Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC11374.5.5                        32 END     2           8        6                (no blast hit)
     2   2.0    0Xt7.1-CAAJ11781.5                           4 END     1           4       25                similar to histone deacetylase 7A isoform a [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012154924 Xt7.1-CABE6177.3.5 - 25 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABE6177.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCACTCGATGTGCTAACGATCCCCTTGATGCCAGGTGGGCATCGGCCTCTTTCCCGAGCAAAGTCCTCTCCAGCCTCCGCATCTCTGCCAGCTCAAGAGCCTTCTGCCAAAGCAATGTCAATTCCTATGCCGGAACAAGCTACCAAGCCTCGCTTCACTACAGGAATTGTGTATGACTCAGTAATGCTGAAACACCAGTGTACTTGTGGGGACAACAGCAATCATCCAGAGCATGCTGGGAGAATCCAGAGCATCTGGTCCCGCTTACAAGAGAGAGGATTACGCAATAATTGTGAATGCATCCGGGGAAGGAAGGCTACATTAGAGGAGCTGCAGTCTGTGCACACAGAGACCCATGTCCTGCTCTATGGAACTAATCCCCTCAACAGACTCAAACTGGATAACCGCAAGCTTGCAGGAATTCTGTCCCAGAGGATGTTTGTAATGCTGCCATGTGGAGGGCTTGGGGTGGACAGTGACACCATCTGGAATGAACTCCACTCCTCTAATGCAGCCCGCTGGGCAGCAGGCAGTGTCATTGACCTGGCATTTAAAGTTGCCAGCCGAGAGCTGAAGAACGGCTTTGCATTAGTCAGACCCCCAGGACATCATGCAGACCCCTCAACAGCCATGGGCTTCTGCTTCTTTAACTCAGTGGCCATTGCAGCAAAACAACTGCAACTAAGACGTGATGTAAGAAAGATCCTCATTGTAGACTGGGATGTACACCATGGAAACGGGACACAACGAGTATTTTACACAGACCCCAACGTGCTGTATATCTCATTGCATCGACATGATGATGGCAACTTTTTCCCGGGCAGTGGAGCAGCTGATGAGGTTGGTGCAGGCAATGGCGAAGGCTTTAATGTCAATGTTGCATGGACGGGTGGTTTGGATCCCCCAATGGGGGACGTGGAATACCTGACAGCCTTTCGGACGGTGGTAATGCCAATAGCCCATGAGTTCTCTCCAGATGTTGTCTTGGTTTCTGCTGGGTTTGATGCAGCTGAAGGGCATCCTGCTCCTCTTGGAGGATATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGC
                                                  Xt7.1-CHK-1008266138                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATGTGCTAACGATCCCCTTGATGCCAGGTGGGCATCGGCCTCTTTCCCGAGCAAAGTCCTCTCCAGCCTCCGCATCTCTGCCAGCTCAAGAGCCTTCTGCCAAAGCAATGTCAATTCCTATGCCGGAACAAGCTACCAAGCCTCGCTTCACTACAGGAATTGTGTATGACTCAGTAATGCTGAAACACCAGTGTACTTGTGGGGACAACAGCAATCATCCAGAGCATGCTGGGAGAATCCAGAGCATCTGGTCCCGCTTACAAGAGAGAGGATTACGCAATAATTGTGAATGCATCCGGGGAAGGAAGGCTACATTAGAGGAGCTGCAGTCTGTGCACACAGAGACCCATGTCCTGCTCTATGGAACTAATCCCCTCAACAGACTCAAACTGGATAACCGCAAGCTTGCAGGAATTCTGTCCCAGAGGATGTTTGTAATGCTGCCATGTGGAGGGCTTGGGGTGGACAGTGACACCATCTGGAATGAACTCCACTCCTCTAATGCAGCCCGCTGGGCAGCAGGCAGTGTCATTGACCTGGCATTTAAAGTTGCCAGCCGAGAGCTGAAGAACGGCTTTGCATTAGTCAGACCCCCAGGACATCATGCAGACCCCTCAACAGCCATGGGCTTCTGCTTCTTTAACTCAGTGGCCATTGCAGCAAAACAACTGCAACTAAGACGTGATGTAAGAAAGATCCTCATTGTAGACTGGGATGTACACCATGGAAACGGGACACAACGAGTATTTTACACAGACCCCAACGTGCTGTATATCTCATTGCATCGACATGATGATGGCAACTTTTTCCCGGGCAGTGGAGCAGCTGATGAGGTTGGTGCAGGCAATGGCGAAGGCTTTAATGTCAATGTTGCATGGACGGGTGGTTTGGATCCCCCAATGGGGGACGTGGAATACCTGACAGCCTTTCGGACGGTGGTAATGCCAATAGCCCATGAGTTCTCTCCAGATGTTGTCTTGGTTTCTGCTGGGTTTGATGCAGCTGAAGGGCATCCTGCTCCTCTTGGAGGATATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGTAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     4     4     5     4     5     4     5     4     5     5     6     5     6     5     6     7     8     6     7     6     7     7     7     7     7     7     9     8    10     8    10     9    11     9    11     9    11     9    11     9    11    10    12    10    12    10    12    10    12    10    12    10    12     9    11     8    11     9    11     9    11     9    11     8    11     9    11     9    11     8    11    11    13    11    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    11    13
