Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 05 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAK9414.3                           12 END     2           6       16                (no blast hit)
     2   2.0    0Xt7.1-CAAJ15807.5                           4 END     3          10      100                PREDICTED: similar to neurexin I-alpha protein [Gallus gallus]

 This cluster: approximate FL confidence score = 97%

 1012155141 Xt7.1-CBTC435.5.5 - 30 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CBTC435.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTTTTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGCTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTTCGGCGCCCATCGCGATCTACAGGTCTCCGGCTTCACTCAGAGGAGGAAACGCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGGGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAATAGTGCTAAAAGTGCTAAAAGCTCCAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAAAAAAAATTAAAAGGAGACAGGGGATGAAATCGGAAGAGCGAGACTGTTTTAAAAAAAAAACAAAGAAAAAACAAAGATACCATGGTCTAGGTTGCCAGAAACAGGAGCCAAAACAAGAATCCCGAATATCCACAGTGTTTTCATTTATTCTGCCTGTCATTGAAATGTCGCAGGAATGCTTTGGAAAGACAGTTGCGGCTCCAAATATTCTATGAATTTGGAGCCAATTCCAGCATTAAGGCACAATTTTAGAAAACGAAAGAAAAAGCTACCTATGATTCTGGATTCAGCCAAAGTGCTAGTGCTTTTTTCCAAACGTAAGTTCATTCTGGTGCCAGCGAAGAATCGTCTGAACCTGCCAACGTCAGTGGTTTGCTGTACTGTGCAATGAAACAATGATATGTATTCAGTAAAAAAAACATGCTCGGAAGACTTAAATACTTTCACGAAGCCCCTTTCTGGTTGCTAAGGGATGTGTTACGGAGGCCTTATTTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACC
                                                  Xt7.1-CHK-1008267204                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGCTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTTCGGCGCCCATCGCGATCTACAGGTCTCCGGCTTCACTCAGAGGAGGAAACGCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGGGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAxxxxxCTAAAAGxxCTAAxAxxxxCAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAAAAAAAATTAAAAGGAGACAGGGGATGAAATCGGAAGAGCGAGACTGTTTTAAAAAAAAAACAAAGAAAAAACAAAGATACCATGGTCTAGGTTGCCAGAAACAGGAGCCAAAACAAGAATCCCGAATATCCACAGTGTTTTCATTTATTCTGCCTGTCATTGAAATGTCGCAGGAATGCTTTGGAAAGACAGTTGCGGCTCCAAATATTCTATGAATTTGGAGCCAATTCCAGCATTAAGGCACAATTTTAGAAAACGAAAGAAAAAGCTACCTATGATTCTGGATTCAGCCAAAGTGCTAGTGCTTTTTTCCAAACGTAAGTTCATTCTGGTGCCAGCGAAGAATCGTCTGAACCTGCCAACGTCAGTGGTTTGCTGTACTGTGCAATGAAACAATGATATGTATTCAGTAAAAAAAACATGCTCGGAAGACTTAAATACTTTCACGAAGCCCCTTTCTGGTTGCTAAGGGATGTGTTACGGAGGCCTTATTTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAxxxCxTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     4     3     4     4     5     4     6     6     6     6     6     7     7     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     8     8    10    10    12    13    13    13    12    13    12    13    12    13    12    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    15    14    15    14    15     7    15     7    15     8    15     8    15     8    15     8    15     8    15     8    15     8    15     8    15     8    15     8    15     8    15     7    15     7    15     7    15     6    13     6    13     6    13     6    13     6    14     6    13     7     9     5     9     5     9     5     9     5     8     5     8     5     8     5     8     5     8     5     7     4     6     3     4     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     3     6     3     6     3     6     3     6     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     6     4     6     4     6     4     6     3     5     3     5     3     5     3     5     3     5     3     5     2     5
