Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ6644.3                           59 END     1           3        1                phosphoinositide-3-kinase, regulatory subunit, polypeptide 3 (p55, gamma) [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZG64446.3                           31 END     1           3        3                (no blast hit)
     3   2.0    0Xt7.1-CAAK9577.5                            4 END     1           3       33                Unknown (protein for MGC:121938) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4 198.0    0Xt7.1-CAAK6267.3                            3 PI      75       1734     2116                PREDICTED: hypothetical protein [Gallus gallus]

 This cluster: approximate FL confidence score = 97%

 1012155026 Xt7.1-CAAP13705.3.5 - 30 ESTs
                                                                       .....-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAP13705.3.5                                                                  AGCAGTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCCTCCAGCAGCAGATTCAGGTTCAAGGTCAACTTCCACCCCTTATGATTCCAGTTTTCCCCCCAGACCAGAGGACGTTAGCGGCAGCGGCTGCGGCGCAGCAAGGGTTCCTGATCCCCCCGGGATTCAGCTACAAGCCGGGATGCAGTGACCCCTACCCTGTGCAGCTGATTCCAACTACTATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAACCAAAAAACTTGAGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTAGAAACGATTTCGGTTTATTTCCATCGACGA
                                                  Xt7.1-CHK-1008266165                                                                        CAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCCTCCAGCAGCAGATTCAGGTTCAAGGTCAACTTCCACCCCTTATGATTCCAGTTTTCCCCCCAGACCAGAGGACGTTAGCGGCAGCGGCTGCGGCGCAGCAAGGGTTCCTGATCCCCCCGGGATTCAGCTACAAGCCGGGATGCAGTGACCCCTACCCTGTGCAGCTGATTCCAACTACTATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAAACAAAAAxxTxxxGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTA
                                                      consensus depths                                                                       4     6     5     7     5     7     5     7     6     7     6     8     6     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     7     8     8     8     7     7     7     7     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     4     4     4     3     4     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     5     5     5     5     6     6     7     6     7     6     7     6     7     5     6     4     5     4     5     4     6     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     8    10     8    10     8    10     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9    10    10    10    10    10    10    10    10    10    10    10    11     9    11    10    11    11    11    11    11    12    12    12    12    12    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    12    13    12    13    12    13    12    13    12    13    11    12    10    12    10    11     9     9     9     9     6     7     6     7     6     6     6     6     6     7     6     7     6     7     7     7     4     6     5     6     2     4     3     4     1     4     3     5     2     5     3     5     2     5     3     5     3     5     3     5     3     5     3     4     3     4     4     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     4
  5   1   2      ests                                 Xt7.1-XZT27750.5                                                                  AGCAGTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCCTCCAGC
  5   1   2      ests                                Xt7.1-CAAP13705.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAAACAAAAACTTGATGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAG
                                               BLH ATG      62     785                                                                  
                                               BLH MIN      62     207                                                                  
