Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 95%

 1012155122 Xt7.1-CAAR9362.3.5 - 23 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     7     8     6     7     5     7     5     7     5     6     5     6     5     6     5     6     4     4     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     6     6     6     6     7     7     7     7     7     7     8     8     9     9     9     9    10    10    10    10    10    10    11    11     8    11    11    11    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7     7     6     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                               BLH ATG      21    1367                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      21     228                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      10       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Br ---- 1e-019     AAQ96651.1 elastase I [Branchiostoma belcheri tsingtaunese] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Ci ---- 2e-029     CAD24306.1 putative coagulation serine protease [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 6e-029     NP_510672.2 Astacin  and CUB domain and EGF-like domain containing protein family member(107.5 kD) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 2e-031     NP_524362.2 CG4920-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 1e-039     XP_001187211.1 PREDICTED: similar to LOC494753 protein, partial [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bb ---- 5e-119     BAC75887.1 mannose-binding lectin associated serine protease-3 [Branchiostoma belcheri] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 6e-139     XP_688766.1 PREDICTED: similar to mannan-binding lectin-associated serine protease precursor [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 0          NP_001025948.1 complement component 1, s subcomponent [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 0          NP_659187.1 complement component 1, s subcomponent [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 0          NP_001725.1 complement component 1, s subcomponent [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 0          AAI25975.1 Unknown (protein for MGC:154184) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 0          NP_001089125.1 hypothetical protein LOC733422 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 0          AAH96508.1 LOC613055 protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAR9362.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------ATG---------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------ATG---------------TGA---------------------------------------------------------------------------------------------TAA------------------------------------------------------------TAA------------ATG------------------------------------------------TAA---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   4   10 seed Liv1 5g3  in                         CAAR9362.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCAGTCTCCTCTCTCAACAGGATCTCCTGTGCTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTG
  5   1   3        nb Abd0 5g                            IMAGE:7018022                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGTGCTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGGATATGGAGATGGGAGCTGCT
  5   1   3        nb AbdN 5g                            IMAGE:7003760                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCCAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTTGGGCCTTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTTGAGACAGGCAGGCAATGAGGCCCGACATTTATATTTCAAACTGGACAGCCGGCGG
  5   1   3        nb AbdN FLt5                          IMAGE:7003602                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGGAGATACAGGCTGGGAGGTTCGCTACTATGGGGGATGCCATACAGTGCCCCCGTGCAGGTCATCTCAAACTCTATTTCTGGATCCTCCAGCAAGAGAAATATGTCC
  5   1   2       ext Ovi1      in                         CABI7622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGA
  5   1   2       ext Fat1      in                          CABC508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCT
  5   1   2       ext Brn3      ?                          CAAK4558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGGCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCTGCCAAGGAGACGGGACCTGGAAGAATATGCACTTCCAGTGCCAACTGGTGAATTGTGGGGAACCTGATCCTATTGACAATGGTAATGTCTTCTCCAGCACTACCACTTATGGCTCAGAAATCACATACAACTGCTCAGATGAATACTACGCCCTAACTCTGCCTGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCATGGATGATCCAGTTCACTGACAT
  5   1   2       ext Bone      in                        CBTC2224.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTCGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATTTGGCTGGCATTGTGTCCTGNGGCCCACGGGACTGTGGAACCTATGGCCTTTAC
  3   1   4      seed Liv1 5g3  in                         CAAR9362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCACTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  5  -1   3        nb Ovi1      out                        CABI8584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCACTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATACAAAAAAAAAA
  3   1   2       ext Ovi1      in                         CABI7622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCACTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATAT
  3   1   2       ext Bone      in                        CBTC2224.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATTTGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATGGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATCCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  5   1   3        nb Bone      in                        CBTC7584.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATTTGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATGGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCANACTCATCATGGAGCATCACAGTACCCATCATCCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTA
  3   1   3        nb Bone      in                        CBTC7584.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATTTGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATGGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATCCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  3   1   2       ext Fat1      in                          CABC508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAATAGTTTTCCTGTTTCTTTCTTTCCTAGACAGCTCCTATAAACTGACCCATGTCTAAGCTGCCAGTGTCTGTGAGGCTTTCTGGCCACAGCCTTCCTTTTTACCCCCCATAGTCCTTCTATTATGTTACAATAGAAAGGGGCTAGAAATGGTTTGCTCCAAAGTAGGTATATGTAAAATTGTAATGTCCTTTTAATACATTTCAGCAAAATGTCCC
  5   1   4      seed Abd0      in                       IMAGE:6999281                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTTACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGCCCCCAAATCCTTCAGTCATTGAGACAGGCAGC
  5   1   2       ext Liv1      in                         CAAR5176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGC
  5   1   2       ext Fat1      in                         CABC7695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGG
  3   1   2       ext Fat1      in                         CABC7695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  3   1   4      seed Abd0      in                       IMAGE:6999281                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGATAATGAAGATACTGAAGGCCAAAGTAACTTGAACAACGACATGNCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCCCTCTAAAGGCATTCATTCATTCGTTTAAAGGCCAGACTTGTGCCCATGTTATGTTATATACACATTGTATTCCCAC
  3   1   2       ext Liv1      in                         CAAR5176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  5   1   2       ext Thy1      in                       CBST11977.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTTGA
  3   1   2       ext Thy1      in                       CBST11977.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAATAGTTTTCCTGTTTCTTTCTTTCCTAGACAGCTCCTATAAACTGACCCATGTCT

In case of problems mail me! (