  5   1   2                                           Xt7.1-CAAK6670.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCTCTGGATACATCCTCTGGTATTACGCTTAATAGCCAGAGCACTCACATTGCTTGGGGGGAAGGCTGCTTATTGCTGTGGTTAAGACTTGCTCTGCGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTTTTTTTTTTTTTTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGCTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATATTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAGGAAAAA
  5   1   2                                       Xt7.1-EC2BBA16DC06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGACATCCTCTGGTATTACGCTTAATAGCCAGAGCACTCACATTGCTTGGGGGGAAGGCTGCTTATTGCTGTGGTTAAGACTTGCTCTGCGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTATTTATTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGTTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAACTGCTGCGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCAGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTA
  5   1   2  SIG                                     Xt7.1-CAAK10710.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGGTTAAAGGGTATTTGCATTATGTGTTTGACTTGGGGAATGGTGCAAATCTGATCAAAGGAAGCTCCAACAAGCCTTTAAATGACCATCAGTGGCACAACGTTATGATCTCCAGGGACACGAGTAACCTGCATACTGTCAAAATTGATACAAAAATCACAACCCAAAGTACAGCGGGAGCGAGAAACCTTGACCTGAAAAGCGACCTATATATTGGAGGGGTTTCCAAAGAAATGTACAAAACCTTACCCAAGCTGGTCCATGCCAAGGAAGGATTCCAAGGTTGCCTTGCTTCCGTAGATCTGAATGGACGCCTTCCAGACCTTATCTCAGATGCTCTTTTGTGAAATGGACAAATTGAGAGAGGATGTGAAGGCCCCAGCACAACATGTCAAGAAGATTCCTGCGCAAACCAAGGCGTCTGCTTGCAACAATGGGACGGATTCAGCTGTGATTGTAGCATGACCTCATTCCGTGGACCTCTGTGCAATGACCCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGCGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCACTTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACAT
  5   1   2  SIG                                      Xt7.1-CAAL6519.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTTCGGCGCCCATCGCGATCTACAGGTCTCCGGCTTCACTCAGAGGAGGAAACGCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGGGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAG
  5   1   2  SIG                                      Xt7.1-XZT38012.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATTCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCTTCTCTACGCTATGTACAAATATCGAAACAGGCATGATGCTTCTATCACGTGATGAGAGTCGAACTACTTCAGTACTCAGCGCAGTTCACGGGCTGTGATTAGAAAACATCAGTATGCTAAGGCTCTAACAAACAGAAAACAGGAAAGAATTATGCTGATCAGCACTTAAGACAGTTAGAAATAGTCCTCATTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATATTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTT
  5   1   2  SIG                                       Xt7.1-CBTC435.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAAAAAAAATTAAAAGGAGACAGGGGATGAAATCGGAAGAGCGAGACTGTTTTAAAAAAAAAACAAAGAAAAAACAAAGATACCATGGTCTAGGTTGCCAGAAACAGGAGCCAAAACAAGAATCCCGAATATCCACAGTGTTTTCATTTATTCTGCCTGTCATTGAAATGTCGCAGGAATGCTTTGGAAAGACAGTTGCGGCTCCAAATATTCTATGAATTTGGAGCCAATTCCAGCATTAAGGCACAATTTTAGAAAACGAAAGAAAAAGCTACCTATGATTCTGGATTCAGCCAAAGTGCTAGTGCTTTTTTCCAAACGTAAGTTCATTCTGGTGCCAGCGAAGAATCGTCTGAACCTGCCAACGTCAGTGGTTTGCTGTACTGTGCAATGAAACAATGATATGTATTCAGTAAAAAAAACATGCTCGGAAGACTTAAATACTTTCACGAAGCCCCTTTCTGGTTGCTAAGGGATGTGTTACGGAGGCCTTATTTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCAGTAAAACTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAGGAAAAATGAAAAAAAAAAAAAAGTTAAAAACTCTGCGTTATTTGGTTTATACATTAACCCAACAGTGGTTATTTAAATATACCTCTGTTAGTCCATGGAGGTCCTCTGGTAGAACCAGGGGTTTCACATATTTTAGATAGGGTGAAAGTAAAACGCCCAAAATAAATAAAATGAATTTTAACAAAGAACAAAACAAAATAAAAATTCAAATGGTATTTTCCTAAAGTTTATGGTTATTATTATTAAATCACAATTGATAGATTTTGTTCCTCATTACAACAGCCCCTGCCTTTGTGAAGTTTAAAGTCCCTCCCACATTCTCACAACATGGGATACCCTGGAGTCATTTCATTAGAAGTCAGTAAACCACCAGTATGTTTTTGGAGTCTAAGGGGAAACCAGAGTACCTGAAGGAAAACCATATAGACACGGGAAGAGCGTACAAACTCCTTGTAGACAGTTCCCAGGTCAAAATACTACTGTTCCTGCCTTTGTGAAGTTTTAAGTCCCCCCCACATTCTCACAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAACCCAGTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTAACAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAATACCCTTTTTCAGCCTTCCT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A--------A
