Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-st56g21.3                            14 END     1           4        7                MGC69325 protein [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     2  32.0    0(repeat)                                    0 REP     93          1      756                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012154893 Xt7.1-TNeu141o23.5.5 - 24 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                 4     6    12    13    16    16    18    18    19    19    20    20    20    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    21    20    21    20    21    20    21    20    21    21    22    18    21    18    20    17    19    17    19    10    16    10    13    10    12    10    11    10    12    10    12    10    12    10    11     5    11     5    11     4    11     4    10     4    10     4    10     4    10     4     8     4     8     4     5     4     6     4     6     4     6     4     6     2     4     2     3
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCATATAGTCACTGAATTGTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACTGATACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACGGGAGCTG
                                                                   SNP                                        ---------C--
                                                                   SNP                                                                ----G-------
                                                                   SNP                                                                                                                                                                            -----C------
                                                                   SNP                                                                                                                                                                                                                                                    ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------A-
                                               BLH ATG      26     675                            
                                               BLH MIN      26      72                            
                                               BLH MPR      23      72                            
                                               BLH OVR      26      96                            
                                               EST CLI       7      46                            
                                               ORF LNG      26       1                            
                                                                                                                         PROTEIN -== Sc ==== 7e-049     NP_009552.1 Histone H2A (HTA1 and HTA2 code for nearly identical proteins); Hta2p[Saccharomyces cerevisiae] ========================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Ce ==== 3e-054     NP_505463.1 Histone HIS-35 (13.4 kD) (his-35) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Dm ==== 8e-057     NP_724343.1 CG31618-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = Sp ==== 3e-057     XP_790098.1 PREDICTED: similar to CG31618-PA [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Gg ==== 9e-062     NP_001025924.1 histone H2A [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = Dr ==== 3e-062     XP_699230.1 PREDICTED: similar to histone H2A [Danio rerio] ===========================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = Mm ==== 1e-063     XP_891398.1 PREDICTED: similar to histone H2A [Mus musculus] ==========================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Hs ==== 4e-064     NP_778235.1 histone H2A [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Xt ==== 2e-065     AAH74601.1 MGC69325 protein [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Xl ==== 7e-066     AAH77427.1 MGC82198 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === ?? ==== 7e-066     NP_001086775.1 MGC82198 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu141o23.5.5                                    TGA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TGA---------------TAA------------------------------------------------TGA------------------------------------------------------------------------TGA------------------------------------------------------------------------ATG---------------------------TAG---------------------------------------TAG
                                                                   ORF                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                 ]
  5  -1   2       ext Neu                            TNeu011n04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAGGGGGGTGACTATCCCGGGCAGACTGGTACAGTCGCACTGCCGGTAACACGGAGGGACACAATGTTGCTGTTTGGAGTTCAATAAACCTCGTAACGGGAGCTGCAATTGATTGGTTGGTGAAATAATGTATCGGGGTAAAGGGATCTGAGTGTCCCCCAACTTCTCCTTATTCTCTGATCAGAACTAAATGCCCCGCACTCAGTGTGGCCCTTCCCTGAATGCTGCAGCCGAGGGCCCCCGCCCATTCCCTTTATACCCGCC
  5   1   0       add Gas8      out                         st77e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGGGGGTGATTATCCCGGGCAGACTGATACAGTTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGGGGTTCAATAAACCTCATAACGGGAGCTGCAATTGATTTCTGAGTTGGTGAAATAATGTATCGGGGTAAAGGGATCTGAGTGTCCCCCAACTTCTCCTTATTCTCTGATCCCAGGGGAGTCGGATGTTACAGGGAACTGATTTTGAGGGGATTTCTGAATTTGTAATTTTTATGATTTGGGGCTCAGATTATATACAGGGAATATGAATGTGATTCCCACAGATTAGTGGGAACATTCAACAAATAAGTTTTGTGGTTTTGATTGTGTTTCCAGTTACTGTATATAGTCCCTAGTGCGCCCCTTCTGCCAACACTGCAACTCCCCGGGCCCCTACTCTGCCAGGGAGGTACCGGCCTCAGGCTCTTGTCTTCTTGGGAATAAAAGTATCTGCCCTTATCCCTCTCTCGTCTGGGAACCCAATACCCCCCCCCCCCCCCNGGA

In case of problems mail me! (