Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG12099.5                            2 END     1           5       50                (no blast hit)

 This cluster: approximate FL confidence score = 85%

 1012155109 Xt7.1-TTpA020d08.5.5 - 18 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA020d08.5.5                          ACAAAGATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTTGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGCCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTACAATCTG
                                                  Xt7.1-CHK-1008267197                                ATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTTGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGCCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTAC
                                                      consensus depths                               4     4     6     6     6     6     7     7     8     8     8     8     8     8     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9    11     9    11     8    11     8    11     8    10     8    10     8    10     8    10     8    11     9    11     9    11     9    11     5     8     7     8     7     9     7     9     7     9     7     9     6     9     6     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     6     9     7     9     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     2     3
  5   1   2       e50                               Xt7.1-TTpA020d08.5                          ACAAAGATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACC
  5   1   2       e50                                 Xt7.1-CAAQ4304.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTTCAGCTTTCTTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCACCAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTTGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGCCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGT
                                                                   SNP                                                                                      ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---A--------
                                               BLH ATG     233     291                          
                                               BLH MIN     233      33                          
                                               BLH MPR     203      33                          
                                               BLH OVR     233      15                          
                                               CDS MIN     233      33                          
                                               EST CLI     -12      13                          
                                               ORF LNG     233       1                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dr ==== 2e-007     NP_001002702.1 zgc:92620 [Danio rerio] ===========================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 4e-021     NP_723546.1 CG18619-PB [Drosophila melanogaster] ==================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PREDICTED = Mm ==== 8e-047     NP_808355.1 hypothetical protein B230205M03 [Mus musculus] ================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 1e-047     NP_001301.1 cAMP responsive element binding protein-like 2 [Homo sapiens] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PREDICTED = Gg ==== 4e-048     XP_424137.2 PREDICTED: similar to Cre binding protein-like 2 isoform 2 [Gallus gallus] ============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 2e-062     AAI35140.1 Unknown (protein for MGC:121129) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         
                                                  Xt7.1-TTpA020d08.5.5                                                          TGA------------------TAGTGA---------------------------------------------------------------------------------------TAAATG---------------------------------------------------------------TAA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------TGA------------TGA------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------TAA------------------------------------TAA------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------TAA------------------------------------------TAG---------TAG
                                                                   ORF                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Tad5 FL                           XZT7015.FL-MGC GCTTGTACAAGCGGAGCTATTGTAAACAAAGATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCTAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTAGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGGCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTACAATCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       e50                               Xt7.1-TTpA020d08.5                          ACAAAGATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACC
                                                  Xt7.1-CHK-1008235236                                ATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAG
  5   1   2   14  bld Te5  5g3  in                        CAAO12257.5p .............GAGCTATTGTAAACAAAGATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGNGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGGAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTC
  5   1   2       bld Tad5 FL   in                          XZT7015.5p              GGAGCTATTGTAACAAAGATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCTAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTC
  5   1   2   10  bld Te1  5g3  in                        CBWN14149.b1 .....................GTAAACAAAGATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTTGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCATTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAATGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGCTCTGACTTCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGG
  5   1   2      seed TpA  5g                        TTpA020d08.p1kSP6                        TAACAAAGATGGGTTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTAGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGAT
  5   1   2   14  bld Brn4 5g3  in                        CAAL22691.5p ....................................TTTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTAGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCAACAAAATCCTACTGAGCGCAGCTTCTTTCATGCAAC
  5   1   2   10  bld Fat1 5g3  out                       CABC10853.5p .....................................TTCCCTTAGCAGGCCAGGTTTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTCGCTGGGATCTAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGG
  3  -1   2       bld Int1 PIPE in                        CAAP13485.3p                                                         TTGAACTGGTAACCAGCAGCTTTAGTGAGATCAGGCGTAGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCCATGCACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCTAAACC
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ4304.5p ...................................................................ACCAGCAGCTTTAGTGAGATCAGGCGTAGCTGGGATCGAGTGTCTGGTCGGGCGAGCCTGTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAA
  5   1   2       bld In63 5x3                        IMAGE:8960607.5p                                                                                                              GTGCCGGGCGAAGCCTGTTGGGTGGGGAGTCGGTGCGTCTGTATGGTGTATGTAATCCAAATTAAATGAGCGCTGTGTATCCCAGCCTGTATATCTCTGCCAGTAGTATAACTCATTCTGTTGGACAGTATTAACTTCTTCATCTCCAGATGGATGACAGCAAGGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACTCTGCCTTTTTTGTGGGAAAACACGATCACGAGGCGACACCTGTGCGAAGCGCGGATCACTTCAGCTTTCTTTTTTCCACAAATCTACTGACGCAGCTCTCATGCACAGGAAGGAGATTCGTAGCATGCAGACTCGACAACTGTTGATGAAATCACGAAGATAGCATCCAGGTGCTGCATACGTCCGTACGATCGTGATCTCTTGGATCAATGCGCCTCCG
  5   1   2       bld Te5       in                         CAAO5315.5p                                                                                                                                                                                                                                                                  AAGAAGGCGTGGCCGCGTATCTGGCGGGAAGGTGAAGAAACCTGGCAAGAGAGGGAGGAAACCCGCCAAGATCGATCTGAAGGCAAAGCTAGAGCGCAGCAGGCAGAGCGCCCGCGAGTGCAGAGCCAGGAAGAAGCTCCGTTACCAGTACCTGGAAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCAGTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAAGGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGTTCTGACTTCCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCCTAGCACCCAGTGGACATTAGACATAGAC
  3   1   2       bld Te1  5g3  in                        CBWN14149.g1                                                                                                                                                                                                                                                                                                                                                                                                                             AAGAGCTGGTGTCCAGCCGCGAGCGAGCCATATGCGCCCTGAGGGAGGAGCTGGAAATGTACAAACAGTGGTGCGCTGCAATGGACCAAGGGAAAATTCCATCTGAGATCAAAGCCCTACTCATTGGGGAAGATTTAAAGGCTGCACCGAACCAAGTGAAACACAGGGCAGTTAAGACAGAGCAGAATGAAAAGTGTCCCTGAACATCTCCTGCCTGAGTCTATTTACCGACTGACTACCTGTCTCTCAGAGAGACGGATGGGCTCTGACTTCCGGGGTCTCCGCACTTCTACTACCTCTGCCTTTTTTGTGGGAAAACACCGATCACGAGGGCGACACCTGGTGGCGAAGCGGCGGAATCACTTCAGCTTTTCTTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGAAGAGAATTCACAGAGGGGTTGCCTCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTAGATGGCTGGGATCCATATCGTCGTCCTCCCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGTAAAGGGAAAGTTAACTATCAAAAAAAAAAAAAAA
  5   1   2       e50                                 Xt7.1-CAAQ4304.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTTCAGCTTTCTTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCACCAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTTGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGCCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGT
                                                  Xt7.1-CHK-1008239395                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCTTTCTTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTTGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGCCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTACAATC
  3   1   2       bld Hrt1 5g3  in                         CAAQ4304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCACTTCAGCTTTCTTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCAACAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTTGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGCCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTACAATCTGAAAAAAA
  3   1   2       bld Brn4 5g3  in                        CAAL22691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCACTTCAGCTTTTCTTTTTTCCCAACAAAATCTNACTGAGCGCAGCTTCTTCCATGCACAAGGGGAAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTTGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGCCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTAC
  5  -1   2       bld Int1 PIPE in                        CAAP13485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTTCAGCTTTTCTTTTTTTCCCAACAAAATCCTACTGAGCGCAGCTTCTTCCATGCACAAAGGGGAAAGGAGATTTCGGTAGCATGGCAAGGACTCGACAACCCTGTTNTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTTGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGCCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTACAAAAAAAAAACCTCGGCCGAATTGAA
  3   1   2       bld Te5  5g3  in                        CAAO12257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGCATGGCAAGGACTCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGAAATCGCAATAGACCAACTGCGTTTTGTCTAAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTAGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGGCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTACAATCTG
  3   1   2      seed Tad5 FL   in                          XZT7015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCGACAACCCTGTTTTGATGAAAATCCAAACCGGAGAGGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTAGGTATTTGTATATCCAGGGCAGAATTGTGAGTTGGCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGT
  3   1   2       bld Brn4      out                        CAAL9673.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCCAAACCGGAGAAGAGTAGAGCATTCGCAGAGGGGTTGCCCCGTGACATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCAGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGCCCAACCTGCGTTTTGTCTTAAACGTCTGCACCTATAACAGCACGTGCACTTCCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGCGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTCGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCACCATCTCGCTATATTTAACCCTTCATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTT
  3   1   2       bld Te5       in                         CAAO5315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCAGAGGGGTTGCCCCGTGGCATTACTGTCAGCGTTAGCAGATCCAGTTTTGGAATCCTCCTGTGGGATCCATATCGCCGTCCTCTCTTCCTGTGACCTTTCATCCCTAGCAACCCAGTGGACATTAGACATAGACCAAGGGGATGTCCCGACTGTCTTCCATTTGGCAAAGGGAAAGTTAACTATCAACCACCGTTTTCTGCTGTCACTTTGTTCAAATACGGAGCTGGAATCGCAATAGACCAACTGCGTTTTGTCTTAAACGTCTGCACCTATAATAGCACGTGTACTTTCCCGCTAATCCGTGTGCCATGGGAGGCTGGAAACCCAGTTGGGCAGTGGTAGTTTCATGAAAATGAGTCTAGGAGCCCTTTCCTTGGGCGCCCAATTGGGCAAAAGGTATAAAATAGTTCAGTTTTTGCCTCTTGCTGAGGCATTAGGCTCCTCAGGGTAAGGCCAAACCCCCATCTTGCTATATTTAACCCTTTATGTGCCCTAGACTGTAGAATAGATCCTTCACTTTTAGGTATTTGTATATCCAGGGCAGAATTGTGAGTGGGCGTCCTACTCACCGGCACTCAAAGCGTTAACCCACTGCTCATTTACTGATTCGTTGCCTGTATTCATTTATCCCATAACGCTAATATTTGTAGCTGAATGTAGTGAAATATACTTTCCTGTCCATTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)