Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1 111.0    0(repeat)                                    0 REP     82       2041     2373                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012155029 Xt7.1-CABK1658.3.5 - 25 ESTs
                                                                       ....-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABK1658.3.5                                                                                                                                                                                                                                                                                             CAGATACCTTGGAGATGAGGTGACTACATCTGAAGATCGTTCCAAAGCCCTGTTACAGAAATTGCATGAACAGGCTAAGGATAGGCAGCAACAGAGACAGCACCCAAAAGCGAAGGCTTCTCCAAAAGATGACCATGTCGAAGAAACAAACACAAAACCCAGCATAAATGAAACCCTAAGGAAAACTAAAAAAAGAAAGAAAAAACAAGAGGAGGAAGAAGAAGGTGAATTGAAGAGTCCTAGTGATGAGAATGAACAGGACAGTGGGCAACAGGAAGCTACATGTATTAAAGAAAAAAAACAGACCAAGAAGAAGAAGAAGAAGCTTATAGCGGAGGAATGCAATGAAGTCATAGAGCACATATCTAAAAATAATGAAGGCAGCATGGCAGAGGAACCTGGTGGGGCAAAAGTAACCTCATCAGACCCTAGTTCCATTCTCCTTGGGGGGTTTGAACCCAAGTCTGTAGAGAAGGTTTTGCCAGTTCTGCCGCAATGGCTGGCTCAGCCAAGTCTAGTACAGAAGAATATTAAACAGAACTTAGTTCCCATTCATGATATCCATTGTTTGCACCCTAAAGTGCTGAAAAAGCTAGAAGCCAATAAGGTGAAATATCTTTTTCCAGTTCAGGCTGAAGTTATCCCTGCCATTCTGGACAGCACCTGCCATGGTTTCTTATTGGGTAAGGGTGGATACCGTCCCAGTGATGTTTGTGTATCTGCACCTACAGGAAGTGGAAAGACCTTGGCATTTGTTATCCCTATAGTTCAGGCTCTGCTACAGCGAGTAGTGTGTGAAGTGAGAGCACTTGTTGTGTTGCCTACCAAAGAGCTGGCCCAGCAGGTCTGTAAGGTATTTAACACTTACGTGGATGGTATGGGACTGAAAGTGGTAATGGTAACAGGGCAGAAATCTTTCCTTAAAGAGCAGGAATCTCTTATACACAAAACAGCATTTGGCTTTTGCAGCCTGGCAGATATTCTTGTGTGCACCCCAGGAAGGCTTGTAGATCATATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTCTAACCCAGAACCCGGAGAAACTAAAACAGCTGGGCCTGTATCAACCCAGGCTCTTCACCTCCAAGCAAAAGGGAACGTCAGATGATTCCTCTGAAACACAAATGGAATCAAGTACATCAGGGAATTTTTCCCTTCCAGAGGGACTTACGCATTATTATATTCCCTGCAACCTCAATTCAAAGCCTCTTATCCTTCTGCACTTCCTCTTGTCTCTTCGTTTCTCCCGTGTCCTCTGTTTCACAAACTCAAGGGATGCCTCCCACCGCCTATATCTGTTGGTCCGCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAA
                                                  Xt7.1-CHK-1008266620                                                                                                                                                                                                                                                                                                   CCTTGGAGATGAGGTGACTACATCTGAAGATCGTTCCAAAGCCCTGTTACAGAAATTGCATGAACAGGCTAAGGATAGGCAGCAACAGAGACAGCACCCAAAAGCGAAGGCTTCTCCAAAAGATGACCATGTCGAAGAAACAAACACAAAACCCAGCATAAATGAAACCCTAAGGAAAACTAAAAAAAGAAAGAAAAAACAAGAGGAGGAAGAAGAAGGTGAATTGAAGAGTCCTAGTGATGAGAATGAACAGGACAGTGGGCAACAGGAAGCTACATGTATTAAAGAAAAAAAACAGACCAAGAAGAAGAAGAAGAAGCTTATAGCGGAGGAATGCAATGAAGTCATAGAGCACATATCTAAAAATAATGAAGGCAGCATGGCAGAGGAACCTGGTGGGGCAAAAGTAACCTCATCAGACCCTAGTTCCATTCTCCTTGGGGGGTTTGAACCCAAGTCTGTAGAGAAGGTTTTGCCAGTTCTGCCGCAATGGCTGGCTCAGCCAAGTCTAGTACAGAAGAATATTAAACAGAACTTAGTTCCCATTCATGATATCCATTGTTTGCACCCTAAAGTGCTGAAAAAGCTAGAAGCCAATAAGGTGAAATATCTTTTTCCAGTTCAGGCTGAAGTTATCCCTGCCATTCTGGACAGCACCTGCCATGGTTTCTTATTGGGTAAGGGTGGATACCGTCCCAGTGATGTTTGTGTATCTGCACCTACAGGAAGTGGAAAGACCTTGGCATTTGTTATCCCTATAGTTCAGGCTCTGCTACAGCGAGTAGTGTGTGAAGTGAGAGCACTTGTTGTGTTGCCTACCAAAGAGCTGGCCCAGCAGGTCTGTAAGGTATTTAACACTTACGTGGATGGTATGGGACTGAAAGTGGTAATGGTAACAGGGCAGAAATCTTTCCTTAAAGAGCAGGAATCTCTTATACACAAAACAGCATTTGGCTTTTGCAGCCTGGCAGATATTCTTGTGTGCACCCCAGGAAGGCTTGTAGATCATATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTCTAACCCAGAACCCGGAGAAACTAAAACAGCTGGGCCTGTATCAACCCAGGCTCTTCACCTCCAAGCAAAAGGGAACGTCAGATGATTCCTCTGAAACACAAATGGAATCAAGTACATCAGGGAATTTTTCCCTTCCAGAGGGACTTACGCATTATTATATTCCCTGCAACCTCAATTCAAAGCCTCTTATCCTTCTGCACTTCCTCTTGTCTCTTCGTTTCTCCCGTGTCCTCTGTTTCACAAACTCAAGGGATGCCTCCCACCGCCTATATCTGTTGGTCCGCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                  