGACCCCAATTCTCAGTGGTGGGAGGGACGGCTATTGCTTACTAAGAAGTCTGGTTATTTCCCAAGTTCCTCGGTGGAGCCATGTCCTGTGGAACCACTTGTGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCTGAAAAAAAAAAA
                                                  Xt7.1-CHK-1008232608                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGTTCACGGTGCGGCGTTGGGGTCCATAAGGAGTGCCTGGAAACAATTCACGCCTGCAAAATCGGTGGCTCTACGGATGATGTGGATTCTCTAATCACAGTGTCAGGGCCTAAAATGGTTGCGGTACAGAACTACTTTGGAAACCCGGCGCCTCCAGGGAAACCCGTGTTAACGTTTCAGAAAGACGATGTGATCGAGTTGCTGCGAGGTGACCCCAATTCTCAGTGGTGGGAGGGACGGCTATTGCTTACTAAGAAGTCTGGTTATTTCCCAAGTTCCTCGGTGGAGCCATGTCCTGTGGAACCACTTGTGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCTGAAAAA
  5   1   2       bld Tbd0      ?                      NISC_nl23g01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGGGCTTCCAGTTCTTTTGCAAGACGGAAGAGATGAAGAGGAAGTGGATGGAGCAGTTTGAAATGGCAATGTCAAACATAAAGCCCGACAAGGCCAACGCCAACCACCACAACTTCCAGATGTTTACATTCGACAAAACCACCAACTGCAAAGCCTGCAAGATGTTCCTAAGGGGCACTTTTTACCAGTGATATTTTTGTTCACGGTGCGGCGTTGGGGTCCATAAGGAGTGCCTGGAAACAATTCACGCCTGCAAAATCGGTGGCTCTACGGATGATGTGGATTCTCTAATCACAGTGTCAGGGCCTAAAATGGTTGCGGTACAGAACTACTTTGGAAACCCGGCGCCTCCAGGGAAACCCGTGTTAACGTTTCAGAAAGACGATGTGATCGAGTTGCTGCGAGGTGACCCCAATTCTCAGTGGTGGGAGGGACGGCTATTGCTTACTAAGAAGTCTGGTTATTTCCCAAGTTCCTCGGTGGAGCCATGTCCTGTGGAACCACTTGTGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAG
  5   1   2       bld Gas7      in                         XZG46438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTTTACCAGGGATATTTTTGTTCACGGTGCGGCGTTGGGGTCCATAAGGAGTGCCTGGAAACCATTCACGCCTGCAAAATCGGTGGCTCTACGGATGATGTGGATTCTCTAATCACAGTGTCAGGGCCTAAAATGGTTGCGGTACAGAACTACTTTGGAAACCCGGCGCCTCCAGGGAAACCCGTGTTAACGTTTCAGAAAGACGATGTGATCGAGTTGCTGCGAGGTGACCCCAATTCTCAGTGGTGGGAGGGACGGCTATTGCTTACTAAGAAGTCTGGTTATTTCCCAAGTTCCTCGGTGGAGCCATGTCCTGTGGAACCACTTGTGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTAC
  3   1   2       chi Brn3      in                         CAAK8425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGNCGGACAACTTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGCCTCCTGCGCTTCCTACAACTTTTCTTTTCTCAGTCCTCAGGGCCTCAACTTCCCTTGCCAGAACCCGTCCACTCCCTTCTGGTCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCG
  3   1   2      seed Brn3                                CAAK10981.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTCCTGTGGAACCACTTGTGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCTG
  5  -1   2       bld Int1      in                         CAAP7243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAACCACTTGTGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTGCGAATCGA
  3   1   2       bld Te4  5g3  in                         CAAN1185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTCAGTGGGACGTACCTAATCCGAGAGAGGCCGGCGGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAACGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCTG
  3   1   2       bld Fat1 5g3  in                        CABC11201.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACTTGTGATCCGCAGTGATTACAGTAAATACCCGTGGTTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCTG
  3   1   2       bld Ovi1 5g3  in                         CABI7968.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGCCGGTAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCTG
  3   1   2       bld Gas7      in                         XZG46438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAACGTGGAGAGGCCCCAAGCGGACAACCTTCTCAAAGGCCACGTTAGTGGGACGTACCTAATCCGAGAGAGGCCGGCAGAGGCCGAACGCTTCGCCATCAGCATTAAGTTCAATGACGAAGTCAAACACATAAAGGTTGTAGAGAAGAACAACTGGATCCACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTATGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCTGAAAAAAAAAAATAG
  3   1   2       bld Egg0                                 dad71h07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACATCACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCTCTTTTAACGGAATTAAAGTCATNCCAGCCCGGGGGTCG
  3   1   2       bld TpA  5g3  in                   TTpA074b08.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAGAGGCCAAGAAGTTTGAAAGCTTATTGGAACTGGTGGAATACTATCAGACGCACTCGCTGAAGGAAAGCTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATGTTTTAACGGAATTAAAGTCATTCCAGATCTGAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      in                         CAAP1327.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTTTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCT
  5   1   2       bld Int1      in                         CAAP1327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTAAGCAGCTGGACACCACGTTAAAGTACCCCTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGAACGGCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCAATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTGAGACATTTGCACAACAGACACTCCCTGAAGTGACACCCTTTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACGGAATTAAAGTCATTCCAGATCT
  5  -1   2       bld Neu                            TNeu128o07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTACAAATCCAGAACGGGCCGCAGCAGTAGCAGCAGCAGCAGCAATACGCCCCGGGCCCCAGTGTTCACGCCACGACCGGTAGGACCGCCCATCGCCAGGTACAACTTCGCCGCCAGAGACATGCGCGAGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGCCCAGGGATGGTGGAAAGGAGACACCAATGGCAGGATTGGGTGGTTTCCCTCCACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACTGAGACATTTGCACAACAGACCCCCCCCCCAAGTGACACCCTTTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTACGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCATCTTTTAACCGCCATTCCACTCATTCCAGATCTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas0 5g3  in                         dad35h01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGTTCATGCCTCGACCGGTAGGAACGGCCATCGCCAGGTACAGCTTTGCCGCCAGGAGACATGCGCGGGCTTTCCCTACGGGAAGGGGACGTCGTCAGGATCTACAGCCGGATTGGAGGGGACCAGGGATGGTGGAAAGGAGAGACCCATGGCAGGATTGGGTGGTTTCCCTCGACGTACGTGGAAGAGGAAGGGGTCCAATGAGCTCCCCCACTCCGGACCAAGCCCCTCCTACCTCACCCCCCTGCACAACAGACACTCCCTGAAGTGACACCCTCTTGCATTCCGCAGGCCGAGCCTGACCGCCGCCTTTGGCTCCTTTCGCCCGTACTACTTGTATATAAGATTTATAATGCTGATCTATGGCAGGCGTATGAGGAACTGATTGGTGGAATGTTGCCGGCGCTCTTTTAACGGAATAAAAAGTCATNCCAGATTCTGGAAAAAAA

In case of problems mail me! (