  5   1   2      ests                                 Xt7.1-CAAN9093.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATGATGTGGGAGGAAATCCTGCCCGAGCGAGGTCAGAATCACTGCGAGTTGGGCAACATGAGACTCTCAGCAGCAGCCAACAAGCAATTCAGCAGCAACAGCAACAGCACTCCTTCCATCAGCAGGCCTATTTATATGAATCCAGCCTCCACAGACCTGTGAAACGGCCACTCGATGTGCTAACGATCCCCTTGATGCCAGGTGGGCATCGGCCTCTTTCCCGAGCAAAGTCCTCTCCAGCCTCCGCATCTCTGCCAGCTCAAGAGCCTTCTGCCAAAGCAATGTCAATTCCTATGCCGGAACAAGCTACCAAGCCTCGCTTCACTACAGGAATTGTGTATGACTCAGTAATGCTGAAACACCAGTGTACTTGTGGGGACAACAGCAATCATCCAGAGCATGCTGGGAGAATCCAGAGCATCTGGTCCCGCTTACAAGAGAGAGGATTACGCAATAATTGTGAATGCATCCGGGGAAGGAAGGCTACATTAGAGGAGCTGCAGTCTGTGCACACAGAGACCCATGTCCTGCTCTATGGAACTAATCCCCTCAACAGACTCAAACTGGATAACCGCAAGCTTGCAGGAATTCTGTCCCAGAGGATGTTTGTAATGCTGCCATGTGGAGGGCTTGGGGTGGACAGTGACACCATCTGGAATGAACTCCACTCCTCTAATGCAGCCCGCTGGGCAGCAGGCAGTGTCATTGACCTGGCATTTAAAGTTGCCAGCCGAGAGCTGAAGAACGGCTTTGCATTAGTCAGACCCCCAGGACATCATGCAGACCCCTCAACAGCCATGGGCTTCTGCTTCTTTAACTCAGTGGCCATTGCAGCAAAACAACTGCAACTAAGACGTGATGTAAGAAAGATCCTCATTGTAGACTGGGATGTACACCATGGAAACGGGACACAACGAGTATTTTACACAGACCCCAACGTGCTGTATATCTCATTGCATCGACATGATGATGGCAACTTTTTCCCGGGCAGTGGAGCAGCTGATGAGGTTGGTGCAGGCAATGGCGAAGGCTTTAATGTCAATGTTGCATGGACGGGTGGTTTGGA
  5   1   2      ests                                 Xt7.1-CABE6177.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCAATAGCCCATGAGTTCTCTCCAGATGTTGTCTTGGTTTCTGCTGGGTTTGATGCAGCTGAAGGGCATCCTGCTCCTCTTGGAGGATATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGTAAAAAAAAAAA
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 6e-024     CAJ81536.1 histone deacetylase 2 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Sc ---- 1e-069     NP_014377.1 component of histone deacetylase A; Hda1p [Saccharomyces cerevisiae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 4e-080     AAH43813.1 Similar to histone deacetylase 6 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 4e-080     NP_001080486.1 histone deacetylase 6 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-113     NP_510700.2 Histone DeAcetylase family member (hda-4) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-148     NP_727682.1 CG1770-PB [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 4e-156     XP_797761.2 PREDICTED: similar to histone deacetylase-4 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          NP_001034447.2 hypothetical protein LOC568877 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_062518.2 histone deacetylase 7A [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_057680.2 histone deacetylase 7A isoform b [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_001026573.1 similar to histone deacetylase 7A isoform a [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABE6177.