2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     2     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     9    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12     7    12     9    13     9    13     9    13     9    13     9    13     9    13     9    13     9    13     8    13     9    13     8    13     9    13     9    13     9    13    10    14    10    14     9    14    10    13     9    13    10    13    10    14    11    14    11    14    10    14    11    14    11    14    10    15    12    16    12    16    12    16    12    16    12    16    13    17    13    17    13    17    13    17    14    17    13    17    12    16    13    16    12    15    11    15    10    14    10    14    10    13     9    13     9    13     9    13     6     9
  5   1   2  SIG                                    Xt7.1-TTbA001b22.3                                                                                                                                                                                                                                                                         GGATCCATCGATTCAATCGGCACGTACCTTGGAGATGAGGTGACTACATCTGAAGATCGTTCCAAAGCCCTGTTACAGAAATTGCATGAACAGGCTAAGGATAGGCAGCAACAGAGACAGCACCCAAAAGCGAAGGCTTCTCCAAAAGATGACCATGTCGAAGAAACAAACACAAAACCCAGCATAAATGAAACCCTAAGGAAAACTAAAAAAAGAAAGAAAAAACAAGAGGAGGAAGAAGAAGGTGAATTGAAGAGTCCTAGTGATGAGAATGAACAGGACAGTGGGCAACAGGAAGCTACATGTATTAAAGAAAAAAAACAGACCAAGAAGAAGAAGAAGAAGCTTATAGCGGAGGAATGCAATGAAGTCATAGAGCACATATCTAAAAATAATGAAGGCAGCATGGCAGAGGAACCTGGTGGGGCAAAAGTAACCTCATCAGACCCTAGTTCCATTCTCCTTGGGGGGTTTGAACCCAAGTCTGTAGAGAAGGTTTTGCCAGTTCTGCCGCAATGGCTGGCTCAGCCAAGTCTAGTACAGAAGAATATTAAACAGAACTTAGTTCCCATTCATGATATCCATTGTTTGCACCCTAAAGTGCTGAAAAAGCTAGAAGCCAATAAGGTGAAATATCTTTTTCCAGTTCAGGCTGAAGTTATCCCTGCCATTCTGGACAGCACCTGCCATGGTTTCTTATTGGGTAAGGGTGGATACCGTCCCAGTGATGTTTGTGTATCTGCACCTACAGGAAGTGGAAAGACCTTGGCATTTGTTATCCCTATAGTTCAGGCTCTGCTACAGCGAGTAGTGTGTGAAGTGAGAGCACTTGTTGTGTTGCCTACCAAAGAGCTGGCCCAGCAGGTCTGTAAGGTATTTAACACTTACGTGGATGGTATGGGACTGAAAGTGGTAATGGTAACAGGGCAGAAATCTTTCCTTAAAGAGCAGGAATCTCTTATACACAAAACAGCATTTGGCTTTTGCAGCCTGGCAGATATTCTTGTGTGCACCCCAGGAAGGCTTGTAGATCATATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTC------------------------------------------------------------------------------------------------------------------------------------TTATATTTCCCCCTGCCACCCTCCAATTCCAAGCCCTCCTTTATCCCTTCCTGCCACCTTCCTCTTGTCCTCTTCCTTTCCTCCCCCGTGTCCTCCTGTTTCCACAAACTCCAGGGAATGCCCTCCCCACCCGCCTATATCTGTTGGTCCCCCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCTCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTAAAAAAAAAAAAAAAAAAGCG
  5   1   2  SIG                                      Xt7.1-CABK1658.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTCTAACCCAGAACCCGGAGAAACTAAAACAGCTGGGCCTGTATCAACCCAGGCTCTTCACCTCCAAGCAAAAGGGAACGTCAGATGATTCCTCTGAAACACAAATGGAATCAAGTACATCAGGGAATTTTTCCCTTCCAGAGGGACTTACGCATTATTATATTCCCTGCAACCTCAATTCAAAGCCTCTTATCCTTCTGCACTTCCTCTTGTCTCTTCGTTTCTCCCGTGTCCTCTGTTTCACAAACTCAAGGGATGCCTCCCACCGCCTATATCTGTTGGTCCGCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-XZT31498.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGGAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAACTGACTCTTGTGTATAAACAAAACAGTTTTCTATTTCAAAGTGGAATAAAAGGGCTGTAAAAAAAAAAAAAAAAAAA
