Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Feb 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-st56g21.3                            14 END     1           4        7                MGC69325 protein [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     2  32.0    0(repeat)                                    0 REP     93          1      756                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012154893 Xt7.1-TNeu141o23.5.5 - 24 ESTs
                                                                       .......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu141o23.5.5                            TTTGTGCTTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGGGCAAGGGGGGTGATTATCCCGGGAACGCTGTCTATGCTAAACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTCAGTGTCCGGCCCAGTCGCAGTATC
                                                  Xt7.1-CHK-1008266586                                  CTTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGxxCAxxGGGGGTGATTATCCCGGGxxxxCTGxxxxxGxxxxACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTCAGTGTCCGGCCCAGTCGC
                                                      consensus depths                                 4     6    12    13    16    16    18    18    19    19    20    20    20    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    21    20    21    20    21    20    21    20    21    21    22    18    21    18    20    17    19    17    19    10    16    10    13    10    12    10    11    10    12    10    12    10    12    10    11     5    11     5    11     4    11     4    10     4    10     4    10     4    10     4     8     4     8     4     5     4     6     4     6     4     6     4     6     2     4     2     3
  5   1   2                                           Xt7.1-XZG56583.5                CCACGCGTCCGCTTTGTGCTTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCCAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAATTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCGCATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCAATACGCACAATAGAACTGCATCGCACAGGGTTTTTTTTTTTTTTACAGAATAAATGAATGTGGCGGGATACAGACATAAC
  5   1   2  SIG                                    Xt7.1-TNeu141o23.5                                    TGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAAGGGGGGTGATTATCCCGGGCGGACTGATACAGTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGAGTTCAATAAACCTCATAACGGGA
  5   1   2                                             Xt7.1-st9c05.5                                    GGATTTACTCCTGAGAACATGTCCGGAAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGGTTGTTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACACTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCTGAGTGACGAGTAGAACTACAGAAACCCAAAGGCTCTTCT
  5   1   2  SIG                                       Xt7.1-st45a13.5                                              TGGGGATCATGTCCGGCAGAGGGAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCATATAGTCACTGAATTGTAAAAACGCTGTCTATGCTAAACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTCAGTGTCCGGCCCAGTCGCAGTATCGCAGGGGGAAGCTAATATTTAGCGATNTGAGAACTAATCTGTTAGTTACACGGGGGGGGGGCTGATACAGTCGCACTGCCAATAACAGGGAGGGACACAATGTTGCTATTCGGGCTGCAATTGATTTCTGCGTCGGTGAAATAATGTATCGGGGTAACAGGGGATCTGAGGGCCCCCCACTTCTCCTTATTCTCTGATCCCAGCGGAGCTTCCCAGTGCGGAGTCGGATGTAACAGGGAACTGATTGAGGGAATTTCTGGATTCGGGGCTCAGAGATTACATACAGGGAATATGAATGTGATTCCCAGAGATTAGTGGGAACATTCAGCAAATACGTTTTGTGGTTTTGATTTTGCTGTCCAGTTACTGTATATAGTC
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCATATAGTCACTGAATTGTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGACTGATACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAACGGGAGCTG
                                                                   SNP                                        ---------C--
                                                                   SNP                                                                ----G-------
                                                                   SNP                                                                                                                                                                            -----C------
                                                                   SNP                                                                                                                                                                                                                                                    ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------A-
                                               BLH ATG      26     675                            
                                               BLH MIN      26      72                            
