Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012155122 Xt7.1-CAAR9362.3.5 - 23 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAR9362.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGTGCTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCTGCCAAGGAGACGGGACCTGGAAGAATATGCACTTCCAGTGCCAACTGGTGAATTGTGGGGAACCTGATCCTATTGACAATGGTAATGTCTTCTCCAGCACTACCACTTATGGCTCAGAAATCACATACAACTGCTCAGATGAATACTACGCCCTAACTCTGCCTGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATA
                                                  Xt7.1-CHK-1008266924                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCTGCCAAGGAGACGGGACCTGGAAGAATATGCACTTCCAGTGCCAACTGGTGAATTGTGGGGAACCTGATCCTATTGACAATGGTAATGTCTTCTCCAGCACTACCACTTATGGCTCAGAAATCACATACAACTGCTCAGATGAATACTACGCCCTAACTCTGCCTGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     7     8     6     7     5     7     5     7     5     6     5     6     5     6     5     6     4     4     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     6     6     6     6     7     7     7     7     7     7     8     8     9     9     9     9    10    10    10    10    10    10    11    11     8    11    11    11    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7     7     6     7
  5   1   2  SIG                                      Xt7.1-CAAR9362.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGTGCTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCTGCCAAGGAGACGGGACCTGGAAGAATATGCACTTCCAGTGCCAACTGGTGAATTGTGGGGAACCTGATCCTATTGACAATGGTAATGTCTTCTCCAGCACTACCACTTATGGCTCAGAAATCACATACAACTGCTCAGATGAATACTACGCCCTAACTCTGCCTGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATA
  5   1   2  SIG                                      Xt7.1-CABC7695.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAATAGTTTTCCTGTTTCTTTCTTTCCTAGACAGCTCCTATAAACTGACCCAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------C--
                                               BLH ATG      21    1367                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      21     228                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      10       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Br ---- 1e-019     AAQ96651.1 elastase I [Branchiostoma belcheri tsingtaunese] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Ci ---- 2e-029     CAD24306.1 putative coagulation serine protease [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 6e-029     NP_510672.2 Astacin  and CUB domain and EGF-like domain containing protein family member(107.5 kD) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 2e-031     NP_524362.2 CG4920-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 1e-039     XP_001187211.1 PREDICTED: similar to LOC494753 protein, partial [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bb ---- 5e-119     BAC75887.1 mannose-binding lectin associated serine protease-3 [Branchiostoma belcheri] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 6e-139     XP_688766.1 PREDICTED: similar to mannan-binding lectin-associated serine protease precursor [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 0          NP_001025948.1 complement component 1, s subcomponent [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 0          NP_659187.1 complement component 1, s subcomponent [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 0          NP_001725.1 complement component 1, s subcomponent [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 0          AAI25975.1 Unknown (protein for MGC:154184) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = ?? ==== 0          NP_001089125.1 hypothetical protein LOC733422 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 0          AAH96508.1 LOC613055 protein [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAR9362.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------ATG---------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------ATG---------------TGA---------------------------------------------------------------------------------------------TAA------------------------------------------------------------TAA------------ATG------------------------------------------------TAA---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2  SIG                                      Xt7.1-CAAR9362.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGTGCTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCTGCCAAGGAGACGGGACCTGGAAGAATATGCACTTCCAGTGCCAACTGGTGAATTGTGGGGAACCTGATCCTATTGACAATGGTAATGTCTTCTCCAGCACTACCACTTATGGCTCAGAAATCACATACAACTGCTCAGATGAATACTACGCCCTAACTCTGCCTGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATA
                                                  Xt7.1-CHK-1008295966                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCTGCCAAGGAGACGGGACCTGGAAGAATATGCACTTCCAGTGCCAACTGGTGAATTGTGGGGAACCTGATCCTATTGACAATGGTAATGTCTTCTCCAGCACTACCACTTATGGCTCAGAAATCACATACAACTGCTCAGATGAATACTACGCCCTAACTCTGCCTGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAAT
  0   1   1           AbdN FLt5                   IMAGE:7003602.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCTGCCAAGGAGACGGGACCTGGAAGAATATGCACTTCCAGTGCCAACTGGTGAATTGTGGGGAACCTGATCCTATTGACAATGGTAATGTCTTCTCCAGCACTACCACTTATGGCTCAGAAATCACATACAACTGCTCAGATGAATACTACGCCCTAACTCTGCCTGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAATAGTTTTCCTGTTTCTTTCTTTCCTAGACAGCTCCTATAAACTGACCCATGTCTAAGCAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   4   10 seed Liv1 5g3  in                         CAAR9362.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCAGTCTCCTCTCTCAACAGGATCTCCTGTGCTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTG
  5   1   3        nb Abd0 5g                            IMAGE:7018022                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTGTGCTGAGATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGGATATGGAGATGGGAGCTGCT
  5   1   3        nb AbdN 5g                            IMAGE:7003760                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATACAGAGTGATGGACCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCCAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTTGGGCCTTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTTGAGACAGGCAGGCAATGAGGCCCGACATTTATATTTCAAACTGGACAGCCGGCGG
  5   1   3        nb AbdN FLt5                          IMAGE:7003602                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGGAGATACAGGCTGGGAGGTTCGCTACTATGGGGGATGCCATACAGTGCCCCCGTGCAGGTCATCTCAAACTCTATTTCTGGATCCTCCAGCAAGAGAAATATGTCC
  5   1   2       ext Ovi1      in                         CABI7622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGA
  5   1   2       ext Fat1      in                          CABC508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTTGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACGTTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCT
  5   1   2       ext Brn3      ?                          CAAK4558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGGCGACATTATATTTCAAACTGACAGCGGCGGGGAGAATACAGGCTGGAAGGTTCGCTACTATGGGGATGCCATACAGTGCCCCGTGCAGGTCATCTCAAACTCTATTCTGGATCCTCAGCAAGAGAAATATGTCTTCAGGGATGTGGTGAACGTGACATGCGTGGAGGGTTATGAGATTGTGAAGGACCAGAAAACTCTTAGATCTTTTATATCCACCTGCCAAGGAGACGGGACCTGGAAGAATATGCACTTCCAGTGCCAACTGGTGAATTGTGGGGAACCTGATCCTATTGACAATGGTAATGTCTTCTCCAGCACTACCACTTATGGCTCAGAAATCACATACAACTGCTCAGATGAATACTACGCCCTAACTCTGCCTGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCATGGATGATCCAGTTCACTGACAT
  5   1   2       ext Bone      in                        CBTC2224.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTCGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATTTGGCTGGCATTGTGTCCTGNGGCCCACGGGACTGTGGAACCTATGGCCTTTAC
  3   1   4      seed Liv1 5g3  in                         CAAR9362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCACTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  5  -1   3        nb Ovi1      out                        CABI8584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCACTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATACAAAAAAAAAA
  3   1   2       ext Ovi1      in                         CABI7622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCACTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATAT
  3   1   2       ext Bone      in                        CBTC2224.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATTTGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATGGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATCCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  5   1   3        nb Bone      in                        CBTC7584.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATTTGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATGGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCANACTCATCATGGAGCATCACAGTACCCATCATCCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTA
  3   1   3        nb Bone      in                        CBTC7584.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATAGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATTTGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATGGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATCCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  3   1   2       ext Fat1      in                          CABC508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACATTGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCTTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAATAGTTTTCCTGTTTCTTTCTTTCCTAGACAGCTCCTATAAACTGACCCATGTCTAAGCTGCCAGTGTCTGTGAGGCTTTCTGGCCACAGCCTTCCTTTTTACCCCCCATAGTCCTTCTATTATGTTACAATAGAAAGGGGCTAGAAATGGTTTGCTCCAAAGTAGGTATATGTAAAATTGTAATGTCCTTTTAATACATTTCAGCAAAATGTCCC
  5   1   2  SIG                                      Xt7.1-CABC7695.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAATAGTTTTCCTGTTTCTTTCTTTCCTAGACAGCTCCTATAAACTGACCCAT
                                                  Xt7.1-CHK-1008295962                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAATAGTTTTCCTGTTTCTTTCTTTCCTAGACAGCTCCTATAAACTG
  5   1   4      seed Abd0      in                       IMAGE:6999281                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGAGTTGGTTTCTGATCCTACTCCTCTTGGGATGTGTCCATTCATCCTTCCCCTCCATGTATGGGGAAATCACATCCCCTAATTACCCCCAAGGATATCCCAACAATGTTGAGGAGACATGGGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTTACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGCCCCCAAATCCTTCAGTCATTGAGACAGGCAGC
  5   1   2       ext Liv1      in                         CAAR5176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGATCTCAGTGCCAGAGGGGTTTGGAATCCATCTTTACTTCATTCACCTGGACATTGAGCCTTCTGAGAACTGTGAATATGATAATGTGCAGGTGATGGTTGGAGATATAGTGGAAAAAAAGCTGTGTGGACGTCAGTCTGGGAGGTCCCATAGAAGACCCCTAGAAGAAAAATATTTCTACTCCAACTATTTGAAGCTCCTGTTCAAATCTGACTTCTCCAACCAGCAACGATATACTGGATTTGCAGCTTACTACAGAGCTGTGGATATCAACGAGTGCCAGGAAAGCACAGAAACTGTCTGCTCTCATTTCTGCAACAATTACATTGGAGGCTATTTCTGCTCCTGCCCTCCAGAATATTTCCTTCACCCAGATAACCACACTTGTGGGGTGAATTGCAGTGGGGGACTGTTTACGGACATACAGGGGATGATCAGCAGCCCTGGATTCCCGTCCCCATACCCTGAGAATACCCGCTGTGAATACAAAGTGCAATTGGAACATGGGTTTGAGGTCGTCATCCATTTCCAAGAAGACTTTGATGTTGAGGAATATGGAGATGGGAGCTGCTCTGACTCGCTAACTATAAAAGCTGGGACACGCACATTTGGGCCTTTTTGTGGTAAAAGTCCCCCAAATCCTTCAGTCATTGAGACAGGCAGCAATGAGGCCGACATTATATTTCAAACTGACAGCGGC
  5   1   2       ext Fat1      in                         CABC7695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCGGTGAAGATGGAACCTACAGCTGCTCATCATATGGATATTGGGTCAATAGTAGAGGAAATAAGGAACTTCCTATATGTACCCCAGTTTGTGGGGTCCATCAGTCTGACAAAAGTGGCCGGATATTTGGTGGCACTAGAGCTAAACCTGGGCAGTTTCCATGGATGATCCAGTTCACTGACATAGAATTAGGTGGTGGTTCCCTAATATCTGATCGGTGGGTCCTGACAGCTGCTCATGTGGTGAATAAGAAAATCTTCCCAACGATGTTTGGGGGTGTGATGAAGTTTTTCCCGAACACTAATTTACAATCCCAGGAGAAAAGACTGCAGGCCAAGAAAATTATTATTCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGG
  3   1   2       ext Fat1      in                         CABC7695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATCCTCTTTATCAGGATAATGAAGATACTGAAGGCCAAAGTAACTTTGACAACGACATTGCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  3   1   4      seed Abd0      in                       IMAGE:6999281                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGATAATGAAGATACTGAAGGCCAAAGTAACTTGAACAACGACATGNCTCTGGTCCAACTGACTAAGAAAGTCAAACTGGGCTCATGTATCTCTCCCATTTGTCTTCCAAGGAGGGGACTTGCCCCCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCCCTCTAAAGGCATTCATTCATTCGTTTAAAGGCCAGACTTGTGCCCATGTTATGTTATATACACATTGTATTCCCAC
  3   1   2       ext Liv1      in                         CAAR5176.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGTCGTTAATGAGGTTGCCATTATCGCAGGATGGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATAT
  5   1   2       ext Thy1      in                       CBST11977.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTTGA
  3   1   2       ext Thy1      in                       CBST11977.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGTAAAACTGAAAAGAGAGAATCTGCAGTTAATTTGCAGTTTGCGAGTATTTCTCTCAGCTCCATGGATAAATGTAAGAAGGCGACTGGTGGAAAGGGTTATTTCACTCCAAACATGCTGTGTGCAGGATCTGATGTAGGGAAGGACAGTTGCAATGGTGATAGTGGGGGTCCACTCATGTTCACTGACCCACAGGACAGCAGCAAAATGTATATGGCTGGCATTGTGTCCTGGGGCCCACGGGACTGTGGAACCTATGGCCTTTACACCAAGGTGGATAATTACCTTGACTGGATTGAGGAGACAATAGCAGCGGTGGAGAGGGAAGAGCAGGAGGAGGTGGAGACACAGGTGGTGTGTGAGTGAGTGTTGCTCTCCAGAGAGACAGTCATGACGTCACGTCGGAGCCAGACTGCACCTTGTATACTACAGATATCTCCTTATACCCCAGAGAATACTTCCTGTTGAACTGAAGCAACAGAATGGATAATTAAAGCAAATACAGTTCTTCTGTGCTCAGATACATTGGGAATCGCACTATATACGCCTATAACGCAAACTCATCATGGAGCATCACAGTACCCATCATTCTGTAACTTCATTTCATTCATTCGTTTAAAGGCCAACTTGTGCCATGTTATGTTATATACAATTGTATTTCATATATAATAGTTTTCCTGTTTCTTTCTTTCCTAGACAGCTCCTATAAACTGACCCATGTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)