  5   1   2                                         Xt7.1-TTbA059c20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGCTCGTGCAGGGAAAGCTGGCCTACCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCATAAGTGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGATCAGCGATACGAAGAGGCTCTGATTGAGTTACAGCGAGCAGTCAATAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCCTCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATTTATGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATTAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGCTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTGAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCATTCTTTTTGTCTATAGGGGTGGGGTTAAAAATCCAACCCCCCTATAGACTGTTTTAGGTACCGGGCCCTAAATCATTTGGCCAGTTAACAAATATGAGTCGTGGGGAGGTTGTCCTTTTGGTATTTGCCTTCATCCAAAGCCAAGTGGGGTGTCCCAAGTTCCCGAAAAAAGGGAATTCAGGTGAAGGAAGGCGTTTGGGTTAGCAAATAAATACATTTTTTTTTTTTTTAAAAAAAAAAAAGATTTTAAGAAAC
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----G------
                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ==== 9e-025     BAE93318.1 zinc finger protein [Ciona intestinalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Bf ---- 2e-025     AAM18861.1 unknown [Branchiostoma floridae] ---------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                    PROTEIN --- Cs ---- 4e-026     BAB12216.1 vasa homolog [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Xt ---- 7e-039     AAH64887.1 Hypothetical protein MGC76291 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 1e-042     AAH97561.1 MGC114699 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Ce ==== 7e-049     NP_498690.2 ZK686.2 [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 4e-051     NP_014436.1 Dead Box Protein 6; Dbp6p [Saccharomyces cerevisiae] ---=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 3e-090     NP_476833.1 Dead box protein 73D CG9680-PA [Drosophila melanogaster] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PREDICTED - Sp ---- 4e-130     XP_797208.2 PREDICTED: similar to DEAD/H box 51 RNA helicase, partial [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 0          NP_081432.2 DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 0          NP_778236.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 51 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PREDICTED - ?? ---- 0          XP_706660.1 PREDICTED: similar to DEAD/H box 51 RNA helicase isoform 3 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 0          XP_682705.1 PREDICTED: similar to DEAD/H box 51 RNA helicase isoform 1 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 0          XP_415229.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK1658.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------TAA---------TAG---------------------------------------------TGA---------------TGA------------------------------------TGA------------------------------------------------------------------ATG------------------------------------------------------------------------------------TGA------------------------------------------------TAA------------------------------------------------TGA------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2  SIG                                    Xt7.1-TTbA001b22.3                                                                                                                                                                                                                                                                         