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------TGA------------TAG------------------------------------ATG------------------------TAA------------------------TGA---------TAA---------------------TGA---------------TGA---------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------TGA---------------TAA---------TAG---------------------------------------------------------------TAG---------TGA---------------------------------------------------------------------------------------ATG---------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------ATGTAA------------------------------------------TAG---------------ATG---------------------------TAG---------------------------------------TAA------------------------------TGA---------------------------TGA------------TGA---------------------------------------------------------------------------------------------TAG---------------TAG---TAG---------------------TAA------------------------------------------------------TAG------------------------------------------------------------------------------------------ATG------------------TAG------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2      ests                                 Xt7.1-CAAN9093.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATGATGTGGGAGGAAATCCTGCCCGAGCGAGGTCAGAATCACTGCGAGTTGGGCAACATGAGACTCTCAGCAGCAGCCAACAAGCAATTCAGCAGCAACAGCAACAGCACTCCTTCCATCAGCAGGCCTATTTATATGAATCCAGCCTCCACAGACCTGTGAAACGGCCACTCGATGTGCTAACGATCCCCTTGATGCCAGGTGGGCATCGGCCTCTTTCCCGAGCAAAGTCCTCTCCAGCCTCCGCATCTCTGCCAGCTCAAGAGCCTTCTGCCAAAGCAATGTCAATTCCTATGCCGGAACAAGCTACCAAGCCTCGCTTCACTACAGGAATTGTGTATGACTCAGTAATGCTGAAACACCAGTGTACTTGTGGGGACAACAGCAATCATCCAGAGCATGCTGGGAGAATCCAGAGCATCTGGTCCCGCTTACAAGAGAGAGGATTACGCAATAATTGTGAATGCATCCGGGGAAGGAAGGCTACATTAGAGGAGCTGCAGTCTGTGCACACAGAGACCCATGTCCTGCTCTATGGAACTAATCCCCTCAACAGACTCAAACTGGATAACCGCAAGCTTGCAGGAATTCTGTCCCAGAGGATGTTTGTAATGCTGCCATGTGGAGGGCTTGGGGTGGACAGTGACACCATCTGGAATGAACTCCACTCCTCTAATGCAGCCCGCTGGGCAGCAGGCAGTGTCATTGACCTGGCATTTAAAGTTGCCAGCCGAGAGCTGAAGAACGGCTTTGCATTAGTCAGACCCCCAGGACATCATGCAGACCCCTCAACAGCCATGGGCTTCTGCTTCTTTAACTCAGTGGCCATTGCAGCAAAACAACTGCAACTAAGACGTGATGTAAGAAAGATCCTCATTGTAGACTGGGATGTACACCATGGAAACGGGACACAACGAGTATTTTACACAGACCCCAACGTGCTGTATATCTCATTGCATCGACATGATGATGGCAACTTTTTCCCGGGCAGTGGAGCAGCTGATGAGGTTGGTGCAGGCAATGGCGAAGGCTTTAATGTCAATGTTGCATGGACGGGTGGTTTGGA
                                                  Xt7.1-CHK-1008250260                