Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012155088 Xt7.1-CABI14455.5.5 - 29 ESTs
                                                                       ..-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABI14455.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACGCGCTTATTGCTGAGTTGGAAGGAGCCGTAAGGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCTTCGCAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACTTGTGTCATGGTTCTGGTTCTGTCCTTCTGCCTCATTCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACAGCCGGCACGTAGTCATTTCCCGCCAGTTGCGAGAGCTCCCCACAGAGTCGGCCTTCCCTCCGCTTCCGGATCTGGGTGCACAGCAGAACCCGCGTGTCGACATCGCCCCCCAGGAGAAACCACAGGAGAACCTGCTGGACCTGTCCCTGAAGGACCTGCACCTGGATCCGGTTCTGCAGGGGGCCCAGAATGACACCCCAGAGGTGCAGGACGTGGGCACGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCTTTGACCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACGCTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTG
                                                  Xt7.1-CHK-1008266915                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTATTGCTGAGTTGGAAGGAGCCGTAAGGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCTTCGCAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACTTGTGTCATGGTTCTGGTTCTGTCCTTCTGCCTCATTCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACAGCCGGCACGTAGTCATTTCCCGCCAGTTGCGAGAGCTCCCCACAGAGTCGGCCTTCCCTCCGCTTCCGGATCTGGGTGCACAGCAGAACCCGCGTGTCGACATCGCCCCCCAGGAGAAACCACAGGAGAACCTGCTGGACCTGTCCCTGAAGGACCTGCACCTGGATCCGGTTCTGCAGGGGGCCCAGAATGACACCCCAGAGGTGCAGGACGTGGGCACGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCTTTGACCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACGCTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGxxxCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     2     2     2     2     3     4     4     4     5     6     7     6     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     5     5     6     5     6     5     6     4     5     3     5     2     4     2     3     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     4     4     4     4     3     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     6     5     6     5     7     4     6     4     7     4     8     7     8     7     8     7     8     8     9     8     9     8     9     5     9     5     9     5     9     5     9     5     9     5     9     8     9     9    10    10    11    10    11    10    11     7    10     8    11     8    10     8    10     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    12     9    13     9    13     9    13     9    13     9    13    10    14    10    14    10    13    10    13    10    13    10    13    10    14    10    14    11    14    13    14    13    14    11    13    11    13    12    14    12    14    11    12    10    12     8    12    11    12     9    12    10    12    11    12    11    11    10    11     9    11     9    11     9    11     9    11     8    10     8    10     7    10     6    10     6    10     6    10     5     9     4     9     4     8     5     8     4     7
  5   1   2       e50                                Xt7.1-CABI13813.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACGCGCTTATTGCTGAGTTGGAAGGAGCCGTAAGGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCTTCGCAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACTTGTGTCATGGTTCTGGTTCTGTCCTTCTGCCTCATTCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACAGCCGGCACGTAGTCATTTCCCGCCAGTTGCGAGAGCTCCCCACAGAGTCGGCCTTCCCTCCGCTTCCGGATCTGGGTGCACAGCAGAACCCGCGTGTCGACATCGCCCCCCAGGAGAAACCACAGGAGAACCTGCTGGACCTGTCCCTGAAGGACCTGCACCTGGATCCGGTTCTGCAGGGGGCCCAGAATGACACCCCAGAGGTGCAGGACGTGGGCACGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCTTTGACCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACGCTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTATGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCCCTATTATGTGC
  5   1   2       e50                                Xt7.1-CABI14455.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                               BLH ATG     114     357                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN     114     105                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR      87     174                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               CDS MIN      87       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               EST CLI      39       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG      87      22                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                                                       PROTEIN --- Dm ---- 2e-024     NP_524087.3 CG7450-PA, isoform A [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 3e-035     BAE06358.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 3e-035     NP_491897.2 F57B10.1 [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 2e-038     XP_790412.2 PREDICTED: similar to CAMP responsive element binding protein 3-like 3 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 1e-041     AAI24054.1 CAMP responsive element binding protein 3-like 4 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 4e-047     NP_038525.2 cAMP responsive element binding protein 3 [Mus musculus] --------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 4e-048     NP_115996.1 cAMP responsive element binding protein 3-like 3 [Homo sapiens] -------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dr ==== 3e-057     NP_998697.1 zgc:66452 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 8e-069     XP_424990.1 PREDICTED: similar to Zgc:66452 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          AAH92317.1 Unknown (protein for MGC:115335) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = ?? ==== 0          NP_001090005.1 hypothetical protein LOC735076 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABI14455.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGA------------TGA---------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------ATGTAA------------------------------ATG------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TGA------------------------------------------------ATG---------------ATG------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------ATG------------------------------------------TGA------------------------TGA------------------------------------------------------------------ATG---------------TAA------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       e50                                Xt7.1-CABI13813.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACGCGCTTATTGCTGAGTTGGAAGGAGCCGTAAGGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCTTCGCAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACTTGTGTCATGGTTCTGGTTCTGTCCTTCTGCCTCATTCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACAGCCGGCACGTAGTCATTTCCCGCCAGTTGCGAGAGCTCCCCACAGAGTCGGCCTTCCCTCCGCTTCCGGATCTGGGTGCACAGCAGAACCCGCGTGTCGACATCGCCCCCCAGGAGAAACCACAGGAGAACCTGCTGGACCTGTCCCTGAAGGACCTGCACCTGGATCCGGTTCTGCAGGGGGCCCAGAATGACACCCCAGAGGTGCAGGACGTGGGCACGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCTTTGACCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACGCTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTATGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCCCTATTATGTGC
                                                  Xt7.1-CHK-1008233237                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTTATTGCTGAGTTGGAAGGAGCCGTAAGGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCTTCGCAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACTTGTGTCATGGTTCTGGTTCTGTCCTTCTGCCTCATTCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACAGCCGGCACGTAGTCATTTCCCGCCAGTTGCGAGAGCTCCCCACAGAGTCGGCCTTCCCTCCGCTTCCGGATCTGGGTGCACAGCAGAACCCGCGTGTCGACATCGCCCCCCAGGAGAAACCACAGGAGAACCTGCTGGACCTGTCCCTGAAGGACCTGCACCTGGATCCGGTTCTGCAGGGGGCCCAGAATGACACCCCAGAGGTGCAGGACGTGGGCACGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCTTTGACCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACGCTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTATGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCCCTATT
  5   1   2   10  bld Te1  5g3  in                        CBWN10767.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGAGATTTCCAGGTGACGCGCTTATTGCTGAGTTGGAAGGAGCCGTAAGGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTTTTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGG
  5   1   2       bld Te4  FL   in                          CAAN713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATTTCCAGGTGACGCGCTTATTGCTGAGTTGGAAGGAGCCGTAAGGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAG
  5   1   2       bld Gas  5g                        TGas030k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGTTGGAAGGAGCCGTAAGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACAGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAGCCTGAGCACCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACACAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAGGAANAGCANGANAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCTGGGTCTCCGGCTGACT
  5   1   2   14  bld Te4  5g3  in                         CAAN4082.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCCGTAAGGTGCGGGGGGATCGCAGTTTGTGCCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCT
  5   1   2   14  bld Te4  5g3  in                         CAAN3080.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGATTTCCAGGTGACGCGCTTATTGCTGAGTTGGAAGGAGCCGTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAAACAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCT
  5   1   2   20  bld Te1  5g                             CBWN10759.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTTGTGCCGAGATAACGGCTGTCTGAGCGCTATGATGTCTCTGCTGGGGGACATTACGGACATGGAGGTCCATCTCTTGGATTTCCTTTTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCATACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGACTGACCCGACGGTGGATGATTTCCTGAGAGATCT
  5   1   2   10 seed Ovi1 5g3  in                        CABI13813.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGATACCGGCTGTCTGAGCGCTAAGATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACCGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGATCTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCTTCGCAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACT
  5   1   2   14  bld Brn3 5g3  in                         CAAK2453.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTACCTCAGGCTATGAGTTCTATGTCTCTGCTGGGGGACATTACGGACATGGAGGCCCATCTCTTGGATTTCCTGCTGGAGGGCCCCTTTCCTAGTGAGAAGAATTGGGGGGCAGACCTGGCTGGGGCCCCTGAATGCTGCACCCTGGAGCCTGAGATGCTGAGTGACCCGACGGTGGATGATTTCCTGAGTGAGCTCCTCGGGGGGTGTGACGAGTCCAACCTGAGCAGCTCCCCTCCCCTGAGTGACAGCGGAATCTCTGACATTGCCTTCCCCTCACCCGCTGCCTGCGATGTGCCACTGGGGGCCTGGGACCACTCTCCCCCCTGCAGCCCAGACGTTATACAGAGCGAGCACAACTACTCCCTGCAGCAGGACAATGGGGGGGTCTTCCTGCAGAGTGTGCGCTCCGAGAACTGCGAGGGGGACATATTCATCGACCTTGACTTCTGTTCTGACTCAGAGCCACGGACACTGGGTATGGAGGAGGAGGAGGAGGAAGAGCAGGAGAATGAAGAGGAAGGCACTCAGTACCAGGGGCAGCCGGGTCTCCGGCTGACTGAGGAAGAGTCCCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAGCAGACCGGTCTCTGCTGCAGCAGCTTCGCAAC
  5   1   2       bld Tbd0                               IMAGE:6980175                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGCCTACTTGGAAAGGAAGGAATCATTTTACCCCAGCACCTGCCCCTCACTAAGGCGGAGGAGCGGGCGCTGAAACGCGTGCGCAGGAAGATCCGCAACAAGCGCTCCGCTCAGGAGAGTCGCAAGAAGAAGAAGGAGTACGTGGATGGGCTGGAGAGCAGGGTCACCGCGCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCTTCGCAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACTTGTGTCATGGTTCTGGTTCTGTCCTTCTGCCTCATTCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCATGACAGCCGGCACGTAGTCATTTCCCGCCAGTTGCGAGAGCTCCCCACAGAGTCGGCCTTCCCTCCGCTTCCAGATCTGGGGGCTCAGCAGAACCCGCGTGTCGACATCGCCCCCCAGGAGAAACCACAGGAGAACCTGCTGGACCTGTCCCTGAAAGACCGGCACCTGGATTCCGGTTTGCAGGGGGCCCAAATGACCCCCCAAAGGTGCAGAATTGGGCCCTGGTGAATCCAAACCCCCGGGACCAGTTAGTTTTTCCTTTAACCCCCCAAAAAAAAAAGGGCCCTGGTGGGAAAAACATTGGGTCTCAACTGTCCCCAAGGCCCCCTGTCCCTTTTTTTGGGGAAAACACATTGGTGGGAAACCCCACTGGTTTACCCCCCCCCTCGAGA
  5   1   2       bld Gas7      in                         XZG19076.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCCTGCACCACCCAAAACCAGGTTCTACAGAATCAGGTCCAGCAGCTGCAGAAACAGAACCGGTCTCTGCTGCAGCAGCTTCGCAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACTTGTGTCATGGTTCTGGTTCTGTCCTTCTGCCTCATTCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACAGCCGGCACGTAGTCATTTCCCGCCAGTTGCGAGAGCTCCCCACAGAGTCGGCCTTCCCTCCGCTTCCGGATCTGGGTGCACAGCAGAACCCGCGTGTCGACATCGCCCCCCAGGAGAAACCACAGGAGAACCTGCTGGACCTGTCCCTGAAGGACCTGCACCTGGATCCGGTTCTGCAGGGGGCCCAGAATGACACCCCAGAGGTGCAGGACGTGGGCACGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCCTTGATCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACACTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGG
  3   1   2       bld Ovi1 5g3  in                        CABI13813.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACCTCCAGGCTTTGCTGAGACAGACAGGAGTCAAGACTACAGCATCCAGCACTTGTGTCATGGTTCTGGTTCTGTCCTTCTGCCTCATTCTCTTCCCCAGTTTGTACCCATTTGGCAAAGGAGCCCCCCAGGACAGCCGGCACGTAGTCATTTCCCGCCAGTTGCGAGAGCTCCCCACAGAGTCGGCCTTCCCTCCGCTTCCAGATCTGGGGGCTCAGCAGAACCCGCGTGTCGACATCGCCCCCCAGGAGAAACCACAGGAGAACCTGCTGGACCTGTCCCTGAAGGACCTGCACCTGGATCCGGTTCTGCAGGGGGCCCAGAATGACACCCCAGAGGTGCAGGACGTGGGCACGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCTTTGACCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACGCTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTATGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCAG
  3  -1   2       bld Ovi1      in                        CABI14455.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGACCTGTCCCTGAAGGACCTGCACCTGGATCCGGTTCTGCAGGGGGCCCAGAATGACACCCCAGAGGTGCAGGACGTGGGCACGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCTTTGACCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACGCTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTATGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCCCTATTATGTGCTGAGGGGTACGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCATCCCATTGTGCTATCACTGGGGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCC
  5   1   2       bld Lun1      in                         CABD4912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCATCGATTCGCGGCGGAGTCCAAACCCACCGGCACCAGTAACTCTTCCTTTGACCTCCCTGAGAGAGAGAGTGAGCCTGGCATGGAGATACCAACTGGCTCCAACGCTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTATGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCCCTATTATGTGCTGA
  5   1   2       add In63                            IMAGE:8958315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGAAGATACCAACTGGCTCCAACACTGCCCCAGATGCCCCCCATGCCCGCTACGTCATGCAGGAGAAGCACGATTGGCTGGAGAGGACTCGCAGTGTGGTTATCAGCCCCCTGCACTCGGATGAGATGTAACACCGGCTGCCCGGGCAGTGCTGCTGGGTCATGGTGCCCCCCCCAATATGTGCTGAGGGGTACGGCACTACCTGCCCAACCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCATCCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCTATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCTCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGTCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGTACGGCACTACCTGCCCATCTCATTGTGCTATCACTGGTGTATTGTGCCCCCCATATGTGCTGAGGGGTACGCACTACCTGCCCAACCCATTGTGCTATCACTGTGTATGTGCCCCCCATTATGTGCTGAGGGTACGCACTACTGCATCCATTGGGCTATCACTGTGATGGCCCCCATTAGGCTGAGGTAGCTACTACATCATGGCTTCCTGGTATGGGCTGGAGATTGGGGGGGAATCCGCTACTTGCCACCCTA
  5   1   2       e50                                Xt7.1-CABI14455.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGAT
                                                  Xt7.1-CHK-1008232338                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATAC
  5   1   2       bld Hrt1      in                         CAAQ7527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGGGTACGGCACTACCTGCCCATCCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGC
  3  -1   2       bld Sto1                                 CABG3301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAAGTGCCCTCCTGCACTTTTGCCCAATGTAAATAGTAAATGACCC
  3   1   2       bld Gas7      in                         XZG59372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCCC
  5   1   2       bld Gas7      in                         XZG59372.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACAAGaaaaaaaaaaaaaaaataaaaaaaaataaaaaaaaaaaaaaaGG
  5  -1   2      seed Ovi1      in                        CABI14455.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCATTATGTGCTGAGGGGTAAGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGCCCCCCCCATTATGTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGCCTCGTGCCGAATTGA
  3   1   2       bld Te4  5g3  in                         CAAN4082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCTGAGGGGTACGGCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACAC
  3   1   2       bld Hrt1      in                         CAAQ7527.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACTACCTGCCCAACCCATTGTGCTATCACTGGTGTATTGTGGGCCTGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACAC
  3   1   2       bld Te4  FL   in                          CAAN713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTAAGATATTTTGGGGGTGGGATCAGCTACTTGCCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACTTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACAC
  3   1   2       bld Te4  5g3  in                         CAAN3080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCACCCATAGTGGCACCCTGCTATAGTTTCCCATTGTGGGTTATACCTCTGCCCGGCCCATTGTGCCCCCTGTAAATGATCATATGCCAAGGGTTGCACCGGTGCCCCGCCCATTGTGGCATCCCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACCTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATAC
  3   1   2       bld Gas7      in                         XZG19076.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGCCCATTGTGGCATCCCTAATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGACCATTAGGGGGAGGTTTGGGCTCCCAGGAATGGGGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTCTTCCTCGGGTTCGGGGGGGGGAACATGGGTTTTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCCCATTGAGCCCCAGCAGAAGGGAGAGAATCGGGTATTTTTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGCCCCTTGGGTGTTGTTATTCCCCCCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCAGATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACCC
  3   1   2       bld HeRe                             EC2CAA12CC08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTCTGATGCACTTACCCAGCGCCATGGGACCTGTCCTGCCCCCCCAGCAGTGTGTGGCCCCTGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTCTTCCTCTGGTTCTGGGGGGGAAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATTGGGTACCTCTGCCCTGAATACCCCCCCAGTCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCACCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCAGATTGTGT
  3   1   2       bld Lun1      in                         CABD4912.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAGCAGTAGGGGGAGGTTTGGGCTCCCAGGAATGGTGGCGCTTTGCACTTTCATGTATATAGGATTTCTGTAATATATTCATTGTTGTTCCTCTGGTTCTGGGGGGGAACATGGGATCTGGGGGGGCCCAAATCACTAACTGGCAAGTCTGTCCCTGCAGTTGGTCACTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATCGGGTACTTCTGCCCTGAATACCCCCCCAGCCCGTATGGGACCTACCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGCTTGATGATAAGTTGCCCTCTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAACCCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCACATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACAC
  3   1   2       add Brn3 5g3  in                         CAAK2453.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTTTGGTAATATATTCATTGTTCTTCCTCGGGTTTTGGGGGGGGAACATGGGTTTTGAGGGGGCCCAAATCTCTAATTGGCAAGTCTGTCCCTGCAGTTGGTCATTTTTCCCCATTGAGACCCAGCAGAAGGGAGAGATTCGGGTTCTTTTCCCCTGAATACCCCCCGAGCCCGTTTGGGACCTCCCCTCAGGGCCTGTGATTAGCTGATTGGCTGGGAGGTTTTCCCACCATTTTTTCCTTTGTAGGGGGACGTGCCCATTGGTTTAGAGGGATAGGGGGGTTTTCCCATTCAGGGGCTGCTTTAAGGCCTTTTTAGCCAATCATTTTTTGGCTGGAGGGGGGGGGGGTTCAGGGATGATAAGTTGCCCTTTTGCACTTTTGCCCAATGTAAATAGTAAATGCCCCTTGGGTGTTGTTATTCCCAGCTGATTAAAGCCCCCGCCTTCCCCCCCCCCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCAGATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACAC
  3   1   2       add Te1  5g3  in                        CBWN10767.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCAGTTGGTCATTTTTCCACATTGAGACCCAGCAGAAGGGAGAGAATTGGGTACTTTTGCCCTGAATACCCCCGGAGCCCGTATGGGACTTACCTTCAGGGCCTGTGATTAGTTGATTGGCTGGGAGGCTTTCCCAGCATTTTGTGCTGTGCAGGGGGACGTGCCCATTGGGTTAGAGGGATAGGAGGGTTTTGCCAGTCAGTGGTTGCATTAAGGCCTTTTTAGCCAATCAGTGTATGGTTGGGGGGGGTTCAGGGATGATAAGTTGCCTTTTTGCACTTTTGCCCAATGTAAATAGTAAATGACCCCCCCCCCAGCAAGGCCAGAGGAACCACAACCATTGTATCAGATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACACAAAAAAAAAAAAAAA
  5   1   0       add Te3                                 CAAM14482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTTTTGCCCAATCTAAATAGTAAATGACCCTTGGGTGTTGTTATTCCCAGCTGATTAAAGCCCCCGCCATCCCCCCCCCCCCCCCCCCAGGAAGGGCAGAGGAACCACAACCATTGTATCAGATTGTGTAACAGGAGGAATGTGCTGTAAATCTGTATAAATAATAATAAACTGATTGATACCCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGGGGGGCCTTTTTTAAATTTTTCGGGGGGGGGCAGAATTTTCTCCCCCCGTTTTTTTTTGAAAAAGGGGTCTCTTAGAGGGGGGGGAAAAAAAAAAAAGGGGGGGGTGTTTTTTTTACACCCGGGGGGGGAAAAAAAATTTTTTTGGTGTTTTTTTGGAAAAAAAATTTTTTTTTGGGGGGGGAAATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)