Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 374.0    0Xt7.1-CAAK8403.5                            8 PI      84        918     1290                LOC495143 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012155163 Xt7.1-CAAL6321.3.5 - 19 ESTs
                                                                       .-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAL6321.3.5                                                                                                      GAGTGGAGCAGCGCGTTGGAGGCAGTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGGTACTCAGGCAGGGCCACCTGCGACTGCCCCAACTGCCAAGAGGCAGAGAGATTGGGGCCCGCCGGGGCCAGCCTGAGGAGGAAGGGGCTGCACAGCTGCCATATTCCCGGCTGCGGGAAGGTTTACGGCAAAACGTCTCACCTGAAGGCGCATCTGCGCTGGCACACCGGGGAGAGGCCCTTCGTTTGCAACTGGCTCTTCTGCGGCAAGCGATTCACTCGCTCCGACGAACTTCAGCGGCACCTGCGCACCCACACTGGAGAGAAGCGCTTTGCCTGCCCTGTATGTAACAAACGCTTTATGCGCAGCGACCACCTTAGCAAGCACATCAAGACGCACAACGGGGGAGGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGGGTAAATTAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008266935                                                                                                            AGCAGCGCGTTGGAGGCAGTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGGTACTCAGGCAGGGCCACCTGCGACTGCCCCAACTGCCAAGAGGCAGAGAGATTGGGGCCCGCCGGGGCCAGCCTGAGGAGGAAGGGGCTGCACAGCTGCCATATTCCCGGCTGCGGGAAGGTTTACGGCAAAACGTCTCACCTGAAGGCGCATCTGCGCTGGCACACCGGGGAGAGGCCCTTCGTTTGCAACTGGCTCTTCTGCGGCAAGCGATTCACTCGCTCCGACGAACTTCAGCGGCACCTGCGCACCCACACTGGAGAGAAGCGCTTTGCCTGCCCTGTATGTAACAAACGCTTTATGCGCAGCGACCACCTTAGCAAGCACATCAAGACGCACAACGGGGGAGGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATTAAAAAAAAAAAAAAAAAAGAAA
                                                      consensus depths                                                                                                           2     2     2     2     3     3     4     4     4     5     4     5     6     8     6     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     7     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     3     3     4     4     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     8     9     8     9     8     9     8     9     9    10     9    11     9    10     9    10     9    10     9    10     9    10    10    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     2     3     3     3
  5   1   2      ests                                 Xt7.1-CAAL9737.5                                                                                                      GAGTGGAGCAGCGCGTTGGAGGCAGTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGGTACTCA
  5   1   2      ests                                 Xt7.1-CAAL6321.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGGGGGAGGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGGGTAAATTAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                          -----------C
                                               BLH ATG     138     743                                                                                                      
                                               BLH MIN     138     144                                                                                                      
                                               BLH MPR     114     144                                                                                                      
                                               BLH OVR     138     470                                                                                                      
                                               CDS MIN     138     144                                                                                                      
                                               EST CLI      22       1                                                                                                      
                                               ORF LNG     138      75                                                                                                      
                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 5e-096     NP_572579.2 CG1343-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 6e-121     AAH84343.1 LOC495143 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = ?? ==== 6e-121     NP_001088307.1 hypothetical protein LOC495143 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 3e-141     NP_874359.2 Sp8 transcription factor isoform 1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                              PROTEIN --- Dr ---- 0          NP_998125.2 sp9 transcription factor [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_001005343.1 buttonhead-like zinc finger transcription factor Sp9 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          AAI21269.1 Trans-acting transcription factor 9 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAL6321.3.5                                                                                                                                                                                                                  TGA---------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------TAG------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------ATG---------------------------------------TAG---------------------------------------------------------TAA---------------------------------------------------------------------------------ATG---------------------------------TAA---------ATG---------------------------------------------------------------------------------------------------------------TAA------------------------------------TGA------------------------------TGA---------TGA------------------ATGTAA------------ATG------TAA