                                               BLH MPR      62     207                                                                  
                                               BLH OVR      62     213                                                                  
                                               CDS MIN      62     207                                                                  
                                               ORF LNG      62      40                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Br ---- 1e-007     AAS91553.1 AmphiHMG1/2 [Branchiostoma belcheri tsingtaunese] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Cs ---- 1e-009     BAB68354.1 Cs-tcf [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 7e-014     NP_012893.1 Ixr1p [Saccharomyces cerevisiae] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 8e-024     AAF81765.1 HMG box transcription factor AmphiSox1/2/3 [Branchiostoma floridae] ==================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bb ---- 6e-025     ABD24303.1 Sry-like protein C [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 2e-045     NP_001024919.1 EGg Laying defective family member (egl-13) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 1e-048     BAE06707.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 1e-052     NP_001014695.1 CG11153-PB, isoform B [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sp ---- 8e-054     NP_999637.1 transcription factor SoxD1 [Strongylocentrotus purpuratus] ---------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xt ---- 4e-093     CAJ83449.1 novel SRY-box containing family protein [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 3e-096     AAH68647.1 XSox12 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_001028757.1 SRY-box-containing protein 5 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === ?? ==== 0          AAI42560.1 Unknown (protein for MGC:160888) [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === Gg ==== 0          NP_001004385.1 transcription factor LSox5-I [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_035574.1 SRY (sex determining region Y)-box 5 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_008871.3 SRY (sex determining region Y)-box 5 isoform a [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAP13705.3.5                                                                                                                                ATG------------------------------------ATG---------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------TGA------------------------TAG---------------------------------------------ATG---------------TGA---------------------------------------------------------------------------------------------------------------------TAA---ATG------------------------------TAA------------------------TGA---------------------------------------ATG------------------------------------------------------------------------------------------------------TGAATG---------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1           HdA  FL                     THdA019c19.FL-Sanger                                                                      GTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCCTCCAGCAGCAGATTCAGGTTCAAGGTCAACTTCCACCCCTTATGATTCCAGTTTTCCCCCCAGACCAGAGGACGTTAGCGGCAGCGGCTGCGGCGCAGCAAGGGTTCCTGATCCCCCCTGGATTCAGCTACAAGCCGGGATGCAGTGACCCCTACCCTGTGCAGCTGATTCCAACTACTATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-XZT27750.5                                                                  AGCAGTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCCTCCAGC
                                                  Xt7.1-CHK-1008238279                                                                        CAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCC
  5   1   2       bld BrSp                             EC2BBA20DF08.g1 GGGGTTCTTCTCTGTATTCTCCGCAGTGGTATTTGGATGGTTTCCTGCCCGCTCCCAGCACAACAAAAAAACCCATTTCTGTTACAATGGCCCCTAACAACACAATGACGGCATTAAGGATTTATGTGGAGGTTTCATTATTTTCTTTTCTTTTGTTCCTTCCAGGATGTCTTCCAAGCGACCAGCCTCCCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGGCCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAA
  5   1   2       bld Neu                            TNeu036k11.p1kSP6      AAAGAATGCGGCTCCGGGAGAGACAGACACAGAGACAGAGGAGACAGAGGAGAAGCCGGAGAGCAGTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAAGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGAACTGGAAGACAAGCTCCTCGCAATGGG
  5   1   2   12 seed Tad5 PIPE in                         XZT27750.5p .............................................AGACAGAGGAGAAGCCGGAGAGCAGTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCCTCCAGCAGC
  5   1   2       bld Gas8 5g3  in                          st41f15.5p                                                          AGCCGGAGAGCAGTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGA
  5   1   2       bld HdA  5g3  in                  THdA040l10.p1kaSP6                                                            CCGGAGAGCAGTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAAGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAAATGGAGTTGGCCTAGCAGCTACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCA
  5   1   2       bld Neu  5g                        TNeu024h02.p1kSP6                                                               GANAGCAGTCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGC
  5   1   2       bld HdA  FL   in                   THdA019c19.p1kSP6                                                                       TCAGTTGCTGGGAGTCGGGAGCAGAGCAGCCCCCACACAGGGACCCGGACCCCAGCGATGCTCACGGACCCCGACCTACCCCCGGAGTTTGAGAGGATGTCTTCCAAGCGACCAGCCTCTCCGTATGGGGAAGCAGATGGAGAGGTAGCCATGGTGACGAGCAGGCAGAAAATGGAAGACGACGGCGGCGATGGCCTCCCGGCTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTTGGCCAGCAGNCACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAATCAACCTCCTCCAGCAGCAG
  5  -1   2       chi TbA                            TTbA001o10.p1kSP6                                                                                                                      TGACAGATCGCGCCTCGGCTGTGTTCTACGTTTCATATTTTCCTTGGCTCGGCTTTACGGACACGTTGCCAAGAACTCATTTTCTTGAGAGACTCCACAAGGAAGACTGGCACACTAGCAACTTCACCCCCAAACACTTATTTTCCATCGACTTGTTTTTCATCTTCCCTTGCACGTGGGTTTCAAGCCTCACTCGGAGGAATTTCAGGCCGTTTCGTTACTGACGCAGGAGGGTTGTGACCGTCGGAGCCCCTCGTACCAACACAACACAATGGAACTTGATTGCAATAAGATGCCCCCGTTTGCCCTGCACAACGCAGCTACCTCACCCATAAAGGCAGAAGAGTTGGGGCGCCAGAGCGGGGAGTCTCTAGCCAACGCCATGCTGGGGACCCCAGAGAGACGCAAGGGCAGTTTAGCGGACGTGGTGGACACCCTGAAGCAGAGGAAGATGGAGGAGCTGATTAAGAGTGAGCCAGAAGAAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCCTCCAGCAGCAGATTCAGGTTCAAGG
  5   1   2      ests                                Xt7.1-CAAP13705.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAAACAAAAACTTGATGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAG
                                                  Xt7.1-CHK-1008229832                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAAACAAAAAxxTxATGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTAGAAA
  5   1   2       bld Tad5      in                           XZT498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTTAGAGTGAGCCAGAGAACCCCCAGTATAGAAAAGCTTCTGTCTAAAGACTGGAAGGACAAGCTCCTCGCAATGGGATCGGGGAACCTGGGAGATGTCAAAGGGACACCGGAGAGTCTTGCCGAGAAGGAGAGGCAGCTTATGGCCATGATTAACCAGTTGACCAGTTTACGGGAGCAGCTGCTGGCAGCGCACGACGAGCAGAAGAAATTGGCCGCCTCACAAATCGAAAAGCAACGGCAACAAATGGAGTTGGCCAAGCAGCAACAGGAACAGATTGCGAGGCAGCAGCAGCAACTCCTGCAGCAGCAACACAAAATCAACCTCCTCCAGCAGCAGATTCAGGTTCAAGGTCAACTTCCACCCCTTATGATTCCAGTTTTCCCCCCAGACCAGAGGACGTTAGCGGCAGCGGCTGCGGCGCAGCAAGGGTTCCTGATCCCCCCGGGATTCAGCTACAAGCCGGGATGCAGTGACCCCTACCCTGTGCAGCTGATTCCAACTACTATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCC
  5   1   2       bld HeRe      in                     EC2CAA26BA09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTGTGCGGAGCGTTAGTGCAGCGTGGCACAATGCCTCCCTTTCATTAGCCCTCGGCTCGGAGCACAAAGGGCGGCTTTGCGCAGACTGAATGCAGGAGTTTAATTTGCAGGTGGAGGGAAGATAAAAGGTGCTGATGCTTCTGTCATTGTCTCGCTTAGGTGACCCCTACCCTGTGCAGCTGATTCCAACTACTATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCCCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGA
  5   1   2       bld Int1      in                        CAAP13705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGCTGATTCCACTACTATGGCAGCTGCCGCCGCGGCAACACCGGGACTGGCACCTCTGCAGTTACAGCAATTGTACGCAGCTCAGCTGGCCGCCATGCAGGTGTCTCCGGGGGCCAAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCGATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGA
  5   1   2       bld Gas7      in                         XZG20722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTACCTGGCGTGCCCCCCAGCAACCTCAGCAACGCCGTCTCCCCGAGCAGCATCCATACAGACAAGAGCACAAGCAGCCCCCCGCCCAAAACCAAGGACGATGTGACGCAGCCCCTGAACCTGTCGGCCAAACCCAAGGGCTCCAATAGTAAATCTCCATCGTCCCCCACCTCCCCCCATATACCCCGGCTAAGCAGCGCCCTCGCTCACAAACCCATCTGCTCCACCTCCGCAAGTACCCCCCTCCGGGTCAACTCAATAGATATCCTGTCGTCCATCACCTCCCCGGGGTATTTAAACGACCACGACGCCGTCACCAAGGCCATCCAGGAAGCGCGGCAAATGAAAGAGCAGCTCCGCCGCGAGCAACAGGCGCTGGACGGGAAAGTGGTGAACAGCCTGGGACTCAATAACTGCAGGACCGACAAGGACAAATCATCGCTGGAGAGTTTAACGCAGCAGTTGACGGGGAAACCCAATGAAGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCAGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTA
  5   1   2       bld HeRe      in                     EC2CAA38DH04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGCAGTTGACGGGGAAACCCAATGAGGACAAGTTCAGCCACGCCATGATGGATTTCAATCTGAGCGGCGATTCAGATGGGAGCGCGGGAATTTCAGAGTCGAGGATATATCGGGAATCGCGAGGCCGCGGCAGCAACGAGCCGCACATTAAGCGCCCAATGAACGCCTTCATGGTCTGGGCCAAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGGGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCA
  5   1   2       bld Gas8      in                          st94o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGCGACTGGGTTGGAGAGGGAGATCATGCTGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACNAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCNGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCATGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTAC
  3   1   2       bld HdA  FL   in                    THdA019c19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGATGAACGGAGGAAGATCCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTAT
  3   1   2       bld Gas8      out                         st33l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGATGAACGGAGGAAGATNCTGCAGGCGTTTCCCGACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTC
  3   1   2       bld Gas8 5g3  in                          st41f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACATGCATAACTCCAATATCAGCAAAATACTGGGTTCCCGCTGGAAGGCCATGACGAATCTGGAGAAGCAGCCGTANTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGAAAGGAAAGAGGATTCATCA
  3   1   2       bld Gas8                                  st34l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAAGCAGCCGTACTACGAGGAGCAGGCCCGGCTCAGCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATNCAAGGCAATTATGCGCAGCCGGAGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATNGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGANGACGNCCCCGACGTAGATTACGCCAGCGACAGTGAGANCCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGANCTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACAGCTGNCTGTTACTAGAACTCTTAGCTGGGACATCAACCGACGATTCCGAGCTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATT
  3   1   2       bld Tad5      in                           XZT498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGCAAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAANGAAAAATAAGCANNGGGAAAAATAAAAAAAAAAG
  3   1   2      seed Int1      in                        CAAP13705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAGCAGCACCTGGAGAAGTACCCGGACTATAAGTACAAGCCGAGGCCCAAGCGCACCTGCTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTC
  3   1   2       bld Gas7      in                         XZG20722.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAGTGGACGGGAAGAAGCTGCGAATCGGCGAATACAAGGCAATTATGCGCAGCCGGAGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATG
  3   1   2       bld HeRe      in                     EC2CAA38DH04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGCAATTATGCGCAGCCGGGGGCAAGAGATGAGACAGTATTTCAATGTGGGGCAACAAGCACAGATCCCAATTAGCACGGCCGGCGTCGTCTACCCCGGTGCCATCGCCATGGCGGGTATGCCCTCTCCTCATTTACCATCGGAGCATTCCAGCGTATCCAGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATGGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACC
  3   1   2       bld Tad5 PIPE in                         XZT27750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCAGCCCCGAGCCGGGAATGCCCGTCATCCAGAGCACTTACGGCATCAAAGAAGAAGAGCCGCACATCAAGGAGGAGATCCATAGAGAGGACATCAACGGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAACAAAAAACTTGATGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTAGCGACATTTCGGTTTTATTTCCATCGACGACATTTC
  5   1   2       bld HdA       out                 THdA040m19.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGGAGACTCCACAGAGAGGACATCAACGAGGGAAATGTACGACGAATACGACGAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTCATaaaaatgaaaaaaaaagaaagaaaaaaactcaaaaaaaaaaaaaaaaaaaCCGGCCGCNTNGGCCTCCC
  3   1   2       bld HeRe      in                     EC2CAA26BA09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGACGACGACCCCGACGTAGATTACGCCAGCGACAGTGAGAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCAGAGTTGGGAACTTTATAGACTTACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACATGAACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAAGAAAAAAACTCAAAAAAAAACAAAAAACTTGATGGCTGTTTGTTCTAGAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTT
  3   1   2       bld HdA  5g3  in                    THdA040l10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAACCTTAGTGCAGAACAAGCCAACTGATATGGGGCCGAGTTGGGAACTTTATAGACTAACCAAGCCCAACCTGGTTCCTCCATAGCGGAGGCCAAGCACAAGAACTTTTTCATAACACTGACTGTTACTAGAACTCTTATTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTAT
  5   1   2       bld Neu                            TNeu025i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACTTTCTCCTACACTGACTGTTACTAGAACTCTTACTGGGACATCAACCGACGATTCCGACTTCAGCCCCAAAACCGACCGGCTGGGAAAGGAAAGAGGATTTCATCAACAATTTCCACCGAAAGAATGAAAAATAAGCTATGGGTAAAAAAGAAAAAGAGAGGAAAAGCCAGTAAATTCAGCTGCTAGACCCCCAGCACTGAAGTCTTTTACCCTTCAACTTTTTTTTTTTTTTTCATAAAAATGAAAAAAAAAGAAAGAAAAAAACTCAAAAAAAAAAAACAAAAAACTTGATGGCTGTTTGTTCTAAAAATTCTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTAGCGACATTTCGGTTTTATTTCCATCGACGACATTTC
  3   1   2      shim Gas8      in                          st94o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGGCCCCCCCCCCCGNANNTTTTTTCCCCNNCNNNTTTTTTTTTTTTTCCTAAAAATGGAAAAAAAAGGAAGGAAAAAACNCCAAAAAAAAAAACNAAAAACNTGATGGCTGTTTGTTCTAGAAATTCTCNCTCAGGTACNCAGTGCCNACNGTGGCTTGNGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTTGGGGGGGGTTGGTTAATTTTCCCGGAAATTGAATTTTTTCACTTTGGTTGTCCCGTTGCATTGTGGGATGG
  3   1   2       bld HdA       out                   THdA030h02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGATGGCTGTTTGTTTTAGAAATTTTCACTCAGGTACACAGTGCCAACAGTGGCTTGTGAATGTGTTTTGTTGTTTTGTGCTACGGTTTTAAGAGGAATAAGATAATTTTTATTTTAAGGTTCTTTTTTTTTGGGGGGTTGGTTTTATTTTCCCGGAAATTGAATTTTTTCACTTTGGCTGTCCCGTTGCATTGTGGGATGGACGGCTTCAGTAGAAACGATTTCGGTTTATTTCCATCGACGACATTTCACAAAAAAAAAAAAAAAAAAGC
  5   1   2      shim TbA       out                  TTbA057h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGATGGACGGCTTCAGTAGCGACATTTCGTGTTTTATTTCCATCGACGACATTTCACAAAAAAAAAAAAAAAAAGTGCCAATTTTTTACCCAAGTGTCGATTTTGTTCCTTTTGCTTTTTTTCCCCCCCCCCCGTTTCTTTCCCTGATCAGCGTTAAGTCTTAAACAATCTTTAAACAAAAACTGAAAACACCCGCGGACGGTGAATATCAGTGGACACTCGAGTTTACGAAAGAGAAAGAAATTCTCTCGGATTTCGGGGGGGGGCGCGAGTCCGAGCGCTTTTTACGGTACTATTGACGCGTCGATAAAATTGTGCTTTTTGGGGATAAAAAAACAAAAAGTCCCACAATCTTTGAAAAGCCTTTACTTACTCTTTGCACTTCAGAGTTCAAATAAGAAAAACGATAACGTTTTTTGCTATCGAAAAAAGAAAATTTAGAATTTATAAGATGCTGAATTTTTTTTTTCATTTGAAGTAGATTTATTGGATCTGCTTTCCCAATAACCTGCAAAGATTTATAGACGTTGGGGTATCCGAGGGAAGGATCCATCGGGGAGACCCCTCATTAAACGAGTTTTTTTACATTAGAAACTGGTTTTCACTCAATTTCGAGTGATCTCTGTATATAATACACAGAGCCCGGGGCAGCCCTTCCGATATACGTGAACGTGGCCCCCCTAGACTTTATAAAATTTTGATTCATTTTTTTTCTAGGCAAACGGGACTCCGCCCACACCTGTTACTGCTTCAAAAACATTTCCCCCATTTCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)