GGATCCATCGATTCAATCGGCACGTACCTTGGAGATGAGGTGACTACATCTGAAGATCGTTCCAAAGCCCTGTTACAGAAATTGCATGAACAGGCTAAGGATAGGCAGCAACAGAGACAGCACCCAAAAGCGAAGGCTTCTCCAAAAGATGACCATGTCGAAGAAACAAACACAAAACCCAGCATAAATGAAACCCTAAGGAAAACTAAAAAAAGAAAGAAAAAACAAGAGGAGGAAGAAGAAGGTGAATTGAAGAGTCCTAGTGATGAGAATGAACAGGACAGTGGGCAACAGGAAGCTACATGTATTAAAGAAAAAAAACAGACCAAGAAGAAGAAGAAGAAGCTTATAGCGGAGGAATGCAATGAAGTCATAGAGCACATATCTAAAAATAATGAAGGCAGCATGGCAGAGGAACCTGGTGGGGCAAAAGTAACCTCATCAGACCCTAGTTCCATTCTCCTTGGGGGGTTTGAACCCAAGTCTGTAGAGAAGGTTTTGCCAGTTCTGCCGCAATGGCTGGCTCAGCCAAGTCTAGTACAGAAGAATATTAAACAGAACTTAGTTCCCATTCATGATATCCATTGTTTGCACCCTAAAGTGCTGAAAAAGCTAGAAGCCAATAAGGTGAAATATCTTTTTCCAGTTCAGGCTGAAGTTATCCCTGCCATTCTGGACAGCACCTGCCATGGTTTCTTATTGGGTAAGGGTGGATACCGTCCCAGTGATGTTTGTGTATCTGCACCTACAGGAAGTGGAAAGACCTTGGCATTTGTTATCCCTATAGTTCAGGCTCTGCTACAGCGAGTAGTGTGTGAAGTGAGAGCACTTGTTGTGTTGCCTACCAAAGAGCTGGCCCAGCAGGTCTGTAAGGTATTTAACACTTACGTGGATGGTATGGGACTGAAAGTGGTAATGGTAACAGGGCAGAAATCTTTCCTTAAAGAGCAGGAATCTCTTATACACAAAACAGCATTTGGCTTTTGCAGCCTGGCAGATATTCTTGTGTGCACCCCAGGAAGGCTTGTAGATCATATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTC------------------------------------------------------------------------------------------------------------------------------------TTATATTTCCCCCTGCCACCCTCCAATTCCAAGCCCTCCTTTATCCCTTCCTGCCACCTTCCTCTTGTCCTCTTCCTTTCCTCCCCCGTGTCCTCCTGTTTCCACAAACTCCAGGGAATGCCCTCCCCACCCGCCTATATCTGTTGGTCCCCCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCTCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTAAAAAAAAAAAAAAAAAAGCG
                                                  Xt7.1-CHK-1008295388                                                                                                                                                                                                                                                                               ATCGATTCAATCGGCACGxxxCTTGGAGATGAGGTGACTACATCTGAAGATCGTTCCAAAGCCCTGTTACAGAAATTGCATGAACAGGCTAAGGATAGGCAGCAACAGAGACAGCACCCAAAAGCGAAGGCTTCTCCAAAAGATGACCATGTCGAAGAAACAAACACAAAACCCAGCATAAATGAAACCCTAAGGAAAACTAAAAAAAGAAAGAAAAAACAAGAGGAGGAAGAAGAAGGTGAATTGAAGAGTCCTAGTGATGAGAATGAACAGGACAGTGGGCAACAGGAAGCTACATGTATTAAAGAAAAAAAACAGACCAAGAAGAAGAAGAAGAAGCTTATAGCGGAGGAATGCAATGAAGTCATAGAGCACATATCTAAAAATAATGAAGGCAGCATGGCAGAGGAACCTGGTGGGGCAAAAGTAACCTCATCAGACCCTAGTTCCATTCTCCTTGGGGGGTTTGAACCCAAGTCTGTAGAGAAGGTTTTGCCAGTTCTGCCGCAATGGCTGGCTCAGCCAAGTCTAGTACAGAAGAATATTAAACAGAACTTAGTTCCCATTCATGATATCCATTGTTTGCACCCTAAAGTGCTGAAAAAGCTAGAAGCCAATAAGGTGAAATATCTTTTTCCAGTTCAGGCTGAAGTTATCCCTGCCATTCTGGACAGCACCTGCCATGGTTTCTTATTGGGTAAGGGTGGATACCGTCCCAGTGATGTTTGTGTATCTGCACCTACAGGAAGTGGAAAGACCTTGGCATTTGTTATCCCTATAGTTCAGGCTCTGCTACAGCGAGTAGTGTGTGAAGTGAGAGCACTTGTTGTGTTGCCTACCAAAGAGCTGGCCCAGCAGGTCTGTAAGGTATTTAACACTTACGTGGATGGTATGGGACTGAAAGTGGTAATGGTAACAGGGCAGAAATCTTTCCTTAAAGAGCAGGAATCTCTTATACACAAAACAGCATTTGGCTTTTGCAGCCTGGCAGATATTCTTGTGTGCACCCCAGGAAGGCTTGTAGATCATATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCAGACTCCTCTACAGAAACTGCTCTTCTCAG------------------------------------------------------------------------------------------------------------------------------------------------TTCCCCCTGCCACCCTCCAATTCCAAGCCCTCCTTTATCCCTTCCTGCCACCTTCCTCTTGTCCTCTTCCTTTCCTCCCCCGTGTCCTCCTGTTTCCACAAACTCCAGGGAATGCCCTCCCCACCCGCCTATATCTGTTGGTCCCCCAGCxTTxGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCTCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTAAAAAAAAAAAAAAA
  5   1   2       ext Ovi1 PIPE in                        CABI12683.5p                                                                                                                                                                                                                                                                         GGATCCATCGATTCAATCGGCACGAGGCTTGGAGATGAGGTGACTACATCTGAAGATCGTTCCAAAGCCCTGTTACAGAAATTGCATGAACAGGCTAAGGATAGGCAGCAACAGAGACAGCACCCAAAAGCGAAGGCTTCTCCAAAAGATGACCATGTCGAAGAAACAAACACAAAACCCAGCATAAATGAAACCCTAAGGAAAACTAAAAAAAGAAAGAAAAAACAAGAGGAGGAAGAAGAAGGTGAATTGAAGAGTCCTAGTGATGAGAATGAACAGGACAGTGGGCAACAGGAAGCTACATGTATTAAAGAAAAAAAACAGACCAAGAAGAAGAAGAAGAAGCTTATAGCGGAGGAATGCAATGAAGTCATAGAGCACATATCTAAAAATAATGAAGGCAGCATGGCAGAGGAACCTGGTGGGGCAAAAGTAACCTCATCAGACCCTAGTTCCATTCTCCTTGGGGGGTTTGAACCCAAGTCTGTAGAGAAGGTTTTGCCAGTTCTGCCGCAATGGCTGGCTCAGCCAAGTCTAGTACAGAAGAATATTAAACAGAACTTAGTTCCCATTCATGATATCCATTGTTTGCACCCTAAAGTGCTGAAAAAGCTAGAAGCCAATAAGGTGAAATATCTTTTTCCAGTTCAGGCTGAAGTTATCCCTGCCATTCTGGACAGCACCTGCCATGGTTTCTTATTGGGTAAGGGTGGATACCGTCCCAGTGATGTTTGTGTATCTGCACCTACAGGAAGTGGAAAGACCTTGGCATTTGTTATCCCTATAGTTCAGGCTCTGCTACAGCGAGTAGTGTGTGAAGTGAGAGCACTTGTTGTGTTGCCTACCAAAGAGCTGGCCCAGCAGGTCT
