Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     11617.0    0Xt7.1-CABJ7825.3.5                         14 PI      97         39      956                MGC88898 protein [Xenopus tropicalis]
     2 794.0    0Xt7.1-CABJ2457.5                            9 PI      81         66      954                MGC88898 protein [Xenopus tropicalis]
     3 227.0    0Xt7.1-XZT5571.5.5                           4 PI      87        692      883                PREDICTED: hypothetical protein [Gallus gallus]
     4 983.0    0Xt7.1-CBSU590.5                             2 PI      86         64      933                MGC88898 protein [Xenopus tropicalis]
     5 593.0    0Xt7.1-CABJ11546.5                           2 PI      83        259      872                MGC88898 protein [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     6  29.0    0(repeat)                                    0 REP     83        965     2286                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012155013 Xt7.1-CABJ4020.3.5 - 20 ESTs
                                                                       .........-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABJ4020.3.5                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCGAGCGAAGAGCTGCCTGCCTCAAAAAGAAAGGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAATACCGAATTTTTCGAGTTGAAAGTATTGTTAAGACTCAAAAAATTGGAGTTTAAATGGATGTTCGTTTCCATAAATTCTCTTTATTTTTCCTAAACAGGAAGTGCTCCAGCAGCCATTTTAGGACCATTGGCACTCATTCTTGGAAAACAATAATGTGTTTAATTTTCACTTGAAACTGGGTGAAATAGAAAACAATAATGAGATGAACTTCCCCATGAAACTGGGTGAAATAGAAAACAAAGACGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGATGAGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCGAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACCATTGTTATCATCAATTAAATAAAGATAAGTTTATACTTTATCTGCAA
                                                  Xt7.1-CHK-1008266616                                                                                                                                                                                                                                                                                                                                                                                                                                GCGAAGAGCTGCCTGCCTCAAAAAGAAAGGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAATACCGAATTTTTCGAGTTGAAAGTATTGTTAAGACTCAAAAAATTGGAGTTTAAATGGATGTTCGTTTCCATAAATTCTCTTTATTTTTCCTAAACAGGAAGTGCTCCAGCAGCCATTTTAGGACCATTGGCACTCATTCTTGGAAAACAATAATGTGTTTAATTTTCACTTGAAACTGGGTGAAATAGAAAACAATAATGAGATGAACTTCCCCATGAAACTGGGTGAAATAGAAAACAAAGACGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGATGAGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCGAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACCATTGTTATCATCAATTAAATAAAGATAAGTTTATACTTTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                               2     4     2     5     2     5     3     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     5     6     4     6     4     6     4     6     3     6     3     6     3     6     3     6     3     6     3     5     4     6     4     6     4     6     4     6     4     6     4     5     4     5     4     5     4     5     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     6     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9    10     9    10     9    10     9    10     9    10     9    10     8     9     9     9     9     9     9     9     9     9     9     9     9     9    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    11    11    10    11    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     7     7     3     3     3     3     3     3     2     2     2     2     2     2     2     2
  5   1   2      ests                            Xt7.1-IMAGE:6998706.5                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCGAGCGAAGAGCTGCCTGCCTCAAAAAGAAAGGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAA
  5   1   2      ests                                 Xt7.1-CABJ4020.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGTGCTCCAGCAGCCATTTTAGGACCATTGGCACTCATTCTTGGAAAACAATAATGTGTTTAATTTTCACTTGAAACTGGGTGAAATAGAAAACAATAATGAGATGAACTTCCCCATGAAACTGGGTGAAATAGAAAACAAAGACGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGATGAGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCGAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACCATTGTTATCATCAATTAAATAAAGATAAGTTTATACT