                                               BLH MIN     451     112                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     436     108                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     436      63                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ce ---- 3e-014     NP_505767.1 neurexin I (5L325) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 4e-027     XP_786974.1 PREDICTED: similar to neurexin 2 isoform alpha-2 precursor [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-029     NP_524449.1 CG7050-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - ?? ---- 3e-073     XP_686621.1 PREDICTED: similar to neurexin 2 isoform alpha-1 precursor, partial [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ==== 3e-158     XP_693903.1 PREDICTED: similar to Neurexin 1-beta precursor (Neurexin I-beta) [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 4e-174     XP_419373.2 PREDICTED: similar to neurexin I-alpha protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_064648.2 neurexin I [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 0          NP_620072.1 neurexin 1 isoform beta precursor; neurexin I [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CBTC435.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA------------------------------TAG------------------------TGA------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------ATG---------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------ATG------------------------TGA---------------------------------------------------------------------------TGA------------------------------------------------------ATG---TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TAA------------------------------------------------------------------ATG------TGA---------------------ATG---------------------------------------------------------------------------------------TAA---------------TAA------------------------------------------------ATG---------ATG------TAA---------------------TGA---------------------TAG---------TAG---ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------TAA---------TAA------------ATG------------TAA------------------------------------------------ATG------------------------------------------------ATG---------------TGA---------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2                                           Xt7.1-CAAK6670.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCTCTGGATACATCCTCTGGTATTACGCTTAATAGCCAGAGCACTCACATTGCTTGGGGGGAAGGCTGCTTATTGCTGTGGTTAAGACTTGCTCTGCGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTTTTTTTTTTTTTTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGCTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATATTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAGGAAAAA
                                                  Xt7.1-CHK-1008293914                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATACATCCTCTGGTATTACGCTTAATAGCCAGAGCACTCACATTGCTTGGGGGGAAGGCTGCTTATTGCTGTGGTTAAGACTTGCTCTGCGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTTTTTTTTTTTTTTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGCTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATATTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAG
  5   1   4      seed Brn3      in                         CAAK6670.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCTCTGGATACATCCTCTGGTATTACGCTTAATAGCCAGAGCACTCACATTGCTTGGGGGGAAGGCTGCTTATTGCTGTGGTTAAGACTTGCTCTGCGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTTTTTTTTTTTTTTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGCTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTTC
  3   1   4      seed Brn3      in                         CAAK6670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATATTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAGGAAAAATG
  5   1   2                                       Xt7.1-EC2BBA16DC06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGACATCCTCTGGTATTACGCTTAATAGCCAGAGCACTCACATTGCTTGGGGGGAAGGCTGCTTATTGCTGTGGTTAAGACTTGCTCTGCGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTATTTATTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGTTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAACTGCTGCGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCAGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTA
                                                  Xt7.1-CHK-1008293912                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTCTGGTATTACGCTTAATAGCCAGAGCACTCACATTGCTTGGGGGGAAGGCTGCTTATTGCTGTGGTTAAGACTTGCTCTGCGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTATTTATTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGTTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAACTGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCAGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTACAAAGG
  5   1   4      seed BrSp      in                     EC2BBA16DC06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGACATCCTCTGGTATTACGCTTAATAGCCAGAGCACTCACATTGCTTGGGGGGAAGGCTGCTTATTGCTGTGGTTAAGACTTGCTCTGCGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTATTTATTTTTTTTATCGTTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAGAGACGTTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAACTGCTGCGCCGGGCG
  3   1   4      seed BrSp      in                     EC2BBA16DC06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCAGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTACAAAGG
  5   1   2  SIG                                     Xt7.1-CAAK10710.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGGTTAAAGGGTATTTGCATTATGTGTTTGACTTGGGGAATGGTGCAAATCTGATCAAAGGAAGCTCCAACAAGCCTTTAAATGACCATCAGTGGCACAACGTTATGATCTCCAGGGACACGAGTAACCTGCATACTGTCAAAATTGATACAAAAATCACAACCCAAAGTACAGCGGGAGCGAGAAACCTTGACCTGAAAAGCGACCTATATATTGGAGGGGTTTCCAAAGAAATGTACAAAACCTTACCCAAGCTGGTCCATGCCAAGGAAGGATTCCAAGGTTGCCTTGCTTCCGTAGATCTGAATGGACGCCTTCCAGACCTTATCTCAGATGCTCTTTTGTGAAATGGACAAATTGAGAGAGGATGTGAAGGCCCCAGCACAACATGTCAAGAAGATTCCTGCGCAAACCAAGGCGTCTGCTTGCAACAATGGGACGGATTCAGCTGTGATTGTAGCATGACCTCATTCCGTGGACCTCTGTGCAATGACCCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGCGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCACTTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACAT
                                                  Xt7.1-CHK-1008293918                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAAAGGGTATTTGCATTATGTGTTTGACTTGGGGAATGGTGCAAATCTGATCAAAGGAAGCTCCAACAAGCCTTTAAATGACCATCAGTGGCACAACGTTATGATCTCCAGGGACACGAGTAACCTGCATACTGTCAAAATTGATACAAAAATCACAACCCAAAGTACAGCGGGAGCGAGAAACCTTGACCTGAAAAGCGACCTATATATTGGAGGGGTTTCCAAAGAAATGTACAAAACCTTACCCAAGCTGGTCCATGCCAAGGAAGGATTCCAAGGTTGCCTTGCTTCCGTAGATCTGAATGGACGCCTTCCAGACCTTATCTCAGATGCTCTTTTGTGAAATGGACAAATTGAGAGAGGATGTGAAGGCCCCAGCACAACATGTCAAGAAGATTCCTGCGCAAACCAAGGCGTCTGCTTGCAACAATGGGACGGATTCAGCTGTGATTGTAGCATGACCTCATTCCGTGGACCTCTGTGCAATGACCCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGCGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCACTTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAA
  5   1   4      seed Brn4      in                        CAAL19921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGGTTAAAGGGTATTTGCATTATGTGTTTGACTTGGGGAATGGTGCAAATCTGATCAAAGGAAGCTCCAACAAGCCTTTAAATGACCATCAGTGGCACAACGTTATGATCTCCAGGGACACGAGTAACCTGCATACTGTCAAAATTGATACAAAAATCACAACCCAAAGTACAGCGGGAGCGAGAAACCTTGACCTGAAAAGCGACCTATATATTGGAGGGGTTTCCAAAGAAATGTACAAAACCTTACCCAAGCTGGTCCATGCCAAGGAAGGATTCCAAGGTTGCCTTGCTTCCGTAGATCTGAATGGACGCCTTCCAGACCTTATCTCAGATGCTCTTTTGTGAAATGGACAAATTGAGAGAGGATGTGAAGGCCCCAGCACAACATGTCAAGAAGATTCCTGCGCAAACCAAGGCGTCTGCTTGCAACAATGGGACGGATTCAGCTGTGATTGTAGCATGACCTCATTCCGTGGACCTCTGTGCAATGACCCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGCGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCACTTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAG
  3   1   2       ext Brn3 FLt3 out                       CAAK10710.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAAC
  3   1   3        nb Brn2      out                       CAAJ15807.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAAC
  3   1   2       ext Brn2      out                       CAAJ17915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAAGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATG
  3   1   3        nb Brn3      out                         CAAK651.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAAC
  3   1   4      seed Brn4      in                        CAAL19921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAAC
  3   1   0       chi BrSp      in                      EC2BBA9CB11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGCTCTTCTGTCACCAGTATTGATTTCAGAGGATGGACTAAAATTTCCTAGGATTTCCATTAAGAATTAAGAAAAAAAACCCTTTAAGCACGCAGGGTAGCCAGGCAGACATGGATATGAGATGGCACTGTGAATCCTCCCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCAGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGAC
  5   1   2       add BrSp      in                      EC2BBA9CB11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGAACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAAATGGAATTCCTGGCCCATCAGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAAGGCTCCTATCACGTGGATGAAAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAL6519.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTTCGGCGCCCATCGCGATCTACAGGTCTCCGGCTTCACTCAGAGGAGGAAACGCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGGGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAG
                                                  Xt7.1-CHK-1008293920                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTTCGGCGCCCATCGCGATCTACAGGTCTCCGGCTTCACTCAGAGGAGGAAACGCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGGGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATT
  5   1   2   17  ext Brn4 5g3  in                        CAAL20915.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGTAGAGCCACTACATGTTCCATCCAGGAGAGCGCATCAATTTTTATTTCTCAGCAAAGCTTTAGGAAGTGGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATCGGTCTCAGTATTTTCTCTGGATATCCTGTGGATTATTACGGCTGGGTTTCATCTAGAGGAAATCCCTTTTCTGCTGGTAGTTTGGCAAACTATGGATCCTTAATTGAAAGGCAGCGACTTGTCGCCTCTTTTGACGCGGAAGGTGGGGGATACGTTTTGGGGAGCTGTTGGCACCTCGGAAAGACGCTTGAGAGATCGGAGTGGGGGGGCCTCTTGGGTCTGGAGATAAATTGGGGTGTCGTTTTGGGACTATGTGCGTGACCTGGGATTGGTTCGATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTTCGGCGCCCATCGCGATCTACAGGTCTCCGGCTTCACTC
  5   1   4      seed Brn4      in                         CAAL6519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGGACCAGAAATCTAGGGGCATAGAGGAGACCCTTATGTGTGAGAGGGGACGTACAAATGTCTGTCAAGGTTTAAAAGTGTGGGGAAAAGTTTGTGCGGAGCTGCTGCGCCGGGCGGCTGGGCTCTGTCGGACTACTCCATGCAGCAGCAGCAGCAGCTACGGATGCCGTGGAACTCCAGCGCTGATCCGGGCGTTGGCAGCGCCAGCCTCCGCTTTGCCATGTGGATTGTCCCGCTAACCCTCAGCTGGATCCTCGGCGTGTCCTGGGGGGCAAACAACCTCGGATCGCACCACATTCATCATTTCCATGGGGGGAAACACGTTTCGGCGCCCATCGCGATCTACAGGTCTCCGGCTTCACTCAGAGGAGGAAACGCCGGCATAACATATATATTTAGCAAAGGAGGAGGACAAATCACTTACACATGGCCCCCTAACGACAGGCCGAGTACACGTGCCGACAGGCTGGCAGTAGGATTTAGCACTGTTCAAAAAGAAGCAGTTTTAGTACGAGTGGACAGCTCTACTGGACTGGGGGACTACTTAGAGCTGCATATTCATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGANACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTTCATAGCCAAAGCACGATAAAAATCGGTGGGGAAGGACAGGGGACNACCATTTNCAGGACAGCTTTCTGGGCCTTACTAC