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGGGAGGAAATCCTGCCCGAGCGAGGTCAGAATCACTGCGAGTTGGGCAACATGAGACTCTCAGCAGCAGCCAACAAGCAATTCAGCAGCAACAGCAACAGCACTCCTTCCATCAGCAGGCCTATTTATATGAATCCAGCCTCCACAGACCTGTGAAACGGCCACTCGATGTGCTAACGATCCCCTTGATGCCAGGTGGGCATCGGCCTCTTTCCCGAGCAAAGTCCTCTCCAGCCTCCGCATCTCTGCCAGCTCAAGAGCCTTCTGCCAAAGCAATGTCAATTCCTATGCCGGAACAAGCTACCAAGCCTCGCTTCACTACAGGAATTGTGTATGACTCAGTAATGCTGAAACACCAGTGTACTTGTGGGGACAACAGCAATCATCCAGAGCATGCTGGGAGAATCCAGAGCATCTGGTCCCGCTTACAAGAGAGAGGATTACGCAATAATTGTGAATGCATCCGGGGAAGGAAGGCTACATTAGAGGAGCTGCAGTCTGTGCACACAGAGACCCATGTCCTGCTCTATGGAACTAATCCCCTCAACAGACTCAAACTGGATAACCGCAAGCTTGCAGGAATTCTGTCCCAGAGGATGTTTGTAATGCTGCCATGTGGAGGGCTTGGGGTGGACAGTGACACCATCTGGAATGAACTCCACTCCTCTAATGCAGCCCGCTGGGCAGCAGGCAGTGTCATTGACCTGGCATTTAAAGTTGCCAGCCGAGAGCTGAAGAACGGCTTTGCATTAGTCAGACCCCCAGGACATCATGCAGACCCCTCAACAGCCATGGGCTTCTGCTTCTTTAACTCAGTGGCCATTGCAGCAAAACAACTGCAACTAAGACGTGATGTAAGAAAGATCCTCATTGTAGACTGGGATGTACACCATGGAAACGGGACACAACGAGTATTTTACACAGACCCCAACGTGCTGTATATCTCATTGCATCGACATGATGATGGCAACTTTTTCCCGGGCAGTGGAGCAGCTGATGAGGTTGGTGCAGGCAATGGCGAAGGCTTTAATGTCAATGTTGCATGGACGGGTGGTTTGGATCCCCC
  5   1   2       bld Te4  PIPE in                         CAAN1901.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATGATGTGGGAGGAAATCCTGCCCGAGCGAGGTCAGAATCACTGCGAGTTGGGCAACATGAGACTCTCAGCAGCAGCCAACAAGCAATTCAGCAGCAACAGCAACAGCACTCCTTCCATCAGCAGGCCTATTTATATGAATCCAGCCTCCACAGACCTGTGAAACGGCCACTCGATGTGCTAACGATCCCCTTGATGCCAGGTGGGCATCGGCCTCTTTCCCGAGCAAAGTCCTCTCCAGCCTCCGCATCTCTGCCAGCTCAAGAGCCTTCTGCCAAAGCAATGTCAATTCCTATGCCGGAACAAGCTACCAAGCCTCGCTTCACTACAGGAATTGTGTATGACTCAGTAATGCTGAAACACCAGTGTACTTGTGGGGACAACAGCAATCATCCAGAGCATGCTGGGAGAATCCAGAGCATCTGGTCCCGCTTACAAGAGAGAGGATTACGCAATAATTGTGAATGCATCCGGGGAAGGAAGGCTACATTAGAGGAGCTGCAGTCTGTGCACACAGAGACCCATGTCCTGCTCTATGGAACTAATCCCCTCAACAGACTCAAACTGGATAACCGCAAGCTTGCAGGAATTCTGTCCCAGAGGATGTTTGTAATGCTGCCATGTGGAGGGCTTGGGGTGGACAGTGACACCATCTGGAATGAACTCCACTCCTCTAATGCAGCCCGCTGGGCAGCAGGCAGTGTCATTGACCTGGCATTTAAAGTTGCCAGCCGAGAGCTGAAGAACGGCTTTGCATTAGTCAGACCCCCAGGACATCATGCAGACCCCTCAACAGCCATGGGCTTCTGCCTCTTTTACTCAGTGGGCATTGCAGCAAAACAACTGCAACTAAGACGTGATGT
  5   1   2       bld Gas                            TGas019o22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCTGTGAATCGGCCACTCGATGTGCTAACGATCCCCTTGATGCCAGGTGGGCATCGGCCTCTTTCCCGAGCAAAGTCCTCTCCAGCCTCCGCATCTCTGCCAGCTCAAGAGCCTTCTGCCAAAGCAATGTCAATTCCTATGCTGGAACAAGCTACCAAGCCTCGCTTCACTACAGGAATTGTGTATGACTCAGTAATGCTGAAACACCAGTGTACTTGTGGGGACAACAGCAATCATCCAGAGCATGCTGGGAGAATCCAGAGCATCTGGTCCCGCTTACAAGAGAGAGGATTACGCAATAATTGTGAATGCATCCGGGGAAGGAAGGCTACATTAGAGGAGCTGCAGTCTGTGCACACAGAGACCCATGTCCTGCTCTATGGAACTAATCCCCTCAACAGACTCAAACTGGATAACCGCAAGCTTGCAGGAATTCTGTCCCAGAGGATGTTTGTAATGCTGCCATGTGGAGGGCTTGGGGTGGACAGTGACACCATCTGGAATGAACTCCACTCCTCTAATGCAGCCCGCTGGGCAGCAGGCAGTGTCATTGACCTGGCATTTAAAGTTGCCAGCCGAGAGCTGAAGAACGGCTNTGCATTAGTCAGACCCCCAGGACATCATGCAGACCCCTCAACAGCCATGGGCTTCTGCTTCTTTAACTCAG
  5   1   2      seed Te4       in                         CAAN9093.