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --A---------
                                               BLH ATG      73     341                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN      73      45                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH MPR      55      45                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               BLH OVR      73     129                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               CDS MIN      73      45                                                                                                                                                                                                                                                                                                                                                                                                                          
                                               ORF LNG      73      10                                                                                                                                                                                                                                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Dr ==== 8e-021     NP_956653.1 hypothetical protein MGC64002 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 4e-037     NP_006160.1 nicotinamide N-methyltransferase [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 3e-038     NP_035054.1 nicotinamide N-methyltransferase [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 2e-082     AAH78562.1 MGC85443 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 2e-082     NP_001087328.1 MGC85443 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 3e-152     AAH81287.1 MGC88898 protein [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ4020.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATG------------------------------------------------TAG------TGA---------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------ATG------------------------------TAA---------------------------------------------------------TAA------TAA------------------TGA------------TAATGA------------------------TGA---------------------TAA------------------TGA------------TGATGA---TAA------------------TGA------------TGA------TAA------------------TGA------------TGA------TAA------------------TGA------------TGA------TAA------------------TGA------------TGA------TAA------------------TGA------------TGA------TAA------------------TGA------------TGA------TAA------------------TGA------------TGA------TAA------------------------------------TGA---------------------------------------------------------------------------------------TAA------------------TGA---------------------TAG---------------------------ATG---------------------------------------TAG---TAA------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TAG---------------------ATG------------ATGTGAATG------------------------------TAA------------------ATG------------------TAATAA---------ATG---------------------------------TGA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   1           AbdN FL                     IMAGE:6998706.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                              CAAGGAGCCACATCTCGAGCGAAGAGCTGCCTGCCTCAAAAAGAAAGGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGTACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAATACCGAATTTTTCGAGTTGAAAGTATTGTTAAGACTCAAAAAATTGGAGTTTAAATGGATGTTCGTTTCCATAAATTCTCTTTATTTTTCCTAAACAGGAAGTGCTCCAGCAGCCATTTTAGGACCATTGGCACTCATTCTTGGAAAACAATAATGTGTTTAATTTTCACTTGAAACTGGGTGAAATAGAAAACAATAATGAGATGAACTTCCCCATGAAACTGGGTGAAATAGAAAACAAAGACGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGATGAGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCGAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACCATTGTTATCATCAATTAAATAAAGATAAGTTTATACTTTATCTGCAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                            Xt7.1-IMAGE:6998706.5                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCGAGCGAAGAGCTGCCTGCCTCAAAAAGAAAGGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAA
                                                  Xt7.1-CHK-1008237343                                                                                                                                                                                                                                                                                                                                                                                                                                GCGAAGAGCTGCCTGCCTCAAAAAGAAAGGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAATACCGA
  5  -1   2       bld Kid1      ?                         CABA11316.5p attatatcttagttgggatcaagtacaggtactgttttattattacagaggaaagggaatcatttaaccatgaaataaacacaataggactgttctgcccccaaaaaggggtaatttcattttccctgtttcgtggtttttttggcgttttgtgaatctttccaaagattcgcaaattttccagcgaagcaaaaacgggacagattcgctcgtcaTTATTGATAATGACAATTGATCTCTGTGGCTTTGCTGCTATAATGTTTTCTGTTGGTAATTATAAATCAATAAAAAGTAGTAAAACCTGAAATATTAATTGAATAATATATTTCTTTGTTTTTTTACATTTTGCTTATGTTTAAAAGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGTATGACTTTTTTGCTGACTTTAGGGATGTACGATCTGTAGGGTCGTTCTTATATTTATATTTTTACTTTTTATTTGATACAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGGTG
  5   1   2       add AbdN 5g                            IMAGE:7021634                                                                                                                                                                                                                                                                                                                                                                                      TTGTTCATCCTCTTCTGTCATAGGAGAAGAAGCCATTAGGTGACCTATAGAAAAGTTTCGTCCGGATTCCCGGGATTTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTTCAGTATTCAATATCTCTTACTTTTATGTTAGGCCAAACACAGTTTTTCCGCCCTGACATGTGAATGAAGAGTTTTGTGCCAAAAGGCTGTGTCCGAACAACGGGGTTAAATTATAAGAACAAAATTTGAGAAATGAAAAAAACTATTACCCATTTCTGGATTTGGTTTTGAATTATCATATTTTTGGGGAAAATTTTTGGTTTTTCCGGAAAGGGATTAAATAGGGTCATAATTGCGCCGGAATCCCCCCAAAAGAACACAAGTTCCAACCCTTAAACATTTGCGCATAATTAATTTTTTTTAAGGACATGTGGGGAAAATAAGGGGATTT
  3  -1   2      seed Bone      in                        CBTC2947.rev                                                                                                                                                                                                                                                                                                                                                                                                         TCGCGATCTAGAACTAGTCTCGAGCGAAGAGCTGCCTGCCTCAAAAAGAAAGGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAAGGTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTG
  5   1   2       bld AbdN FL   in                       IMAGE:6998706                                                                                                                                                                                                                                                                                                                                                                                                              CAAGGAGCCACATCTCGAGCGAAGAGCTGCCTGCCTCAAAAAGAAAGGTAGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGTACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACANCAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGC
  5   1   2       bld AbdN 5g                            IMAGE:7005337                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTGCCTGCCTCAGAAAGAAAGGTAGATTTGTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAACAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAGATTACAGCTACCATTCTGATTTGTTTGAATTATGAATTTTTTGCCATATTTTTGTATGTCCGGAAGGGATTAGTAGAAGTTCCTAAAT
  5   1   2       bld AbdN 5g                            IMAGE:7022506                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGATTTTGGGCACAAATCGCTCCCACATTGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTTATTATAGAGAAATTTTGAGAAGAAAAAAACCAATACCATTCTGAATTTGTTTGATTATGAANTTTTTTGCCATATTTTTGTATGCCCCGAAAGGATATAGAAGGTCTAAAATGCCCTGGAATCCCTTAAAGAACGAAAATTTCATCCTTTAACATTTGGTTAATTAAGTTTTTTTTTAGGGCCTGA
  5   1   2   10  bld Ski1 5g3  in                         CABJ3119.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAATCGGCACGAGGCTTATAATGGCTTCTACAGAGTGTAAGCACTACCATGATGAAGAGTACGATCCTTGCCTTTTATTTGAAACCTACATTGGGGCTGATAAGGATCCTTCCAAGGATCAGATGATAGAATATCCCATTAAAGTTCTCCATGATATACTCTCTTCAGGATCAGTGAAAGGAGAAACTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCTTCACAACACAACATGGTATAAATTCCAATTAAACTTGATCATTGC
