Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ6644.3                           59 END     1           3        1                phosphoinositide-3-kinase, regulatory subunit, polypeptide 3 (p55, gamma) [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZG64446.3                           31 END     1           3        3                (no blast hit)
     3   2.0    0Xt7.1-CAAK9577.5                            4 END     1           3       33                Unknown (protein for MGC:121938) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4 198.0    0Xt7.1-CAAK6267.3                            3 PI      75       1734     2116                PREDICTED: hypothetical protein [Gallus gallus]

 This cluster: approximate FL confidence score = 97%

 1012155026 Xt7.1-CAAP13705.3.5 - 30 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                       4     6     5     7     5     7     5     7     6     7     6     8     6     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     7     8     8     8     7     7     7     7     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     4     4     4     3     4     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     5     5     5     5     6     6     7     6     7     6     7     6     7     5     6     4     5     4     5     4     6     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     8    10     8    10     8    10     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9    10    10    10    10    10    10    10    10    10    10    10    11     9    11    10    11    11    11    11    11    12    12    12    12    12    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    12    13    12    13    12    13    12    13    12    13    11    12    10    12    10    11     9     9     9     9     6     7     6     7     6     6     6     6     6     7     6     7     6     7     7     7     4     6     5     6     2     4     3     4     1     4     3     5     2     5     3     5     2     5     3     5     3     5     3     5     3     5     3     4     3     4     4     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     4
                                               BLH ATG      62     785                                                                  
                                               BLH MIN      62     207                                                                  
                                               BLH MPR      62     207                                                                  
                                               BLH OVR      62     213                                                                  
                                               CDS MIN      62     207                                                                  
                                               ORF LNG      62      40                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Br ---- 1e-007     AAS91553.1 AmphiHMG1/2 [Branchiostoma belcheri tsingtaunese] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Cs ---- 1e-009     BAB68354.1 Cs-tcf [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 7e-014     NP_012893.1 Ixr1p [Saccharomyces cerevisiae] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 8e-024     AAF81765.1 HMG box transcription factor AmphiSox1/2/3 [Branchiostoma floridae] ==================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bb ---- 6e-025     ABD24303.1 Sry-like protein C [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 2e-045     NP_001024919.1 EGg Laying defective family member (egl-13) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 1e-048     BAE06707.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 1e-052     NP_001014695.1 CG11153-PB, isoform B [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sp ---- 8e-054     NP_999637.1 transcription factor SoxD1 [Strongylocentrotus purpuratus] ---------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 4e-093     CAJ83449.1 novel SRY-box containing family protein [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 3e-096     AAH68647.1 XSox12 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_001028757.1 SRY-box-containing protein 5 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === ?? ==== 0          AAI42560.1 Unknown (protein for MGC:160888) [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === Gg ==== 0          NP_001004385.1 transcription factor LSox5-I [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_035574.1 SRY (sex determining region Y)-box 5 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_008871.3 SRY (sex determining region Y)-box 5 isoform a [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAP13705.3.5                                                                                                                                ATG------------------------------------ATG---------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------TGA------------------------TAG---------------------------------------------ATG---------------TGA---------------------------------------------------------------------------------------------------------------------TAA---ATG------------------------------TAA------------------------TGA---------------------------------------ATG------------------------------------------------------------------------------------------------------TGAATG---------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld HeRe      in                     EC2CAA26BA09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTGTGCGGAGCGTTAGTGCAGCGTGGCACAATGCCTCCCTTTCATTAGCCCTCGGCTCGGAGCACAAAGGGCGGCTTTGCGCAGACTGAATGCAGGAGTTTAATTTGCAGGTGGAGGGAAGATAAAAGGTGCTGATGCTTCTGTCATTGTCTCGCTTAGGTGACCCCTACCCTGTGCAGCTGATTCCAACTACTATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCCCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGA
  5   1   2       bld Int1      in                        CAAP13705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGCTGATTCCACTACTATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGA
  5   1   2       bld Gas7      in                         XZG20722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCAATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTA
  5   1   2       bld HeRe      in                     EC2CAA38DH04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGCAGTTGACGGGGAAACCCAATGAGGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCGGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGGGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCA
  5   1   2       bld Gas8      in                          st94o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGCGACTGGGTTGGAGAGGGAGATCATGCTGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACNAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCNGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCATGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTAC
  3   1   2       bld HdA  FL   in                    THdA019c19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTAT
  3   1   2       bld Gas8      out                         st33l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGATGAACGGAGGAAGATNCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTC
  3   1   2       bld Gas8 5g3  in                          st41f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTANTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGAAAGGAAAGAGGATTCATCA
  3   1   2       bld Gas8                                  st34l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATNCAAGGCAATTATGCGCAGCCGGAGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATNGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGANGACGNCCCCGACGTAGATTACGCCAGCGACAGTGAGANCCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGANCTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACAGCTGNCTGTTACTAGAACTCTTAGCTGGGACATCAACCGACGATTCCGAGCTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATT
  3   1   2       bld Tad5      in                           XZT498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGCAAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAANGAAAAATAAGCANNGGGAAAAATAAAAAAAAAAG
  3   1   2      seed Int1      in                        CAAP13705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTC
  3   1   2       bld Gas7      in                         XZG20722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATG
  3   1   2       bld HeRe      in                     EC2CAA38DH04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGCAATTATGCGCAGCCGGGGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATGGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACC
  3   1   2       bld Tad5 PIPE in                         XZT27750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAACAAAAAACTTGATGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTAGCGACATTTCGGTTTTATTTCCATCGACGACATTTC
  5   1   2       bld HdA       out                 THdA040m19.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGGAGACTCCACAGAGAGGACATCAACGAGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATaaaaatgaaaaaaaaagaaagaaaaaaactcaaaaaaaaaaaaaaaaaaaCCGGCCGCNTNGGCCTCCC
  3   1   2       bld HeRe      in                     EC2CAA26BA09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAAGAAAAAAACTCAAAAAAAAACAAAAAACTTGATGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTT
  3   1   2       bld HdA  5g3  in                    THdA040l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCCGAGTTGGGAACTTTATAGACTAACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACAAGAACTTTTTCATAACACTGACTGTTACTAGAACTCTTATTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTAT
  5   1   2       bld Neu                            TNeu025i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAACAAAAAACTTGATGGCTGTTTGTTCTAAAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTAGCGACATTTCGGTTTTATTTCCATCGACGACATTTC
  3   1   2      shim Gas8      in                          st94o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGGCCCCCCCCCCCGNANNTTTTTTCCCCNNCNNNTTTTTTTTTTTTTCCTAAAAATGGAAAAAAAAGGAAGGAAAAAACNCCAAAAAAAAAAACNAAAAACNTGATGGCTGTTTGTTCTAGAAATTCTCNCTCAGGTACNCAGTGCCNACNGTGGCTTGNGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTTGGGGGGGGTTGGTTAATTTTCCCGGAAATTGAATTTTTTCACTTTGGTTGTCCCGTTGCATTGTGGGATGG
  3   1   2       bld HdA       out                   THdA030h02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGATGGCTGTTTGTTTTAGAAATTTTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTAGAAACGATTTCGGTTTATTTCCATCGACGACATTTCACAAAAAAAAAAAAAAAAAAGC
  5   1   2      shim TbA       out                  TTbA057h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGATGGACGGCTTCAGTAGCGACATTTCGTGTTTTATTTCCATCGACGACATTTCACAAAAAAAAAAAAAAAAAGTGCCAATTTTTTACCCAAGTGTCGATTTTGTTCCTTTTGCTTTTTTTCCCCCCCCCCCGTTTCTTTCCCTGATCAGCGTTAAGTCTTAAACAATCTTTAAACAAAAACTGAAAACACCCGCGGACGGTGAATATCAGTGGACACTCGAGTTTACGAAAGAGAAAGAAATTCTCTCGGATTTCGGGGGGGGGCGCGAGTCCGAGCGCTTTTTACGGTACTATTGACGCGTCGATAAAATTGTGCTTTTTGGGGATAAAAAAACAAAAAGTCCCACAATCTTTGAAAAGCCTTTACTTACTCTTTGCACTTCAGAGTTCAAATAAGAAAAACGATAACGTTTTTTGCTATCGAAAAAAGAAAATTTAGAATTTATAAGATGCTGAATTTTTTTTTTCATTTGAAGTAGATTTATTGGATCTGCTTTCCCAATAACCTGCAAAGATTTATAGACGTTGGGGTATCCGAGGGAAGGATCCATCGGGGAGACCCCTCATTAAACGAGTTTTTTTACATTAGAAACTGGTTTTCACTCAATTTCGAGTGATCTCTGTATATAATACACAGAGCCCGGGGCAGCCCTTCCGATATACGTGAACGTGGCCCCCCTAGACTTTATAAAATTTTGATTCATTTTTTTTCTAGGCAAACGGGACTCCGCCCACACCTGTTACTGCTTCAAAAACATTTCCCCCATTTCCC

In case of problems mail me! (