                                               BLH MPR      23      72                            
                                               BLH OVR      26      96                            
                                               EST CLI       7      46                            
                                               ORF LNG      26       1                            
                                                                                                                         PROTEIN -== Sc ==== 7e-049     NP_009552.1 Histone H2A (HTA1 and HTA2 code for nearly identical proteins); Hta2p[Saccharomyces cerevisiae] ========================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Ce ==== 3e-054     NP_505463.1 Histone HIS-35 (13.4 kD) (his-35) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Dm ==== 8e-057     NP_724343.1 CG31618-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = Sp ==== 3e-057     XP_790098.1 PREDICTED: similar to CG31618-PA [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Gg ==== 9e-062     NP_001025924.1 histone H2A [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = Dr ==== 3e-062     XP_699230.1 PREDICTED: similar to histone H2A [Danio rerio] ===========================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED = Mm ==== 1e-063     XP_891398.1 PREDICTED: similar to histone H2A [Mus musculus] ==========================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Hs ==== 4e-064     NP_778235.1 histone H2A [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Xt ==== 2e-065     AAH74601.1 MGC69325 protein [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === Xl ==== 7e-066     AAH77427.1 MGC82198 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN === ?? ==== 7e-066     NP_001086775.1 MGC82198 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu141o23.5.5                                    TGA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TGA---------------TAA------------------------------------------------TGA------------------------------------------------------------------------TGA------------------------------------------------------------------------ATG---------------------------TAG---------------------------------------TAG
                                                                   ORF                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2                                           Xt7.1-XZG56583.5                CCACGCGTCCGCTTTGTGCTTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCCAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAATTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCGCATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCAATACGCACAATAGAACTGCATCGCACAGGGTTTTTTTTTTTTTTACAGAATAAATGAATGTGGCGGGATACAGACATAAC
                                                  Xt7.1-CHK-1008295652                      GTCCGCTTTGTGCTTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCCAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAATTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCGCATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCAATACGCACAATAGAACTGCATCGCACAGGGTTTTTTTTTTTTTTACAGAATAAATGAATGTGGCGGGATACAGA
  3   1   4      seed Gas7 5g3  in                         XZG56583.3p                CCACGCGTCCGCTTTGTGCTTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCCAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAATTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCGCATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCAATACGCACAATAGAACTGCATCGCACAGGGTTTTTTTTTTTTTTACAGAATAAATGAATGTGGCGGGATACAGACATAACGT
  5   1   4   12 seed Gas7 5g3  in                         XZG56583.5p ..........................CTTTGTGCTTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCCAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAATTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCGCATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCAATACGCACAATAGAACTGCATCGCACAGGGTTTTTTTTTTTTTTACAGAATAAATGAATGTGGCGGGATACAGACATAACGTTAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2  SIG                                    Xt7.1-TNeu141o23.5                                    TGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAAGGGGGGTGATTATCCCGGGCGGACTGATACAGTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGAGTTCAATAAACCTCATAACGGGA
                                                  Xt7.1-CHK-1008295650                                          GTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAAGGGGGGTGATTATCCCGGGCGGACTGATACAGTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGAGTTCAATAAACCTCATAACGGGAGCTGCA
  5   1   2       ext Gas  5g                        TGas010e23.p1kSP6 CGTAANAACGCTACATTCTTCTGTTTCTTTGTAGCTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTC
  3   1   3        nb Gas7 5g3  in                         XZG37957.3p                        CCACGCGTCCGCTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCAGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTAATAAAG
  3   1   2       ext Gas  FL   out                   TGas065d24.q1kT7                           CTTTGTGCTTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCCAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAATTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTTCAGA
  3   1   4      seed Gas7 5g3  in                         XZG31778.3p                            CCACGCGTCCGGTTGTATTGGCGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCAGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAAGGGGGGTGATTATCCCGGGCGGACTGATACAGTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGAGTTCAATAAACCTCATAACGGGAGCTGCAATG
  5   1   3        nb Neu  5g                        TNeu141o23.p1cSP6                                   CTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTAAAAT
  5   1   3   12   nb Gas7 5g3  in                         XZG37957.5p ..................................CTGAGTTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCAGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTAATAAAGAAATAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas  5g   ?                    TGas119n13.p1kSP6                                    TGAGTTGTATTGGCGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCAGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAAGGGGGGTGATTATCCCGGGCGGACTGATACAGTCGCACTGCC
  3   1   3        nb Gas8 5g3  in                          st35g23.3p                                     GAGTTGTATTGGGGATCATGTCCGGCAGAGGGAAACAAGGCGGCAAGGTTCGGGATAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTNTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGANCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAANA
  5   1   4   12 seed Gas7 5g3  in                         XZG31778.5p ......................................GTTGTATTGGCGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCAGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAAGGGGGGTGATTATCCCGGGCGGACTGATACAGTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGAGTTCAATAAACCTCATAACGGGAGCTGCAATTGAAAAAAAAAAAAAAAAAGG
  5   1   3        nb Neu                            TNeu017a12.p1kSP6                                        TTGTATTGGGGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACAATAAAGAAAAAAAAAATT
  5   1   3        nb Gas8 5x3                              st17a16.5p                                             TTGGCGATCATGTCCGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAAGGGGGGTGATTATCCCGGGCAGACTGATACAGTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGGGGTTCAATAAACCTCATAACGGCAAAAAAAAAA
  5   1   2       add Neu       ?                   TNeu067i01.p1caSP6                                                         CGGGGCAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCAAAAAAAAAAAAAAAAAAAAgcggccgcttttttttttttttttttctaaaagctccttttgggaatgaaaattttttaaaa
  5   1   3        nb Gas8 5g3  in                          st35g23.5p                                                                            GCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACAAAAAATANNA
  3   1   3        nb Gas8      out                         st56h21.3p                                                                             CGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCCAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGGCGGCCAAGGGCAAGTAACGCTCCGAACGACAAGTCAA
  5  -1   2       ext Neu                            TNeu011n04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCAGGGCAGGGGGGTGACTATCCCGGGCAGACTGGTACAGTCGCACTGCCGGTAACACGGAGGGACACAATGTTGCTGTTTGGAGTTCAATAAACCTCGTAACGGGAGCTGCAATTGATTGGTTGGTGAAATAATGTATCGGGGTAAAGGGATCTGAGTGTCCCCCAACTTCTCCTTATTCTCTGATCAGAACTAAATGCCCCGCACTCAGTGTGGCCCTTCCCTGAATGCTGCAGCCGAGGGCCCCCGCCCATTCCCTTTATACCCGCC
  5   1   0       add Gas8      out                         st77e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGGGGGTGATTATCCCGGGCAGACTGATACAGTTCGCACTGCCGGTAACAGGGAGGGACACAATGTTGCTGTTTGGGGGTTCAATAAACCTCATAACGGGAGCTGCAATTGATTTCTGAGTTGGTGAAATAATGTATCGGGGTAAAGGGATCTGAGTGTCCCCCAACTTCTCCTTATTCTCTGATCCCAGGGGAGTCGGATGTTACAGGGAACTGATTTTGAGGGGATTTCTGAATTTGTAATTTTTATGATTTGGGGCTCAGATTATATACAGGGAATATGAATGTGATTCCCACAGATTAGTGGGAACATTCAACAAATAAGTTTTGTGGTTTTGATTGTGTTTCCAGTTACTGTATATAGTCCCTAGTGCGCCCCTTCTGCCAACACTGCAACTCCCCGGGCCCCTACTCTGCCAGGGAGGTACCGGCCTCAGGCTCTTGTCTTCTTGGGAATAAAAGTATCTGCCCTTATCCCTCTCTCGTCTGGGAACCCAATACCCCCCCCCCCCCCCNGGA
  5   1   2                                             Xt7.1-st9c05.5                                    GGATTTACTCCTGAGAACATGTCCGGAAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGGTTGTTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACACTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCTGAGTGACGAGTAGAACTACAGAAACCCAAAGGCTCTTCT