  5   1   2       bld Ski1      in                        CABJ12041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTAATCGAACTTAGTGTTAGTTCATCATTTATACATATTCTGGTGGCTGCTGATTACTTTGACAACATCATTTCGCTCCAACCCTCCGAATCTGATTATCAAGAGGCACAGAAATGGTTAAACAAGGAACCAGGAGCCATAGACCACTCCCACCTTACAGAGTTTTTTTGTGGTCTTAAAGATGAATGCTCAGACTGTAAAGAACATGAAGAAAAGACCAGAAGAGCCATCAAACAGATTTTAAGATGGGATATTACCAAAGATAACCCACTGGGTGATGTTGTGTTGCCCCAAGCAGACTGTGTGTACAGTTGCGCCTACTTGGAACCTGTTAGTAAAGATCATGAGATGTATCTGAAGCTCCTAAAACAAATCTGCTCCCTTGTGAAGGTTGGAGGTCACCTGATCCTCATTTCAGTATTCAATATCTCTTACTTTATGTTAGGCCAACACAAGTTTTCCGCCCTGACATGTGATGAAGAGTTTGTGCGAAAGGCTGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAATACCGA
  5   1   2       bld Ski1      in                         CABJ4020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTGTCGAGCAACGGGTTAATTATAGAGAAATTTGAGAAAGAAAAAAACAAATACAATTCTGATTTGTTTGATTATGAATTTTTGGCATATTTTGTATGCCGGAAGGATAGAGAGGTCTAAATGCCTGAATCCCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAATACCGaatttttcgagttgaaagtattgttaagactcaaaaaattggagtttaaatggatgttcgtttccataaattctctttatttttcctaaacaggaagtgctccagcagccattttaggaccattggcactcattcttggaaaacaataatgtgtttaattttcacttgaaactgggtgaaatagaaaacaataatgagatgaacttccccatgaaactgggtgaaatagaaaacaaagacgggattaacttctccatgaaactgggtgaaacagaaaacaatgatgagattaacttccccatgaaactgggtgaaatagaaagcaatgaggggattaacttctccatgaaactgggtgaaatagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaNACTGGGTGAAACAGAAAACAATGAGGGGATTAACTTCCCCATNGAACTGGGTGAAATAGAANACAATGAGGGGA
  5   1   2      ests                                 Xt7.1-CABJ4020.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGTGCTCCAGCAGCCATTTTAGGACCATTGGCACTCATTCTTGGAAAACAATAATGTGTTTAATTTTCACTTGAAACTGGGTGAAATAGAAAACAATAATGAGATGAACTTCCCCATGAAACTGGGTGAAATAGAAAACAAAGACGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGATGAGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCGAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACCATTGTTATCATCAATTAAATAAAGATAAGTTTATACT
                                                  Xt7.1-CHK-1008235595                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCAGCAGCCATTTTAGGACCATTGGCACTCATTCTTGGAAAACAATAATGTGTTTAATTTTCACTTGAAACTGGGTGAAATAGAAAACAATAATGAGATGAACTTCCCCATGAAACTGGGTGAAATAGAAAACAAAGACGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGATGAGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCGAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACCATTGTTATCATCAATTAAATAAAGATAAGTTTATACTTTATCT
  5   1   2       bld Ski1      in                         CABJ7692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTAAAGACGAAGTTCATCTTAACATTGCTATTAGTTTTTTAGGCTTGGTGATTATGGTTTCATAGTTATGGAGACCTTGCTCCTCACAACACAACATGGTATAAATTCGAATTAAACTTGATCATTGCTGTTTTTATAAAATGTCACAATAATGCTTGAATTGTGCGTACGAATACCGaatttttcgagttgaaagtattgttaagactcaaaaaattggagtttaaatggatgttcgtttccataaattctctttatttttcctaaacaggaagtgctccagcagccattttaggaccattggcactcattcttggaaaacaataatgtgtttaattttcacttgaaactgggtgaaatagaaaacaataatgagatgaacttccccatgaaactgggtgaaatagaaaacaaagacgggattaacttctccatgaaactgggtgaaacagaaaacaatgatgagattaacttccccatgaaactgggtgaaatagaaagcaatgaggggattaacttctccatgaaactgggtgaaatagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaactgggtgaaacagaaaacaatgaggggattaatttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaACTGGGTGAAATAGAAAGCAATGAGGTGATTAACTTCTCCATGAAAATGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGaatgtgtcaagcacaggctgtcactgactattctattcctttactagtctaaccctccataagactcaatggtactggacagatcCGAACTTTCTATTTCAAAAAAAGTTTAATAAACATTTATAAATCACAAATG
  5   1   2       bld Ski1      in                         CABJ8221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                gaagtgctccagcagccattttaggaccattggcactcattcttggaaaacaataatgtgtttaattttcacttgaaactgggtgaaatagaaaacaataatgagatgaacttccccatgaaactgggtgaaatagaaaacaaagacgggattaacttctccatgaaactgggtgaaacagaaaacaatgatgagattaacttccccatgaaactgggtgaaatagaaagcaatgaggggattaacttctccatgaaactgggtgaaatagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaactgggtgaaacagaaaacaatgaggggattaatttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaACTGGGTGAAATAGAAAGCAATGAGGTGATTAACTTCTCCATGAAAATGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGaatgtgtcaagcacaggctgtcactgactattctattcctttactagtctaaccctccataagactcaatggtactggacagatcgaacctTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCANAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTG
  3   1   2       bld Ski1      in                         CABJ7692.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATGAANCTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCAtgaaactgggtgaaatagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaactgggtgaaacagaaaacaatgaggggattaatttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaACTGGGTGAAATAGAAAGCAATGAGGTGATTAACTTCTCCATGAAAATGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGaatgtgtcaagcacaggctgtcactgactattctattcctttactagtctaaccctccataagactcaatggtactggacagatcgaacctTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGAC
  3   1   2      seed Ski1      in                         CABJ4020.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCAtgaaactgggtgaaatagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaactgggtgaaacagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGaatgtgtcaagcacaggctgtcactgactattctattcctttactagtctaaccctccataagactcaatggtactggacagatcgaacctTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTAAAAAAA
  3   1   2       bld Ski1 5g3  in                         CABJ3119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAtgaaactgggtgaaatagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaactgggtgaaacagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGaatgtgtcaagcacaggctgtcactgactattctattcctttactagtctaaccctccataagactcaatggtactggacagatcgaacctTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATG
  3   1   2       bld Ski1      in                        CABJ12041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             tgaaactgggtgaaatagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaactgggtgaaacagaaaacaatgaggggattaacttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGaatgtgtcaagcacaggctgtcactgactattctattcctttactagtctaaccctccataagactcaatggtactggacagatcgaacctTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATG
  3   1   2       bld Ski1      in                         CABJ8221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTGAAATAGAAAACAATGAGGGGATTAACTTCCCCAtgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaactgggtgaaacagaaaacaatgaggggattaatttccccatgaaactgggtgaaatagaaaacaatgaggggattaacttctccatgaaACTGGGTGAAATAGAAAGCAATGAGGTGATTAACTTCTCCATGAAAATGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGaatgtgtcaagcacaggctgtcactgactattctattcctttactagtctaaccctccataagactcaatggtactggacagatcgaacctTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGAC
  3   1   2       bld AbdN FL   in                       IMAGE:6998706                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    NTCCATGAAACTGGTGAAACAGAAAACATGAGGGGGATAACTTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAATTCTCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGaatgtgtcaagcacaggctgtcactgactattctattcctttactagtctaaccctccataagactcaatggtactggacagatcgaacctTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACC
  5  -1   2       bld Bone      in                        CBTC2947.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAACTTCCCCATGAAACTGGGTGAAATAGAAAACAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAATAGAAAGCAATGAGGGGATTAACTTCTCCATGAAACTGGGTGAAACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCAAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAAAAAAAAAAAAAC
  5   1   2       bld Bone      in                        CBTC5352.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCAAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACCATTGTTATCATCAATTAAATAAAGATAAGTTTATACTTTATCTGCAAC
  3   1   2       bld Bone      in                        CBTC5352.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGAAAACAATGAGGGGATTAATTTGTCATTCAGAATGTGTCAAGCACAGGCTGTCACTGACTATTCTATTCCTTTACTAGTCTAACCCTCCATAAGACTCAATGGTACTGGACAGATCAAACCTTTCTATTTCCAAAAAAAGTTAAATAAACATTAATAAATCACAAATGATTGGAGTTATTTTTTAAAAACTAGAATTTTTCAGGGAACAATAATAAAAAAATGAGTTCTGGTGAAAACCCATTCATAAATCTCGAAATTATCTAGAAGTAAGAAAAAAAATCCAACTTTATCTCAAAATTGCTTAGTAAATGTGCCCCCCAATTCCAGCCAGGGCAACTTAAGGATATAGTTGGTAAGTTTCCCACTTTCTGCCTGGTGTTTCTTCTAGATTTCTCCCATGTTCCAAGACTGAGCCTAGTGTGAATTCCATAGGGTGCTTTAATCATAAGTTCCATGGTGCAGAAACTGATGTGAATGGTATATAACAATATATTTAATAACACAATTTAAAGTAGCTTTTCATTGGTAATGAGAAATCTCCTGCTAAATTAATAAAATATTATAATGACATTTGGAAGTGGTTGGATTCATTTTGGCTGCTGAACCATTGTTATCATCAATTAAATAAAGATAAGTTTATACTTTATCTGCAAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)