                                                                   ORF                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  0   1   1           Brn4 FL                         CAAL19605.FL-MGC                                                                                                                              GTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGCAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGGTACTCAGGCAGGGCCACCTGCGACTGCCCCAACTGCCAAGAGGCAGAGAGATTGGGGCCCGCCGGGGCCAGCCTGAGGAGGAAGGGGCTGCACAGCTGCCATATTCCCGGCTGCGGGAAGGTTTACGGCAAAACGTCTCACCTGAAGGCGCATCTGCGCTGGCACACCGGGGAGAGGCCCTTCGTTTGCAACTGGCTCTTCTGCGGCAAGCGATTCACTCGCTCCGACGAACTTCAGCGGCACCTGCGCACCCACACTGGAGAGAAGCGCTTTGCCTGCCCTGTATGTAACAAACGCTTTATGCGCAGCGACCACCTTAGCAAGCACATCAAGACGCACAACGGGGGAGGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATTAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CAAL9737.5                                                                                                      GAGTGGAGCAGCGCGTTGGAGGCAGTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGGTACTCA
                                                  Xt7.1-CHK-1008238554                                                                                                            AGCAGCGCGTTGGAGGCAGTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGG
  5   1   2       bld TpA  5g3  in                   TTpA071a01.p1kSP6 ATTGGTTGCGACGCGCCTCCAGTCGGCGTTCCGTGCTTGCTGATTGGTGGAGAGCGCCAGGCAGCGGTACTTCAAAGCAGCGGCTGGCAGGGCTTAGCGTTGAGTGGAGCAGCGCGTTGGAGGCAGTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCCTGACCACTCAGCTTTCAGC
  5   1   2       bld 1030 5g                         IMAGE:7091163.5p                                                                                                      GAGTGGAGCAGCGCGTTGGAGGCAGTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGACACGCAAGGGGCCT
  5   1   2       bld HdA  5g3  in                   THdA003d18.p1kSP6                                                                                                                            CAGTAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAGTGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCCTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCNGCCTGGTGGGATGTACACGCTGCCCGCCCCAGCACATG
  5   1   2       bld Brn4 FL   in                        CAAL19605.5p                                                                                                                               TAGGTGGAACCTCAGTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGCAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGTCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGG
  5   1   2   14  bld Brn4 5g3  in                         CAAL6321.5p ...........................................................................................................................................GTCGGTACAAGTTGTGTGCGGAGAAGGGAGCACCCTGCCTGGCAGCACNCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGCAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAACTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGGTACTCAGGCAG
  5   1   2   14 seed Brn4 5g3  in                         CAAL9737.5p ...................................................................................................................................................................AAGGGAGCACCCTGCCTGGCAGCACCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGCAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTC
  5   1   2       bld HdA  5g3  in                   THdA034d10.p1kSP6                                                                                                                                                                      TGGAGCACCCTGCCTGGCAGCACCTCTTCCTTCCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGAGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGTAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCA
  5   1   2   14  bld Brn3 5g3  in                         CAAK1281.5p ......................................................................................................................................................................GAGCACCCTGCCTGGCAGCACTCTCTTCCCCACCCAGGCACCCTGATCTCTGCCCAGGGCCAAGGGACGGGCTATGGCTACCTCTATACTTGGGGAAGAACCGAGATTTGGTACCACTCCCCTAGCCATGTTGGCTGCCACCTGCAATAAGATCGGGAACACCAGCCCCCTGAGCAGCCTGCCGGAGTCCAGCGCCTTTGCCAAAGGAGGTTTTCATCCCTGGAAACGCTCCTCATCCAGCTGCAGCCTGGGCTCTAGCCTGGGGGGATTCGCAGTAGCCACCAGCCGGGCCTCCGGTGCCCTAACAGGGGGAACAGCCACAGCCAACAGTGCGTTCTGCCTGGCCTCCACCTCCCCAACCTCCTCCGCCTTCAGCAGTGACTATAGCGGACTCTTTTCCAGCGCCTCTGGGGTGTCCCCGCAGGAATCAGCCGGCCAGTCAGCTTTCATCTCCAAGGTTCACGCCTCCGCGGAGGGTCTGTATCCGCGGGTGGGAATGGCTCACCCATATGAGTCCTGGTATAAGTCTGGCTTCCACTCGGACGTGTCTGGCGGGGCTTCGGCCTGGTGGGATGTACACGCTGCCGGCCCCAGCACATGGCTGGAGGTGCAGAACACGCAGGGGGCCCTCCACTCTGGGGCTGCCGCACATGGGCAGCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGGTACTCAGGCAGGGCCACCTGCGACTGCCCCAACT
