Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 187.0    0Xt7.1-XZT65619.5.5                         80 PI      77       1428     1732                BMP4 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012155022 Xt7.1-CBWN11775.5.5 - 36 ESTs
                                                                       .....0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CBWN11775.5.5      GCGAGCACCTCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTATATTTATGCATTGAAAAAAAAAATGATGAAACAATTATTTTGAAAAATATATTTATGCCTACACGGAGGTTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTTTTTTTTTAGTTGTACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGGAATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTTCACCAGGTCTTTGCAGTCACCACTCTTTTTATTGCCTCGTGGAATTTTGTGTTAAGGACAACCATTTAAAAAAAAAAAAAAAAAAAATAACAAAAAAAAAATGTCAAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTTCCAGTT
                                                  Xt7.1-CHK-1008266618            ACCTCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTATATTTATGCATTGAAAAAAAAAATGATGAAACAATTATTTTGAAAAATATATTTATGCCTACACGGAGGTTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTTTTTTTTTAGTTGTACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTxxxxTxxTTTTTTTTGxxAxTxATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTTCACCAxGxxxTTGCAGTCACCACTCTTTTTATTGCCxxxxxGAATTTTGTGTTAAxGxxAACCATTAAAAAAAAAAAAAAAAAAAAATAACAAAAAAAAAATGTCAAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTT
                                                      consensus depths           2     2     4     4     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     9     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10     9    10    10    10    10    10    10    10    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    14    13    15    13    15    14    16    14    16    14    16    15    17    14    16    13    15    11    13     8    10     8    10     8    10     8    10     8    10     8    11     8    11     8    11     8    10     7     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     6     6     6     7     7     9     9     8     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     7     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     4     4     4     4     4     5     4     6     4     7     4     7     4     7     7     7     4     7     4     7     4     7     4     8     4     8     4     8     4     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6    11     6    11     6    11     6    11     5    11     5    11     5    11     5    11     5    11     5    11     7    12     6    12     6    12     9    12    10    12    11    12    11    12    12    12    11    13    11    13    11    13    11    13    11    13    12    13    12    13    12    13    12    13    10    13    12    13    10    13    12    13    11    13    10    12     8    12     8    12     7    12     7    12     7    12     7    11     7    11     9    11     4    11     5    11     5    10     4    10     5     9     4     9     6     9     3     4     3     4     3     4     3     4     3     4     3     4
  5   1   2      ests                                Xt7.1-CBWN11775.5      GCGAGCACCTCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTATATTTATGCATTGAAAAA
  5   1   2      ests                               Xt7.1-TEgg061f01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTGTACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCATTTTCAGTTGTTTTTTTTTGCGATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTTCACCACGGCTTTGCAGTCACCACTCTTTTTATTTGCCTCGTGAATTTTGTGTTAAAGACAACCATTAAAAAAAAAAAAAAAAAAAAATAACAAAAAAAAAATGTCAAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTTCCAGTTCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTCACCAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----T------
                                               BLH ATG     536    2082      
                                               BLH MIN     365     216      
                                               BLH MPR      35     216      
                                               BLH OVR     536    1384      
                                               EST CLI      -5       4      