  3   1   4      seed Brn4      in                         CAAL6519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTCAATGCAATCATAAATGACGGGAAATCCCATACAGTACGTTTTACGCGAAGTGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAAC
  3   1   2       ext Brn4 5g3  in                        CAAL20915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGNCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATG
  3  -1   2       ext Brn4 5g   out                       CAAL22844.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGCGATCTAGAACTAGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAAAAAAAATTAAAAGGAGACAGGGGATGAAATCGGAAGAGCGAGACTGTTTTAAAAAAAACAAAGTAAAAACAAAGATACCATGGTCTAGGTTGCCAGAAACAGGAGCCAAAACAAGAATCCCGAATATCCACAGTGTTTTCATTTATTCTGCCTGTCATTGAAATGTCGCAGGAATGCTTTGGAAAGACAGTTGCGGCTCCAAATATTCTATGAATTTGGAGTCAATTCCAGCATTAAGGCACAATTTT
  5   1   2  SIG                                      Xt7.1-XZT38012.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATTCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCTTCTCTACGCTATGTACAAATATCGAAACAGGCATGATGCTTCTATCACGTGATGAGAGTCGAACTACTTCAGTACTCAGCGCAGTTCACGGGCTGTGATTAGAAAACATCAGTATGCTAAGGCTCTAACAAACAGAAAACAGGAAAGAATTATGCTGATCAGCACTTAAGACAGTTAGAAATAGTCCTCATTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATATTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTT
                                                  Xt7.1-CHK-1008293924                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATTCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCTTCTCTACGCTATGTACAAATATCGAAACAGGCATGATGCTTCTATCACGTGATGAGAGTCGAACTACTTCAGTACTCAGCGCAGTTCACGGGCTGTGATTAGAAAACATCAGTATGCTAAGGCTCTAACAAACAGAAAACAGGAAAGAATTATGCTGATCAGCACTTAAGACAGTTAGAAATAGTCCTCATTTATCTGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATATTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGA
  5   1   4      seed Tad5      in                         XZT38012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGC
  5   1   2       ext In62                            IMAGE:8956924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTACTGCGAAGTAGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGAAACAATGATAACGAACGCCTGGCGATTGCTAGACAGCGAATTCCATATCGACTTGGTCGAGTAGTTGATGATTGGCTACTCGACAAAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATTCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCTTCTCTACGCTATGTACAAATATCGAAACAGGCATGATGCTTCTATCACGTGATGAGAGTCGAACTACTTCAGTACTCAGCGCAGTTCACGGGCTGTGATTAGAAAACATCAGTATGCTAAGGCTCTAACAAACAGAAAACAGGAAAGAATTATGCTGATCAGCACTTAAGACAGTTAGAAATAGTCCTCATTTATCTGAACAT
  3   1   4      seed Tad5      in                         XZT38012.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATATTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAGG
  5   1   2  SIG                                       Xt7.1-CBTC435.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAAAAAAAATTAAAAGGAGACAGGGGATGAAATCGGAAGAGCGAGACTGTTTTAAAAAAAAAACAAAGAAAAAACAAAGATACCATGGTCTAGGTTGCCAGAAACAGGAGCCAAAACAAGAATCCCGAATATCCACAGTGTTTTCATTTATTCTGCCTGTCATTGAAATGTCGCAGGAATGCTTTGGAAAGACAGTTGCGGCTCCAAATATTCTATGAATTTGGAGCCAATTCCAGCATTAAGGCACAATTTTAGAAAACGAAAGAAAAAGCTACCTATGATTCTGGATTCAGCCAAAGTGCTAGTGCTTTTTTCCAAACGTAAGTTCATTCTGGTGCCAGCGAAGAATCGTCTGAACCTGCCAACGTCAGTGGTTTGCTGTACTGTGCAATGAAACAATGATATGTATTCAGTAAAAAAAACATGCTCGGAAGACTTAAATACTTTCACGAAGCCCCTTTCTGGTTGCTAAGGGATGTGTTACGGAGGCCTTATTTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCAGTAAAACTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAGGAAAAATGAAAAAAAAAAAAAAGTTAAAAACTCTGCGTTATTTGGTTTATACATTAACCCAACAGTGGTTATTTAAATATACCTCTGTTAGTCCATGGAGGTCCTCTGGTAGAACCAGGGGTTTCACATATTTTAGATAGGGTGAAAGTAAAACGCCCAAAATAAATAAAATGAATTTTAACAAAGAACAAAACAAAATAAAAATTCAAATGGTATTTTCCTAAAGTTTATGGTTATTATTATTAAATCACAATTGATAGATTTTGTTCCTCATTACAACAGCCCCTGCCTTTGTGAAGTTTAAAGTCCCTCCCACATTCTCACAACATGGGATACCCTGGAGTCATTTCATTAGAAGTCAGTAAACCACCAGTATGTTTTTGGAGTCTAAGGGGAAACCAGAGTACCTGAAGGAAAACCATATAGACACGGGAAGAGCGTACAAACTCCTTGTAGACAGTTCCCAGGTCAAAATACTACTGTTCCTGCCTTTGTGAAGTTTTAAGTCCCCCCCACATTCTCACAA