  5   1   2      ests                                 Xt7.1-CAAL6321.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGGGGGAGGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGGGTAAATTAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008234855                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATTAAAAAAAAAAAAAAAAAAGA
  5   1   2       bld Tad5      in                         XZT11139.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGGGAGCCTACAGCCCGGACTTTAGTTCCCTGACCCACTCAGCTTTCAGCTCCACTGGCGCCTCCCATCTGCTCCCAGGGGGTCAGCACCTACTCACCCAAGACGCCTTCAAGCCGGTGCTGCCCTCCTATCCGGACTCTGGGGGCCCCATGCTCTCTGGGGCGGCAGGGACTGGGGCAGGGGGCACTGGGCGCTCAGCCAGACGGTACTCAGGCAGGGCCACCTGCGACTGCCCCAACTGCCAAGAGGCAGAGAGATTGGGGCCCGCCGGGGCCAGCCTGAGGAGGAAGGGGCTGCACAGCTGCCATATTCCCGGCTGCGGGAAGGTTTACGGCAAAACGTCTCACCTGAAGGCGCATCTGCGCTGGCACACCGGGGAGAGGCCCTTCGTTTGCAACTGGCTCTTCTGCGGCAAGCGATTCACTCGCTCCGACGAACTTCAGCGGCACCTGCGCACCCACACTGGAGAGAAGCGCTTTGCCTGCCCTGTATGTAACAAACGCTTTATGCGCAGCGACCACCTTAGCAAGCACATCAAGACGCACAACGGGGGAGGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCCAAGGCAAAATGAAACTAGAAAATA
  3   1   2       bld Brn4 5g3  in                         CAAL6321.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTAGCAAGCACATCAAGACGCACAACGGGGGAGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATT
  3   1   2       bld TpA  5g3  in                   TTpA071a01.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACGCACAACGGGGGAGGTGGAGGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGAAATAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn3 5g3  in                         CAAK1281.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGGAGGTGGAGGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATT
  3   1   2       bld Brn4 FL   in                        CAAL19605.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCACTTGGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATT
  3   1   2      seed Brn4 5g3  in                         CAAL9737.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGGCAAAAAGGGAAGCGACAGCGACACAGACGCCAGCAACTTGGAGACCCCTAGATCTGAATCCCCTGAACTCATCATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATT
  3   1   2       bld HdA  5g3  in                    THdA034d10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGGAAGGGGTTAGGCCCGGAAAGGACTCTGGGAATGACTCCTAGGGGGGGGGGGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTTGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTTTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTTTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTTTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACATGGTGAAAGTCAATATATATATATATGTAAGAGATAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tad5      in                         XZT11139.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGAATGACTCCTAGGAGGGGGGCGGCCACCTCTGGGGGCACATAGACTTCTTCCTGGGGGTGCAGCCAGTTTGTGGCGACAAAAACGCATACGGACGCCTTAGAGATGCGACTGAATTTTTTGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGA
  5   1   2       bld Neu                            TNeu041l05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATACGGACGCCTTAGAGNAGCGACTGAATTTTTGGGGGGGGATTCATAGCTACTTGTTGCTCGAGTGCACTGGACTCTATGTACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATT
  3   1   2       bld HdA  5g3  in                    THdA003d18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGACTTTATGTTTTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAGGACTTTTAGATTCAGAGCAATAGACGCAATTATTGGGGGTCAGAGACTGGGAACCCCCTTATTTTTTTTTTTACAGGGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTAGGACACTAAATCCTCCCCTGAGATTTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATTTTTAAACGCAGATTAAGGTGGGAAGATGAAACAAAAAAACCGGGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTTTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCCTTGTAAACGTTTATTCCAATAGTTTTATTTTTTGTGGATTCCTGAAATTCAGGATATTTTTTTTTTTTTTTTTTTTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCATTCAGACGGGTAAATTAAAAAAAAAAAAAAAAAAGAAAATCAAATTTAAATGCGTTTATCTGTATTATAAAAAAAAAAAATCCTGGTCAAAATTTGATTTTCGTATTAAAGACTTCTGATCAGAAAAAAAAAAAAAAAAAAGCGGCC
  5   1   2       bld HdA                           THdA040g18.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACTGGCAAAGGCAAAATGAAACTAGAAAATATCGCAAGACTTCTAGATTCAGAGCAATAGACGCAATTATCGGAGGCTCAGAGACTGGGAACCCCCTTATTCTTTCTATTACAGCGATTAAAAAGACCAGAAACCCCTTCCGATTCCTTTGTGGATTACGACACTAAATCCTCCACTGAGATCTATTAACAGTTTTTTTTTTATGATCAATAAATTCAATTCATCTTTAAACGCAGATTAAGGTGAGAAGATGAAACAAAAAAACCGAGGGAAATATTTGGGACGATTTATCAGCATTTCCTATATTCTGTATAAAAATAGGTTTCAGAAAGGTCGTGTTGATTTTTATTCATTTTCCCCATTGTAAACGTTTATTCCAATAGTTTTATTTTTCGTGGATTCCTGAAATTCAGGATATTTCTTTTTCTTTCTTTTCTGATGCACTTTGTGAAAGTCAATATATATATATATGTAAGAGATATTTAAAATGTTGATTTAACATTTCACTCAGACGCGTAAATTAAAAAAAAAAAAAAAAAAAAGAAAATCAAATTTAAATGCGTTTATCTGTATTATAAAAAAAAAAAATCCTGGTCATATTTTGATTTTCGTATTAAAGACTTCTGATCNTGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)