                                               ORF LNG     536      94      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Cs ---- 1e-011     BAB68348.1 lefty/antivin related protein [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Br ---- 1e-015     ABD62777.1 myostatin [Branchiostoma lanceolatum] ==================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 1e-032     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 3e-052     BAE06331.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                               PROTEIN --- Dm ---- 1e-079     NP_477311.1 decapentaplegic CG9885-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 2e-094     XP_787248.1 PREDICTED: similar to bone morphogenetic protein 4 [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bf ==== 2e-107     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Bb ==== 3e-113     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 1e-142     NP_571435.1 bone morphogenetic protein 2b [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 2e-168     NP_031579.2 bone morphogenetic protein 2 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 6e-171     NP_001191.1 bone morphogenetic protein 2 precursor [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 3e-175     NP_989689.1 bone morphogenetic protein 2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 0          NP_001079353.1 bone morphogenetic protein 2 A [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 0          CAA38850.1 bone morphogenetic protein 2 (BMP-2) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 0          AAT72007.1 BMP-2 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CBWN11775.5.5                                                        TGATGA---------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------ATG------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------TAG------------------------------------TGA---------------------------------------ATG---TGA---------TGATGA---------------------------------------------------------TAA---------------------------TAG------------TAA------------------TGA------ATG---------------------------------TAA---------TAG------------------------------------------------------------------------------------------------------TAA---ATG------------------------------------------------------------------ATG------------------------------------------------TAA------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---TAA---------------------------------------------------------------------------TAG------------TAA------------------TAA------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  0   1   1           Egg  FL                     TEgg062o06.FL-Sanger                                                                                                                                          TGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTTGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTGGAGACTATATTTATGCATTGAAAAAAAAAATGATGAAACAATTATTTTGAAAAATATATTTATGCCTACACGGAGGTTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTTTTTTTTTTTAGTTGTACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCCTCGTGAATTTTGTGTTAAAGGACAACCATTTAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                Xt7.1-CBWN11775.5      GCGAGCACCTCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTATATTTATGCATTGAAAAA
                                                  Xt7.1-CHK-1008229791            ACCTCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTATATTTATGCATTGAAAAAAAAAAT
  5   1   2       bld Egg  5g3  in                   TEgg063h03.p1kSP6 GTTTGGCGAGCACCTCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGT
  5   1   2      seed Egg  5g                        TEgg120b19.p1kSP6      GCGAGCACCTCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCA
  5   1   2       bld Egg  5g                        TEgg104j04.p1kSP6        GAGCACCTCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCG
  5   1   2       bld Egg  5g                        TEgg113f13.p1kSP6               TCCGTGCCTGTGTGCGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTC
  5   1   2       bld Egg  5g3  in                   TEgg009g08.p1kSP6                             CGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGT
  5   1   2       bld Egg  5g3  in                   TEgg009g09.p1kSP6                             CGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCA
  5   1   2       bld Gas  5g                        TGas022a19.p1kSP6                             CGGCTGGCTCCTGATTGGCAGAGAGCCTGATGACATCAGGATAGAAACAAAAAGCAAAGGGACGCACGAAAAGTGGAGAGAGGAAGAAGCTGACCGGCCGGGGATGAGCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTNCAACGCCTGGCAAAACATTGTGATCCCACCCTACATGCTGGACTTGTACCACCTGCAT
  5   1   2       bld Egg  5x                        TEgg024k16.p1kSP6                                                                                                                           CCGGGGATGATCTGCAGCCCAACTGCCTCTTACAGCCGGGATACAGGGTAAAGGTCGCTCCTCTGCGCATCCCACTCCATGGCTGCCTACCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGACATCACATTGACATCCCGGAGCAACTCAGACCGACTCCAATCGGGGGAGGATAACTATGGTGCTACATTGGGGCGCTCTTGGCTAAGGGACACTCTATCGACCCCACAGAGTATGTGCAAAAACACAAGGACTGGGCTGCGACTAGACGCGCACATTTGCCTAATACCCCTGGGAACGATAAGTTTGGAGTAAAAATAGTCAAGTGATGTGGAAAAAACACGCAGAGAGCATAAAACCATCGTCAAGACACCAACTCGGCGCACACGTCGACAATGGAAGCTGGGATGCCACTCTCTGCTCCTGCTGCTGTTTTACCAAATTTTGCTGAGTGGCTGCACCGGACTTATACCACAAGAACGCGAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCACGACACTCCCAAAGTGTACTCAACCAGCTCCAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCT
  5   1   2       bld Neu  5g3  in                   TNeu065o17.p1cSP6                                                                                                                                        AGCTGCAGCCCAACTGCCTCTTCAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCAGACCGACTCCAGTCGGGGGAGGATAACTTGGTGCGACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTC
  5   1   2       bld Egg  FL   in                   TEgg062o06.p1kSP6                                                                                                                                            CATCCCAACTGCCTCTTACAGCCGGGATACAGGGAAAGGTCGCTCCTCTGCGCATCCCACTCCAGCGCTGCCTCCTTGTCCCATTCAGCGCTAATGCCTGCGGCTGCGCTGCGCTGCTATTTGCACAGGAGATCGCAGTGACATCCCGGTGCGACTCATACCGACTCCAGTCGGGGGAGGATAACTTGGTGCTACATTGGGGCGTTCTTGGTTAAGGGACACACGATCAGTCGCACCGAGTATGTGCAAAAAGAGAAGGACTGGGCTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTTGTAC
  5   1   2       bld Egg       in                   TEgg037g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGAAGAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGAC
  5   1   2       bld Egg       in                   TEgg037g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCGACTAGACGCGCAGATTTGCCTAATAGCCCTGGGAAGGAGAAGTTTGGAGTAAAAAGAGTCAAGTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTG
  5   1   2   10  bld Te1  5g3  in                        CBWN11775.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGATGTGGAAAAAACACACGGAGAGCAGAAAACCATCATCGAGACACAAACTCGGCGCACAGGTCGACAATGGTAGCTGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTTGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACCGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACCCGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGC
  3   1   2       bld TbA       out                   TTbA045i11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTATGGTACTTGTATTGCTCTCCAAGTCTTTTTACATTTGGCTGTGGCTCACGAGTAAGAGGTTGGGGATCTCTGGTCTAGTCCAACAGGTCTTCCTAGGCCTGAAATAGGATCATCCTGCTTTGGCTCAGCAATGGGTGGCCAAATCAGGCAGAGATCTGTTCTTTTGTCAGCCTCACAAACTAGCTGATATTAAGGTGTATGGCCAGCTTAAGCTTGGGGTGGTTAACTCCACTGGTTGCAATTAGTAGAGAGAGATGGTGAAACTAAACACAAGATAATTCTGTTTTAAGTTTATACTTCTTTCCTTTATTTCTAATACTTCTTCTTTTCCTTTGAAAATAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAAAAAAAAAAAAAAAGC
  5   1   2       bld Gas                            TGas025a06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGATCCACTCTCTGCTCCTGCTGCTGTTTTACCAGATTTTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTTGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGGTTGTTGTTGAAGTGACTCACTTG
  3   1   2       bld Egg       in                    TEgg037g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCTGTTTTACCAGATTNTGCTGAGTGGCTGCACCGGACTTATACCAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTGGACAAT
  3   1   2       bld Egg       in                    TEgg037g08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAGGAAGGCAAGCGGAAGTACACGGAATCTGGTCGCTCGTCTCCGCAGCACTCCCAGAGTGTACTCAACCAGTTCGAGCTCCGGCTGCTCAATATGTTTGGCTTAAAGAGGCGTCCAACGCCTGGCAAAAACATTGTGATCCCACCCTACATGCTGGACTCGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTGGACAAT
  5   1   2       bld Egg       in                   TEgg065f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGAGGCGTCCAACGCCTGGCAAAAAATTGTGATCCCACCCTACATGCTGGACTTGTACCACCTGCATTCAGGTCAGCTGGCTGCTGATCAAGACAGTTCCCCCATGGACTACCAGATAGAGCGTGCAGCTAGCCGAGCAAACACCGTTAGGAGCTTTCACCATGAAGAATCCATGGAAGAAATTCCCGAGTCTGGCGAGAAAACAATCCAACGATTCTTCTTCAACCTTTCTTCAGTTCCGAACGAGGAGCTGGTCACTTCTGCCGAGCTACGGATTTTTCGAGAGGGGGTCCAGGAGCCATTTGAGGGTGACAGCAGCAAACTTCATCGGATTAATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCAC
  3   1   2       bld Te1  5g3  in                        CBWN11775.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACCCGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCAAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTATATTTATGCATTGAAAAAAAAAAATGATGAAACAAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA071i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTATGATATTGTCAAGCCAGCAGCGCCCTTCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTATATTTATGCATTG
  3   1   2       bld TpA       in                   TTpA071i08.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTATGATATTGTCAAGCCAGCAGCGGCTGCCTCCCGGGGCCCCGTTGTAAGACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTNATATTTATGCATGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg105i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTATTGGACACCAGACTGATACATCATAACGAAAGCAAATGGGAAAGTTTTGATGTGACACCGGCAATTACACGGTGGATTGCACATAAACAGCCGAACCATGGGTTTGTTGTTGAAGTGACTCACTTGGACAATGACAAAAATGTGCCGAAGAAGCATGTGAGGATTAGCAGGTCTTTAGTCCCAGATAAAGATAGCTGGCCTCGGATACGGCCGTTGTTGGTGACTTTTAGCCACGACGGCAAAGGACATGCGCTTCACAAAAGAGAAAAGCGCCAAGCAAGGCACAAACAACGGAAACGCCTTAAATCGAGCTGCAGGAGGCATCCGTTGTATGTCGATTTCAGCGACGTTGGTTGGAATGACTGGATTGTTGCCCCACCGGGGTATCATGCCTTTTACTGCCACGGGGAATGCCCTTTCCCACTGGCAGACCATTTAAACTCTACAAACCACGCTATCGTGCAGACTTTGGTGAATAACGTCAACCCAAACATCCCCAAAGCTTGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGC
  5   1   2       chi Egg       in                   TEgg061f01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTGTGTACCCACAGAACTCAGCGCCATCTCCATGCTCTACCTGGACGAGAACGAAAAAGTAGTATTAAAAAATTATCAGGACATGGTGGTGGAGGGGTGCGGCTGCCGTTAGGAAGGGTACACGCCGGCCGGCGGCGAGACAGAAAGCTGACACTTTAATATTTCCTTTTTTTTTTTGGAGACTATATTTATGCATTGAAAAAAAAAATGATGAAACAATTATTTTGAAAAATATATTTATGCCTACACGGAGGTTGGGAAGCAAATATTTTAATCAGAGAAATATTCCTTTTTTTTTTTTTAGTTGTACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCACCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAAT
  5   1   2      ests                               Xt7.1-TEgg061f01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTGTACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCATTTTCAGTTGTTTTTTTTTGCGATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTTCACCACGGCTTTGCAGTCACCACTCTTTTTATTTGCCTCGTGAATTTTGTGTTAAAGACAACCATTAAAAAAAAAAAAAAAAAAAAATAACAAAAAAAAAATGTCAAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTTCCAGTTCTG
                                                  Xt7.1-CHK-1008233507                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCxxTTTxAGTTGTTTTTTTTxxxxATTCATTTTxGGxCxxxxxAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTTCACCACGGxxTTxxAGTCACCACTCTTTTTATTxxCxxCGTGAATTTTGTxTxAAxGACAACCATTAAAAAAAAAAAAAAAAAAAAATAACAAAAAAAAAATGTCAAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTTCCA
  3   1   2       bld Egg       in                    TEgg061f01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTGTACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTATTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCCTCGTGAATTTTGTGTAAAGGACAACCATTAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FL   in                    TEgg062o06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTGTACATTTTATAAGGGTTTGTACCCAGCACCTGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCCTCGTGAATTTTGTGTTAAAGGACAACCATTAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Neu  5g3  in                    TNeu065o17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTGTACATTTTATAAGGGTTTGTACCCAGCACATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCCTCGTGAATTTTGTGTTAAAGGACAACCATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg078o07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTTCTTTTTTTACTTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTATTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCGTCGTGAATTTTGGTTAAAGGACAACCATTAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg078o07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAGTATAATGGTCAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATATGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTATTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAG
  3   1   2       bld Egg       in                    TEgg065f17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGATTCCTATTTTGTATTTATTTACCATTATAACCACTTTTTTAGGAAAAAAAAATAGTTGTTTTTGTATTTATANGTAACCAACAGAGAAAATATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTTTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGGGAATTCATTTTGGGCCAGGAGAATTTTTATTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTTTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTTTGGGATTTTACACAGCAGTAGCTTGGACTTTTTTAAAAATATTTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTTTACTGAACTTTTCTTTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCCTCGTGAATTTTGTGTTAAAGGACAACCATTTAAAAAAAAAAAAAAAAAAAATAACAAAAAAAAAATGTCAAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTTCCAGTTCTGAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg063h03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATAGGGTTTGTAAATATGTTCCTGAATGCAGATTCAGCGTTTTTTTCTTTTTTTAACTTATGTATACGCAGCTGGTTATATGGCAAGTTTTATATTTTCTACAAAGCTCATTTTTAAGGTCGTTCGTTATGGAAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTATTTTTTTTTTCCTTTTTTATTTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCGCTCGTGAATTTTGTGTTAAAGGACAACCATTAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas144j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTCACCACGGTCNTTTGCAGTCACCACTCTTTTTATTGCCTCGTGAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas144j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGATCACGGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTCTGGGATTCTACACAGCAGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTCTCATCTACTTT
  3   1   2       bld Egg  5g3  in                    TEgg009g08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATTGGTCCATTCGCCAGTCCTCCATATTGTGCAATTAACATGCATTTTGCAATGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAACTGCCTGATACAACTACTGCCATTTTCAGTTGTTTTTTTTGGGAATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTTTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTTTGGGATTTTACACAGCAGTAGCTTGGACTTTTTTAAAAATATTTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTTTACTGAACTTTTCTCTCATCTACTTTTTTGGGTTACAATTTCTTTTCTTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCCTCGTGAATTTTGTGTTAAAGGACACCCATTTAAAAAAAAAAAAAAAAAAATAACAAAAAAAAAATGTCAAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTTCCAGTTCTGTTAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Egg       out                   TEgg020e14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGCATTTTGCAAGGTAGGAAGTCCGGTGTGCATTTAGAATTGGAATAGGTGCCTGATACAAATACTGCCATTTTCAGTTGTTTTGTTTGCGAATTCATTGGGGGCCAGTAGAATTTTTATTCCCAACTTCCCTTAGGATTAGGGGGTTCCCTAAAACTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCAGGATTTAAAATAAAAAGTTGGGAGATTTGACAAAAGAGTTCAATTATCACGGGCACAAGTGCTTCTGGGATTGTACACAGCAGTAGCTTGGACTTTTTTAAAAATATCTTAAAAATATTTAAGTTGCCTTCCGCTTTGCCACACATTCGAAGATCCACCCTTTGTACAAATCCTTCCATCCCTtaattaatccgggaaaagaaggaattgaccccccaaaatttgatttcaagtcagtggcatcaccactgtgccaTTTTTTTT
  3   1   2       bld Egg  5g3  in                    TEgg009g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTTTCAGTTGTTTTTTTTGCGAATTCATTTTGGGCCAGTAGAATTTTTTTTTTTTTTTTCCTTTTTTATTTTTTTTTTCTTTAAAATTAAAGAAAAAAAAATAAAGCTTGGCGGGGTGGGAAGAACATTGGAAAGTGGCATGATTTAAAATAAAAAGTTTTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTTTGGGATTTTACACAGCAGTAGCTTGGACTTTTTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTCTGCTGTTTTTTTTCTGCCTTTTTTGTTTTTTACTGAACTTTTCTCTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTTCACCACGGTCTTTGCAGTCACCACTCTTTTTATTGCCTCGTGAATTTTGTGTTAAAGGACACCCATTTAAAAAAAAAAAAAAAAAAATACCAAAAAAAAAATGTCAAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTTCCAGTTCTGTTAAAAAAAAAAAAAAAAAAAAAA
  5  -1   2       add TbA                            TTbA026h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTTGGCGGGGTGGGAGAAACTTTGGAAAAGTGGCATGATTTAAAATAAAAAAGTTCTTAAATTTGACAAAAGAGTTCAACTATCACGCGCACAAGTGCTTTTGGGATTTTACACAGCGGTAGCTTGGACTTTCTTAAAAATATCTTAAAAATATTTAATTTATTTAAAGATTTGTGTTTTTTTTCCCCCTTTTGCTGTTTTTTTTCTGCCTTTTTTGTTTTCTACTGAACTTTTCTTTCATCTACTTTTTTGTGTTACAATTTCTTTTCTTTTTTTTTTTTTTCACCACGGTCTTTGCGGTCACCACACTTTTTATTGCCACGTGAATTTTGTGTTAGAGGACGACCGTTTTGGGGGGGGGGGGGGGGGGGGTACGGGAAAAAAAATGTCTAGCAAGATTTCACCAATAAATGAAGAAGTACAGACTTCCAGTTCTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)