                                                  Xt7.1-CHK-1008293916                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAAAAAAAATTAAAAGGAGACAGGGGATGAAATCGGAAGAGCGAGACTGTTTTAAAAAAAAAACAAAGAAAAAACAAAGATACCATGGTCTAGGTTGCCAGAAACAGGAGCCAAAACAAGAATCCCGAATATCCACAGTGTTTTCATTTATTCTGCCTGTCATTGAAATGTCGCAGGAATGCTTTGGAAAGACAGTTGCGGCTCCAAATATTCTATGAATTTGGAGCCAATTCCAGCATTAAGGCACAATTTTAGAAAACGAAAGAAAAAGCTACCTATGATTCTGGATTCAGCCAAAGTGCTAGTGCTTTTTTCCAAACGTAAGTTCATTCTGGTGCCAGCGAAGAATCGTCTGAACCTGCCAACGTCAGTGGTTTGCTGTACTGTGCAATGAAACAATGATATGTATTCAGTAAAAAAAACATGCTCGGAAGACTTAAATACTTTCACGAAGCCCCTTTCTGGTTGCTAAGGGATGTGTTACGGAGGCCTTATTTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCAGTAAAACTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAGGAAAAATGAAAAAAAAAAAAAAGTTAAAAACTCTGCGTTATTTGGTTTATACATTAACCCAACAGTGGTTATTTAAATATACCTCTGTTAGTCCATGGAGGTCCTCTGGTAGAACCAGGGGTTTCACATATTTTAGATAGGGTGAAAGTAAAACGCCCAAAATAAATAAAATGAATTTTAACAAAGAACAAAACAAAATAAAAATTCAAATGGTATTTTCCTAAAGTTTATGGTTATTATTATTAAATCACAATTGATAGATTTTGTTCCTCATTACAACAGCCCCTGCCTTTGTGAAGTTTAAAGTCCCTCCCACATTCTCACAACATGGGATACCCTGGAGTCATTTCATTAGAAGTCAGTAAACCACCAGTATGTTTTTGGAGTCTAAGGGGAAACCAGAGTACCTGAAGGAAAACCATATAGACACGGGAAGAGCGTACAAACTCCTTGTAGACAGTTCCCAGGTCAAAATACTACTGTTCCTGCCTTTGTGAAGTTTTAAGTCCCCCCCACATTC
  5   1   0       chi Brn4      in                        CAAL11566.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCAAGGGAAAATTGGAGTGAAATTTAATGTTGGAACAGATGACATATCAATTGAAGAAGTCAATGCAATCATAAATGACGGGAAATACCATACAGTACGTTTTACGCGAAGTGGGGGTAATGCCACCTTGCACGTAGACAACTGGCCGGTAATAGAACGTTATCCTGCAGGGCGCCAGCTCACAATCTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGGTGGGTTAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAG
  5   1   2       ext Bone      in                         CBTC435.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTCAATAGCCAAGCAACGATAAAAATCGGTGGGAAGGACCAGGGACAACCATTTCAAGGACAGCTTTCTGGCCTTTACTACAATGGCTTGAAAGTTTTGAACATGGCAGCTGAAAATAATCCTGACATCGTAATAGAGGGAAACGTCAGGCTTGTTGGTGATGTGCCTTCATCTATGACTACAGAATCTACCGCCACTGCTATGCAGTCAGAAATGTCTACATCCATTATGGAAACTACTACGACACTGGCCACTAGCACTAGGAAATCACCTACAAGGGAACCTGTTGGTCAGACCACTGATGACATCTTGGTTGCTTCTGCCGAGTGTCCCAGTGATGACGATGAGGACATTGATCCCTGTGAGCCGAGCTCAGCAAATCCTACTAAAGCGAATGGAATTCCTGGCCCATCGGAAGTCATCCGAGAATCCAGCAGTACAACTGGCATGGTAGTCGGCATTGTTGCAGCAGCTGCGTTGTGCATCCTCATCCTCCTCTACGCTATGTACAAATATCGAAACAGGGATGAAGGCTCCTATCACGTGGATGAGAGTCGAAACTACATCAGTAACTCAGCGCAGTCCAACGGGGCTGTGATTAAGGAGAAACAACCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAANATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAANAAAAATTAAAAGGAGACA
  5   1   4      seed Brn4      in                        CAAL11115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCAGTAGTGCTAAAAGCTCTAACAAAAACAAGAAAAACAAGGACAAAGAATATTATGTCTGATCCCAGCCACTTAATGGACAAATGTATAGAAATAGTCTTCATTTTATCTGAGACATAAAATTAACAGACTTATTTACTTTACTTTTTACAAAGCACATTGAAAAAAAATTAAAAGGAGACAGGGGATGAAATCGGAAGAGCGAGACTGTTTTAAAAAAAAAACAAAGAAAAAACAAAGATACCATGGTCTAGGTTGCCAGAAACAGGAGCCAAAACAAGAATCCCGAATATCCACAGTGTTTTCATTTATTCTGCCTGTCATTGAAATGTCGCAGGAATGCTTTGGAAAGACAGTTGCGGCTCCAAATATTCTATGAATTTGGAGCCAATTCCAGCATTAAGGCACAATTTTAGAAAACGAAAGAAAAAGCTACCTATGATTCTGGATTCAGCCAAAGTGCTAGTGCTTTTTTCCAAACGTAAGTTCATTCTGGTGCCAGCGAAGAATCGTCTGAACCTGCCAACGTCAGTGGTTTGCTGTACTGTGCAATGAAACAATGATATGTATTCAGTAAAAAAAACATGCTCGGAAGACTTAAATACTTTCACGAAGCCCCTTTCTGGTTGCTAAGGGATGTGTTACGGAGGCCTTATTTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATA
  5   1   2       ext BrSp      in                     EC2BBA34DE05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAAAATGTCGCAGGAATGCTTTGGAAAGACAGTTGCGGCTCCAAATATTCTATGAATTTGGAGCCAATTCCAGCATTAAAGCACAATTTTAGAAAACGAAAGAAAAAGCTACCTATGATTCTGGATTCAGCCAAAGTGCTAGTGCTTTTTTCCAAACGTAAGTTCATTCTGGTGCCAGCGAAGAATCGTCTGAACCTGCCAACGTCAGTGGTTTGCTGTACTGTGCAATGAAACAATGATATGTATTCAGTAAAAAAAACATGCTCGGAAGACTTAAATACTTTCACGAAGCCCCTTTCTGGTTGCTGAGGGATGTGTTACGGAGGCCTTATTTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTT
  3   1   4      seed Brn4      in                        CAAL11115.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTACTGTGCAATGAAACAATGATATGTATTCAGTAAAAAAAACATGCTCGGAAGACTTAAATACTTTCACGAAGCCCCTTTCTGGTTGCTAAGGGATGTGTTACGGAGGCCTTATTTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCAGTAAAACTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACCAGTAACACC
  3   1   2       ext Bone      in                         CBTC435.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCCGAAATATGAAATATAAGGCACTTTTTCAAAATAAACAAGAGGGATAGATGCAATCATTGGGAAATTTTCATGCACGCTTAATATGTTATTACATATGTTTATATAAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTGATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTCTTCAGCCATTTTTGGTAAGTAAATGTTCTGTGTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCAGTAAAACTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCAAAAAAAAAAAAA
  3   1   2       ext BrSp      in                     EC2BBA34DE05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAACACATCTATATGTGCTTTCTGAACTGTGATAAGTAATGTTTTATAGCCTGTTGTATAGACAATGCAAAATATATCTGCTGTTCAGCCATTTTTGGTAGGGGGATGTTCTGTGTTGCTAGGTATAGGAAGTTTTTTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCAGTAAAACTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTT
  3   1   2       add Brn4      in                        CAAL11566.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGCTAGGTATAGGAAGTTTTCTGATGTCTGATGCAACAGACCAGTTCTCTTTTCTTTTTGCAGTCATCCAAAACAGTAAATCTCTCTCTCTTTTCTCTTTATTTTTTAATTTGAATTCTAGTATGCAGCGGGATAGGTATGAATGTATATATCATGTAAATCGACAGCACAATAGCCTAAATTTCACTGCAGCCAAGTTACAGTGTGTTTTGGGTGAGGACGTATAAAGGGGTCTTTAACCCCCTGTAAAAATGACCAAATTTCGGTAAAACTTAGAGATCTATACCTTCGCGATTAACCTCAACCCCTTTTTTGAAATGCTAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTTTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTTCC
  5   1   2       ext Brn3      out                        CAAK2904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAATACCCTTTTTCAGCCTTCCTAAAAAAAAGGTTCTATCCTTTAGTTACACAAATGTTAACAATTTTTGTATGACAGACTTGCCTACCATTAGAGGAGGGACAAATATATTCTCTGAATTAAAAAAAAGAATATTTTTTTTTTTTTTGTTTACAAGAAATTTGCTGTGTCATAAAAAAAGTATTTTATGTTGTATTTTACAATGATATTAAAACAGTAACACCATTTTGATTTTTTTATATTTATTTAACCCTTTCGTTTCTTTGAGGAAAAATGAAAAAAAAAAAAAAGTTAAAAACTCTGCGTTATTTGGTTTATACATTAACCCAACAGTGGTTATTTAAATATACCTCTGTTAGTCCATGGAGGTCCTCTGGTAGAACCAGGGGTTTCACATATTTTAGATAGGGTGAAAGTAAAACGCCCAAAATAAATAAAATGAATTTTAACAAAGAACAAAACAAAATAAAAATTCAAATGGTATTTTCCTAAAGTTTATGGTTATTATTATTAAATCACAATTGATAGATTTTGTTCCTCATTACAACAGCCCCTGCCTTTGTGAAGTTTAAAGTCCCTCCCACATTCTCACAACATGGGATACCCTGGAGTCATTTCATTAGAAGTCAGTAAACCACCAGTATGTTTTTGGAGTCTAAGGGGAAACCAGAGTACCTGAAGGAAAACCATATAGACACGGGAAGAGCGTACAAACTCCTTGTAGACAGTTCCCAGGTCAAAATACTACTGTTCCTGCCTTTGTGAAGTTTTAAGTCCCCCCCACATTCTCACAACAT
  5   1   0       add BrSp      out                    EC2BBA12DD09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGTTTCACATATTTTAGATAGGGTGAAAGTAAAACGCCCCAAAATAAATAAAATGGCTTTTAACAAAGAACAAAACAAAATAAAAATTCAAATGGTATTTTCCTAAAGTTTATGGTTATTATTATTATTAAATCACAATCGATAGATTTTGTTCCTCATTACAACAGCCCCTGCCTTTGTGAAGTTTAAAGTCCCTCCCACGTTCACACAACATGGGATACCCTAGAGTCATGTCATTATATGTCAGTAAAACCACCAGTATATTTTTGGAGTCTAAGGGGAAACCAGAGTACCTGAAGGAAAACCATAGAGACACGGGAAGAGAGTACAAACTCCTTGTAGACAGTTCCCAGGTCAAAATACTACTGTTCCTGCCTTTGTGAAGTTTAAAGTCCCTCCCACATTCTCACAACATGGGATACCCTAGTGTCATGTCATTAGAAGTCAGTAAAAGTACCAGTAAGTTTTTGGAGTATAAGGGGAAACCAGAGTACCTGAAGGAAAACCATTGAGACACGGGAAGAGCATACAAACTCCTTGTAGACTGTTCCCAGGTCAAAACTGCACGCAGGACCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)