  3   1   3        nb Ovi1      in                        CABI14199.3p                                                                                                                                                                                                                                                                                             CAGATACCTTGGAGATGAGGTGACTACATCTGAAGATCGTTCCAAAGCCCTGTTACAGAAATTGCATGAACAGGCTAAGGATAGGCAGCAACAGAGACAGCACCCAAAAGCGAAGGCTTCTCCAAAAGATGACCATGTCGAAGAAACAAACACAAAACCCAGCATAAATGAAACCCTAAGG
  5   1   3        nb Ovi1      in                        CABI14199.5p                                                                                                                                                                                                                                                                                             CAGATACCTTGGAGATGAGGTGACTACATCTGAAGATCGTTCCAAAGCCCTGTTACAGAAATTGCATGAACAGGCTAAGGATAGGCAGCAACAGAGACAGCACCCAAAAGCGAAGGCTTCTCCAAAAGATGACCATGTCGAAGAAACAAACACAAAACCCAGCATAAATGAAACCCTAAGGAAAACCAAAAAAAAAAAAAAA
  5   1   4      seed TbA       in                   TTbA001b22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGTCTAGTACAGAAGAATATTAAACAGAACTTAGTTCCCATTCATGATATCCATTGTTTGCACCCTAAAGTGCTGAAAAAGCTAGAAGCCAATAAGGTGAAATATCTTTTTCCAGTTCAGGCTGAAGTTATCCCTGCCATTCTGGACAGCACCTGCCATGGTTTCTTATTGGGTAAGGGTGGATACCGTCCCAGTGATGTTTGTGTATCTGCACCTACAGGAAGTGGAAAGACCTTGGCATTTGTTATCCCTATAGTTCAGGCTCTGCTACAGCGAGTAGTGTGTGAAGTGAGAGCACTTGTTGTGTTGCCTACCAAAGAGCTGGCCCAGCAGGTCTGTAAGGTATTTAACACTTACGTGGATGGTATGGGACTGAAAGTGGTAATGGTAACAGGGCAGAAATCTTTCCTTAAAGAGCAGGAATCTCTTATACACAAAACAGCATTTGGCTTTTGCAGCCTGGCAGATATTCTTGTGTGCACCCCAGGAAGGCTTGTAGATCATATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTCTAACC
  5   1   2       ext TbA                            TTbA067n20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTATTATATTTCCCCCTGCCACCCTCCAATTCCAAGCCCTCCTTTATCCCTTCCTGCCACCTTCCTCTTGTCCTCTTCCTTTCCTCCCCCGTGTCCTCCTGTTTCCACAAACTCCAGGGAATGCCCTCCCCACCCGCCTATATCTGTTGGTCCCCCAGCCTTTGAGGAATCAGTGTGGCAGAATTTTCCTCCT
  5   1   2       ext Tad5                                 XZT48762.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCTCCCACCGCCTATATCTGTTGGTCCGCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTAtagtccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatggaaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaatA
  3   1   2       ext Ovi1 PIPE in                        CABI12683.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTAtagtccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatggaaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggtttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcctctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTAAAAAAAAAAGCCTCTCGC
  3   1   4      seed TbA       in                    TTbA001b22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatggaaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggtttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Bone                                CBTC1690.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCTCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGTGTAAGCAAATAAATACATTTTTATTTATTTAAACTG