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGCATCTCTGCCAGCTCAAGAGCCTTCTGCCAAAGCAATGTCAATTCCTATGCCGGAACAAGCTACCAAGCCTCGCTTCACTACAGGAATTGTGTATGACTCAGTAATGCTGAAACACCAGTGTACTTGTGGGGACAACAGCAATCATCCAGAGCATGCTGGGAGAATCCAGAGCATCTGGTCCCGCTTACAAGAGAGAGGATTACGCAATAATTGTGAATGCATCCGGGGAAGGAAGGCTACATTAGAGGAGCTGCAGTCTGTGCACACAGAGACCCATGTCCTGCTCTATGGAACTAATCCCCTCAACAGACTCAAACTGGATAACCGCAAGCTTGCAGGAATTCTGTCCCAGAGGATGTTTGTAATGCTGCCATGTGGAGGGCTTGGGGTGGACAGTGACACCATCTGGAATGAACTCCACTCCTCTAATGCAGCCCGCTGGGCAGCAGGCAGTGTCATTGACCTGGCATTTAAAGTTGCCAGCCGAGAGCTGAAGAACGGCTTTGCATTAGTCAGACCCCCAGGACATCATGCAGACCCCTCAACAGCCATGGGCTTCTGCTTCTTTAACTCAGTGGCCATTGCAGCAAAACAACTGCAACTAAGACGTGATGTAAGAAAGATCCTCATTGTAGACTGGGATGTACACCATGGAAACGGGACACAACGAGTATTTTACACAGACCCCAACGTGCTGTATATCTCATTGCATCGACATGATGATGGCAACTTTTTCCCGGGCAGTGGAGCAGCTGATGAGGTTGGTGCAGGCAATGGCGAAGGCTTTAATGTCAATGTTGCATGGACGGGTGGTTTGGATCCCCCCA
  5   1   2      ests                                 Xt7.1-CABE6177.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCAATAGCCCATGAGTTCTCTCCAGATGTTGTCTTGGTTTCTGCTGGGTTTGATGCAGCTGAAGGGCATCCTGCTCCTCTTGGAGGATATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGTAAAAAAAAAAA
                                                  Xt7.1-CHK-1008230014                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGCCCATGAGTTCTCTCCAGATGTTGTCTTGGTTTCTGCTGGGTTTGATGCAGCTGAAGGGCATCCTGCTCCTCTTGGAGGATATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGTAAxxAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG27216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTAGACTGGGATGTACACCATGGAAACGGGACACAACGAGTATTTTACACAGACCCCAACGTGCTGTATATCTCATTGCATCGACATGATGATGGCAACTTTTTCCCGGGCAGTGGAGCAGCTGATGAGGTTGGTGCAGGCAATGGCGAAGGCTTTAATGTCAATGTTGCATGGACGGGTGGTTTGGATCCCCCAATGGGGGACGTGGAATACCTGACAGCCTTTCGGACGGTGGTAATGCCAATAGCCCATGAGTTCTCTCCAGATGTTGTCTTGGTTTCTGCTGGGTTTGATGCAGCTGAAGGGCATCCTGCTCCTCTTGGAGGATATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGG
  3  -1   2       bld TbA                             TTbA039d19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCAATAGCCCATGAGTTCTCTCCAGATGTTGTCTTGGTTTCTGCTGGGTTTGATGCAGCTGAAGGGCATCCTGCTCCTCTTGGAGGATATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATA
  5   1   2       bld Te5                                  CAAO5661.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTGGTTTCTGCTGGGTTTGATGCAGCTGAAGGGCATCCTGCTCCTCTTGGAGGATATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATT
  5   1   2       bld Tad5      in                         XZT21465.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAAAGTCACAGCAAAATGCTTCGGGCACATGACACGGCAGCTTATGAGCTTAGCAGGAGGCCGAGTGGTGCTTGCTCTGGAGGGTGGCCATGATCTCACATCTATATGTGATGCTTCAGAGGCCTGTGTCTCTGCCCTGCTGGGAAATGAGCTGGATCCCCTCCCTGAAGAGACGTTAAGGCAGAGGCCCAACCAAAATGCTGTGTGTTCTTTGGAAACCGTCATACATGTCCAAAGTAAATACTGGACATCGGTCAAACAGTTTGCTTCCAAGGTTCAATACACCCTTCTGGAAGCCCAGAAACATGATCGGGACGAAGTGGACACAGTGACAGCTTTAGCCTCCTTGTCAGTTGGAAGGGGATCTATTGCAGTAGCTGGGAACAGGCCTCAGGAAGAGCCAATGGAGGAAGATGAACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCTCCCAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGC
  5   1   2       bld Gas       in                   TGas088k06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACCCATGAGTTTATGATGGGGAAGAAGATAGGTGTTGATTTGGTTGTATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCT
  5   1   2       bld Int1      out                       CAAP14011.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATCCCTTCAGCCCCGCAACCATGGGGCAGTTTGCGTCATTATTTCCTTAAAATAACGATACTGTCCCATTTGTGTGAGTCCATGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATG
  5   1   2       bld Gas7      in                         XZG16504.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGATCCGATTAAAGTCTTGATGGTGACTATACCTGAAGAGAACTGAGATGTTGAATTTGCTTGACCCAAGATGTTGCTCGGGCAAGTTGATGGTTGAGGGATTATCAAACAGACAATGGAAGACTATGTATATTGTCAGTATATACAATATTTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGCGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATC
  5   1   2       bld Ova1      in                         CABE6177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTACCTTTAAACAACAATTAAAAAATTGCCTGCCCCAAAGTGACAGTAAATGTGCTCTATCTTTTGAAGAACCTCCACGTGATAGTTGACTCCTTAATGTCAGGATCTGATGGATATCCGCGAGTTAAGCATGTTTTTAGGGCGTAATACTCATTACCAAGCCGAGAAATCCTACATCACCAATAGCATTTGAAGAACATCAGTAGATACTGGTGTGACCTCCTACCAAAAGAGCTGTATTGAGACGGAAACCTTGCCTTCCATACCCCAGCAGATATCCTCTTCTACAGACCACTCCGTTTAAAATGCTTGGACTGTTTGTGCCTTGCACACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATG
  5   1   2       bld AbdN                               IMAGE:7024438                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGACTGTTTGTGCCTTGCCACTGGGAACTCCCTTGTATCCTATATACTCCTCGTGACCACTAATACCGAAGTCTTACGGATTGTGTTTTGTTCATTTGCACTATGGGGAGAAACTCCCCACAACCACAAGAAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTTGTAATTAAGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAAGGATATTTTAGTTCCCCCTTGAAGAATCTTGAAAGGAAAAATTCTATTGGTGGCATGGGTTGTATTCCCCTAACAGAATCAAGGGGATGCCCCCCCCTTTGCTGATTCGGGGAAATCAGTCTTTAACAAGTAAAAAACTTTTGTTTCCGCCCAAAAATTGAACCGGGCTTTAAAATGGGGGAAAGC
  3   1   2       bld Ova1      in                         CABE6177.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAACAATATGGGGACAATTTAAAAACCGTTTTCAATGTTAAAGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTGTTGGCTGT
  3   1   2       bld Gas       in                    TGas088k06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGAGGCTGTATACAGAATCACTATGTACACAAAATTGACTTTTTTTTGCTGTATTATTGATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCGAAACCCATGGAAAATAAAAATTTTCTTGGCGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4  PIPE in                         CAAN1901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGTATTATGNATGCTTATTAAGATTTGTTCTGGATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCGT
  3   1   2      seed Gas7      in                         XZG27216.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGT
  3   1   2       bld Te3       out                       CAAM14183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAATGTAATATCAAAGTTATCAATCTCCATATGGGCCGGGGACAAGAATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGTAATCAC
  5   1   2       bld Bone      in                       CBTC11124.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTAGGAGCAGNCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTANACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGC
  3   1   2       bld Bone      in                       CBTC11124.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTAGGAGCAGCTTTTTGAAATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGC
  3   1   2       bld Tad5      in                         XZT21465.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGGTTAGTGATGCACATATAATATTGACATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGTAATCAC
  3   1   2       bld Gas7      in                         XZG16504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATAGAAGAAAATATTTTTGAGTTTTGGTCTGTCCATTATTTTTTAATGGTGTTGGGTTAGTTATACCCAACCCCTGTGATTTTATATATGTACAGTATATGTGCAATGATTAGACTATGGCTGATCCAGCACTTCTAATGAAACACCCGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGCATCAGTGTCCCCCCATATTGCTGTAGCCTCCCTTTAGTAGTTAGGTGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTG
  3   1   2       bld Te4       in                         CAAN9093.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTTAGTTATACCCAACCCCTGTGATTTTATATATGTCCAGTATATGTGCAATGATTAGACTATGGGTGATCCAGCACTTTTAATGAAACCCCTGGAATCGCTGTAGGCTGCACATGTGCTGTTGAAGGTTTTATTAAGGATCAGGGTCCCCCCATATTGCGGTAGCCTCCCTTTAGTAGTTAGGGGTAGGCCCTGACAAAGACTGTTATTTAACCCCTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTTTATTGGGGCAGGGGTTGTTTTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTTTTTCCAGGTAGAGCTTTGTTTTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATTTCGCATGCTGTAGTTTTAGGCTGTAAAGTGTTGGGGGCATATGCCTTAAACCGGGGTTTTGGATTTATGTCTTTTTTACAGAACAAGTGTTGTTTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCCTGGAAAATAAAAATTTTTTTGGCGGT
  3   1   2       bld Sto1      in                         CABG8240.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGT
  5   1   2       bld Sto1      in                         CABG8240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTAGGCCCTGACAAAGACTGTTATCTAACCACTACACAAGGAGCCTGCCCTCCATATTTGCACGCCTTGTTTAGGGATATTTTAGTTCCCCTTGAAGAATCTTGAAGGAAAAATTCTATTGGTGCAGTGGTTGTATTCCATAACAGAATCAAGGGATGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ovi1      out                        CABI4608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCATCGATTCGTGCCCCCCCTTTGCTGATCATGGCAATCAGTCTTACCAGGTAGAGCTTTGTTCTGCCAAGAATGAGCAGGCTTAAATGGGGAAAGCTAAAGCCAATCTCGCATGCTGTAGTCTTAGGCTGTAAAGTGTTGGGTGCATATGCCTTAAACCTGGGTTTTGGATTTATGTCTTTTCTACAGAACAAGTGTTGTCTATTTTTGCACATACAGTCCTGTTAATAAGCAAAACCATGGAAAATAAAAATTTTCTTGGCTGTAATCACACTAGTTTTCTTCTAGGGTTGTGTGTGTATATATATAATATATATACAGCCGCTGCCCCTACTGTGGCACATTCCCATGATAGAACAGTAGATGTTCCCAACACGACAGATCAGTAGATGCTCCTATTTAAGTAATAAGGGCTTCAGCATGACGGTAAGGAACCCAGGTGCATTCTGGGGACACTAAATAAAAGTACAGAACCCCATTTAATTTGAGGGTGTTAACTGACCACTGCTTTTGTTTAGTACTGCTTATCCCCAGCTAGATTTTCCACCAGCTAAATCCACAGTAACATCTTTGAAGTGATTGCAGTTGGGGGGAAAAACTAACTGCATACCCCCTTAAGTTCTCCCACATCACATATTGTACCCCTGTCAGGTGTGATGACTTGCAAAGCGTGAGAAGCTAAAGTGTAAATCAAAGCAAACAGCTGCCTAAATCCCAAGCTCGCAGGGACCTCCAGATCAAAAACAATCTTTTCCTCCCCTGGGATCAAGGCTGCGCTCCCCTCCTGTTCTCTCTTCCCTTTGCCCATTCGCAGTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)