                                                  Xt7.1-CHK-1008295656                                          ACTCCTGAGAACATGTCCGGAAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGGTTGTTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACACTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCTGAGTGACGAGTAGAACTACAGAAACCCAAAGGCTCTTCTCAGAGC
  3   1   4      seed Gas8      in                           st9c05.3p                                    GGATTTACTCCTGAGAACATGTCCGGAAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGGTTGTTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACACTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCTGA
  5   1   4      seed Gas8      in                           st9c05.5p                                                     CATGTCCGGAAGAGGCAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGGTTGTTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACACTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCTGAGTGACGAGTAGAACTACAGAAACCCAAAGGCTCTTCTCAGAGCCGAA
  5   1   2  SIG                                       Xt7.1-st45a13.5                                              TGGGGATCATGTCCGGCAGAGGGAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCATATAGTCACTGAATTGTAAAAACGCTGTCTATGCTAAACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTCAGTGTCCGGCCCAGTCGCAGTATCGCAGGGGGAAGCTAATATTTAGCGATNTGAGAACTAATCTGTTAGTTACACGGGGGGGGGGCTGATACAGTCGCACTGCCAATAACAGGGAGGGACACAATGTTGCTATTCGGGCTGCAATTGATTTCTGCGTCGGTGAAATAATGTATCGGGGTAACAGGGGATCTGAGGGCCCCCCACTTCTCCTTATTCTCTGATCCCAGCGGAGCTTCCCAGTGCGGAGTCGGATGTAACAGGGAACTGATTGAGGGAATTTCTGGATTCGGGGCTCAGAGATTACATACAGGGAATATGAATGTGATTCCCAGAGATTAGTGGGAACATTCAGCAAATACGTTTTGTGGTTTTGATTTTGCTGTCCAGTTACTGTATATAGTC
                                                  Xt7.1-CHK-1008295654                                                    TCATGTCCGGCAGAGGGAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCATATAGTCACTGAATTGTAAAAACGCTGTCTATGCTAAACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTCAGTGTCCGGCCCAGTCGCAGTATCGCAGGGGGAAGCTAATATTTAGCGATNTGAGAACTAATCTGTTAGTTACACGGGGGGGGGGCTGATACAGTCGCACTGCCAATAACAGGGAGGGACACAATGTTGCTATTCGGGCTGCAATTGATTTCTGCGTCGGTGAAATAATGTATCGGGGTAACAGGGGATCTGAGGGCCCCCCACTTCTCCTTATTCTCTGATCCCAGCGGAGCTTCCCAGTGCGGAGTCGGATGTAACAGGGAACTGATTGAGGGAATTTCTGGATTCGGGGCTCAGAGATTACATACAGGGAATATGAATGTGATTCCCAGAGATTAGTGGGAACATTCAGCAAATACGTTTTGTGGTTTTGATTTTGCTGTCCAGTTACTGTAT
  5   1   4      seed Gas8 5g3  in                          st64e09.5p                                              TGGGGATCATGTCCGGCAGAGGGAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCATATAGTCACTGAATTGTAAAAACGCTGTCTATGCTAAACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTCAGTG
  5   1   2       ext Gas8 5g3  in                          st45a13.5p                                                GGGATCATGTCCGGCAGAGGGAAACAAGGCGGCAAGGTTCGGGCTAAGGCCAAGACCCGCTCATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCATATAGTCACTGAATTGTAAAAACGCTGTCTATGCTAAACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTCAGTGTCCGGCCCAGTCGCAGTATC
  3   1   2       ext Gas8 5g3  in                          st45a13.3p                                                                                                             CATCCCGGGCTGGGCTGCAGTTCCCAGTTGGCCGTGTTCACCGCTTGCTGAGGAAAGGCAATTATGCCGAGCGGGTGGGAGCCGGAGCTCCGGTCTATCTGGCCGCAGTACTCGAGTACCTGACCGCTGAGATCCTGGAGTTGGCCGGGAACGCTGCCCGGGATAACAAGAAGACCCGCATCATCCCCAGGCACCTGCAGCTCGCTGTGCGCAACGATGAGGAGCTGAACAAACTGCTCGGAGGGGTGACTATCGCTCAGGGCGGGGTCCTGCCCAACATCCAGTCCGTGCTGCTGCCCAAGAAAGCCGAGAGCTCCAAGCCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTCTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCATATAGTCACTGAATTGTAAAAACGCTGTCTATGCTAAACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTC
  3   1   4      seed Gas8 5g3  in                          st64e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGCCAAGGGCAAGTAACGCTCCGAACGATGAACTNTAAGCATCAAATAACCCAAAGGCTCTTCTCAGAGCCACTCACATTATCTAAACACGGCTGTGTGACACATACGGGTAAATCTGACTGCTGATCCGCTCATAAACCCAAAGGCTCCTCTCAGAGCCGCCCATATAGTCACTGAATTGTAAAAACGCTGTCTATGCTAAACGTTCTCTATAGCTTTCAATTTAATATACATTTATTGCCAAGAAATGGACAAACTCCGTTGTAATTTGCTTATTTAGCCCATAGACTCTTCCCCCAAACACAGACATACGCTCCCATAGGTTGGTCAGTGTCCGGCCCAGTCGCAGTATCGCAGGGGGAAGCTAATATTTAGCGATNTGAGAACTAATCTGTTAGTTACACGGGGGGGGGGCTGATACAGTCGCACTGCCAATAACAGGGAGGGACACAATGTTGCTATTCGGGCTGCAATTGATTTCTGCGTCGGTGAAATAATGTATCGGGGTAACAGGGGATCTGAGGGCCCCCCACTTCTCCTTATTCTCTGATCCCAGCGGAGCTTCCCAGTGCGGAGTCGGATGTAACAGGGAACTGATTGAGGGAATTTCTGGATTCGGGGCTCAGAGATTACATACAGGGAATATGAATGTGATTCCCAGAGATTAGTGGGAACATTCAGCAAATACGTTTTGTGGTTTTGATTTTGCTGTCCAGTTACTGTATATAGTCAGTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)