  5   1   2  SIG                                      Xt7.1-CABK1658.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTCTAACCCAGAACCCGGAGAAACTAAAACAGCTGGGCCTGTATCAACCCAGGCTCTTCACCTCCAAGCAAAAGGGAACGTCAGATGATTCCTCTGAAACACAAATGGAATCAAGTACATCAGGGAATTTTTCCCTTCCAGAGGGACTTACGCATTATTATATTCCCTGCAACCTCAATTCAAAGCCTCTTATCCTTCTGCACTTCCTCTTGTCTCTTCGTTTCTCCCGTGTCCTCTGTTTCACAAACTCAAGGGATGCCTCCCACCGCCTATATCTGTTGGTCCGCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008295386                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTCTAACCCAGAACCCGGAGAAACTAAAACAGCTGGGCCTGTATCAACCCAGGCTCTTCACCTCCAAGCAAAAGGGAACGTCAGATGATTCCTCTGAAACACAAATGGAATCAAGTACATCAGGGAATTTTTCCCTTCCAGAGGGACTTACGCATTATTATATTCCCTGCAACCTCAATTCAAAGCCTCTTATCCTTCTGCACTTCCTCTTGTCTCTTCGTTTCTCCCGTGTCCTCTGTTTCACAAACTCAAGGGATGCCTCCCACCGCCTATATCTGTTGGTCCGCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAAA
  5   1   2       ext Spl1      in                         CABK1658.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCATCGATTCGCCAGTTCAGGCTGAAGTTATCCCTGCCATTCTGGACAGCACCTGCCATGGTTTCTTATTGGGTAAGGGTGGATACCGTCCCAGTGATGTTTGTGTATCTGCACCTACAGGAAGTGGAAAGACCTTGGCATTTGTTATCCCTATAGTTCAGGCTCTGCTACAGCGAGTAGTGTGTGAAGTGAGAGCACTTGTTGTGTTGCCTACCAAAGAGCTGGCCCAGCAGGTCTGTAAGGTATTTAACACTTACGTGGATGGTATGGGACTGAAAGTGGTAATGGTAACAGGGCAGAAATCTTTCCTTAAAGAGCAGGAATCTCTTATACACAAAACAGCATTTGGCTTTTGCAGCCTGGCAGATATTCTTGTGTGCACCCCAGGAAGGCTTGTAGATCATATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTCTAACCCAGAACCCGGAGAAACTAAAACAGCTGGGCCTGTATCAACCCAGGCTCTTCACCTCCAAGCAAAAGGGAACGTCAGATGATTCCTCTGAAACACAAATGGAATCAAGTACATCAGGGAATTTTTCCCTTCCAGAGGGACTTACGCATTATTATATTCCCTGCAACCTCAATTCAAAGCCTCTTATCCTTCTGCACTTCCTCTTGTCTCTTCGTTTCTCCCGTGTCCTCTGTTTCACAAACTCAAGGGATGCCTCCCACCGCCTATATCTGTTGGTC
  5   1   4      seed TpA       in                   TTpA003k10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGTGTGCACCCCANGGAAGGGCTTGGCAGATTATATTCAGCAAACAGAAGGCTTTAACCTGAGACACCTTCGGTTCTTGGTTATAGATGAAGCAGATCGAATGATTGACAGCATGAATCAGGATTGGCTCAGTCATGTTACTAAAGCAGTGTTTCAAGTGGTGGCTGATTCCCCCAATATGCTTTTTACCAGGAAAGAGCCTGGAATACTCACAGCAGCCAGCTCCTGCCTTCCCCAGACTCCTCTACAGAAACTGCTCTTCTCAGCCACTCTAACCCAGAACCCGGAGAAACTAAAACAGCTGGGCCTGTATCAACCCAGGCTCTTCACCTCCAAGCAAAAGGGAACGTCAGATGATTCCTCTGAAACACAAATGGAATCAAGTACATCAGGGAATTTTTCCCTTCCAGAGGGACTTACGCATTATTATATTCCCTGCAACCTCAATTCAAAGCCTCTTATCCTTCTGCACTTCCTCTTGTCTCTTCGTTTCTCCCGTGTCCTCTGTTTCACAAACTCAAGGGATGCCTCCCACCGCCTATATCTGTTGGTCCGCAGCTTTGGAGGAATCAGTGTGGCAGAATTTTCCTCTCGCCTTAGTCCAGGGGAGAGGAAGAAGACCCTGAAGGAATTTGAGCAGGGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGG
  3   1   2       ext Spl1      in                         CABK1658.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTAtagtccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatggaaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggtttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATT
  5   1   2       ext TbA       in                   TTbA059d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTGATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCCTCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatttatggagagcaacacaagcatggaaaaacattctgaagctgtcaattagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggcttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttgaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAGAAATGGGAATCCAGGTGACT
  3   1   4      seed TpA       in                    TTpA003k10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCCCCAGAAATGCAAAAGCAACTGGGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatggaaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggtttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG27821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTAtagtccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatggaaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggtttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas7      in                         XZG27821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTAtagtccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatggaaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggtttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTTATTTATTTAAAAAAAAAAAAAAAG
  3   1   2       ext TbA       in                    TTbA059d02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGAGATCCTAAGACTTGGAATAGCTTTATGACATAAAACTCTTTTTCCTTTTGGAGAAAGATAGTTGCTGACTGTCCTGGATTCATTGACCCTTTAGTCcagggatccccaaccttttatacccgtgagcccccttcaaatggaaaaatttttggggggcaacacaagcttggaaaaacattttgaaggtgtcaattagagctataattggctatttgatagcccctgtgttgactgacagcctacagaagggtttgttgggcaattacactgggtttttatgaaaccaaagcttgcttcctaaccagaaattgaaaaacgagcaactgctttgaggccactgggggcaacatccaaggggttggggggcaacatgtttcccctgagcccctggttggggatcactgCTATAGTCAGTAGTGGTGGAGCTAAGCTGCCAACACCCCTTTAGACCTGTTCAGTTACCCGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGGGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGGGTCCCAAGTCCCCGAAAAAAGGGAATCCAGGTGACTGAAGGGGTTTGGGTAAGCAAAAAAATACATTTTTTTTTTTTTTaaaaaaaaaaatacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  5   1   3        nb Tad5                                 XZT24856.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 cttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAAAAAAAAAAGG
  5   1   3        nb Ova1      in                         CABE4597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCGATTCGCGGCGTGTTGCCTCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ova1      in                         CABE4597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGCGTGTTGCCTCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTT
  5   1   3        nb TbA                            TTbA059c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTGCATCATTCGGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCAT
  5   1   2                                           Xt7.1-XZT31498.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGGAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAACTGACTCTTGTGTATAAACAAAACAGTTTTCTATTTCAAAGTGGAATAAAAGGGCTGTAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008295394                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATCTTTGGAGAGCAACACAAGCATGGGAAAACATTCTGAAGCTGTCAATGAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGTTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCACTGCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAACTGACTCTTGTGTATAAACAAAACAGTTTTCTATTTCAAAGTGGAATAAAAGGGCTGTAAAAAAAAAAAAA
  5   1   4      seed Tad5      in                         XZT31498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAAAGTTCAGCTGTTGATCAGCACCGATGCAACAGCTAGAGGAATTGATATCAAGGGAGTCAAATGTGTGATAAACTATGATGCGCCACAGTTCATTCGGACATATGTTCATAGGGTGGGTCGAACAGCTCGTGCAGGGAAAGCTGGCCTAGCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCAGAAATGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGAGCAGCGATACGAAGAGGCTCTAATTGAGTTACAGCGAGCAGTCAAGAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCATCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTAtagtccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatgggaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggtttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGGGAGC
  3   1   4      seed Tad5      in                         XZT31498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTAtagtccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatctttggagagcaacacaagcatgggaaaacattctgaagctgtcaatgagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggtttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttaaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTCCCAGAAAAATGGGAATCCAGGTGACTGAAGGCGTTTGCGTAAGCAAATAAATACATTTTTATTTATTTAAACTGACTCTTGTGTATAAACAAAACAGTTTTCTATTTCAAAGTGGAATAAAAGGGCTGTAAAAAAAAAAAAAAAAAAACC
  5   1   2                                         Xt7.1-TTbA059c20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGCTCGTGCAGGGAAAGCTGGCCTACCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCATAAGTGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGATCAGCGATACGAAGAGGCTCTGATTGAGTTACAGCGAGCAGTCAATAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCCTCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATTTATGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATTAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGCTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTGAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCATTCTTTTTGTCTATAGGGGTGGGGTTAAAAATCCAACCCCCCTATAGACTGTTTTAGGTACCGGGCCCTAAATCATTTGGCCAGTTAACAAATATGAGTCGTGGGGAGGTTGTCCTTTTGGTATTTGCCTTCATCCAAAGCCAAGTGGGGTGTCCCAAGTTCCCGAAAAAAGGGAATTCAGGTGAAGGAAGGCGTTTGGGTTAGCAAATAAATACATTTTTTTTTTTTTTAAAAAAAAAAAAGATTTTAAGAAAC
                                                  Xt7.1-CHK-1008295392                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGCAGGGAAAGCTGGCCTACCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCATAAGTGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGATCAGCGATACGAAGAGGCTCTGATTGAGTTACAGCGAGCAGTCAATAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCCTCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTCCAGGGATCCCCAACCTTTTATACCCGTGAGCCACATTCAAATGGAAAAATTTATGGAGAGCAACACAAGCATGGAAAAACATTCTGAAGCTGTCAATTAGAGCTATAATTGGCTATTTGATAGCCCCTGTGTTGACTGACAGCCTACAGAAGGCTTTGTTGGGCAATTACACTGGGCTTTTATGAAACCAAAGCTTGCCTCCTAACCAGAAATTGAAAAACGAGCAACTGCTTTGAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTTGCCCCTGAGCCACTGGTTGGGGATCATTCTTTTTGTCTATAGGGGTGGGGTTAAAAATCCAACCCCCCTATAGACTGTTTTAGGTACCGGGCCCTAAATCATTTGGCCAGTTAACAAATATGAGTCGTGGGGAGGTTGTCCTTTTGGTATTTGCCTTCATCCAAAGCCAAGTGGGGTGTCCCAAGTTCCCGAAAAAAGGGAATTCAGGTGAAGGAAGGCGTTTGGGTTAGCAAATAAATACATTTTTTTTTTTTTTAAAAAAAAAAAAGATTTTA
  5   1   4      seed TbA       in                   TTbA059c20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGCTCGTGCAGGGAAAGCTGGCCTACCATTCACAATGCTGCTGAAAGTGCAGGAAAACCCCTATTTCAGTATGTTGAGGGATGCGGGCGCCCCATAAGTGCAAAAGCAACTGGTGAAGAGTGAGAATCTGAAGCAATATGATCAGCGATACGAAGAGGCTCTGATTGAGTTACAGCGAGCAGTCAATAATGAGAGAGCTCAGAAGAGATCCTAAGACTTGGAATAGCTCTATGACATAAAACTCCTCTTCCTCTTGGAGAAAGCTAGCTGCTGACTGTCCTGGATTCACTGACCCTATAGTccagggatccccaaccttttatacccgtgagccacattcaaatggaaaaatttatggagagcaacacaagcatggaaaaacattctgaagctgtcaattagagctataattggctatttgatagcccctgtgttgactgacagcctacagaaggctttgttgggcaattacactgggcttttatgaaaccaaagcttgcctcctaaccagaaattgaaaaacgagcaactgctttgaggccactgggagcaacatccaaggggttggggagcaacatgttgcccctgagccactggttggggatcactgCTATAGTCAGTAGTGCTGGAGCTAAGCTGCCAACACCCCTATAGACCTGTTCAGCTACCAGGCCCTAAATCATTCAGCCAGTTAACAAGTATTGCTCCTGGTGAGCTTGTCCTTTTTGTATTTGCCTTCATCCAGAGCCAAGTAGGGTGTCACAAGTC
  3   1   4      seed TbA       in                    TTbA059c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGCCCCCTTTTTGATTGACAGCCTACAGAAGGTTTTTTTGGGCAAATCCTCTCGGGttttatgaaaccaaagggtgcctcttaacccgaaattgaaaaacgagcaattgttttggggcccctgggggcaacatccaaggggttgggggggaacatgttgcccctgagccattggttggggatcaTTCTTTTTGTCTATAGGGGTGGGGTTAAAAATCCAACCCCCCTATAGACTGTTTTAGGTACCGGGCCCTAAATCATTTGGCCAGTTAACAAATATGAGTCGTGGGGAGGTTGTCCTTTTGGTATTTGCCTTCATCCAAAGCCAAGTGGGGTGTCCCAAGTTCCCGAAAAAAGGGAATTCAGGTGAAGGAAGGCGTTTGGGTTAGCAAATAAATACATTTTTTTTTTTTTTAAAAAAAAAAAAGATTTTAAGAAACAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)