Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012155197 Xt7.1-TTbA062e11.3.5 - 31 ESTs
                                                                       ........-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTbA062e11.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCCGTGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGNGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTTCTACAGCTCCCTCGGCCTGACCCGCCACATCAACAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGCCCAGGGAGCCCGCTATGCCCAAGTCATGCCCATGGGCACTGAGGGGAGACGGAATGGGAAGGGAGAGCACTTTCTGCTTTATTTATTGTGTTGATAATATTCTCTGTGTCCGTGCTAAATGCCTGTGCCGCCCATAGGTGGGCAAGGATTCTACAGTAAGTTATGTATGTTGTCCCATTGGCCTCATAGAGACAGCGCTGAGCCATAGCGGGGATAGTGCTGCTGCCTGTGAGAGCTCAGATGGGGCAACGCTTTAGGGTGGGGGAGGGGTGGGCAAGCCATATGCTCACTGTACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATCAAAAA
                                                  Xt7.1-CHK-1008266943                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGGGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTTCTACAGCTCCCCCGGCCTGACCCGCCACATCAACAAGTGCCACCCCTCCGAGAACCGGCAGGTCATCCTGCTCNAAGTGCCGGTGCGCCCGGCCTGCTGACTTTGTGGGGACTTGTTCCAAGGAGAAATGTAGGGGTGTGCCCACCCCTCCCCCACATGGACCTGACGGGGGCCCCAAAATGAGAATATTGCACCAATTGTAAGTGCCGGGGGGCTGCAGCATATTGCGGGGCAGTGTGTTGTCTCTCTCAGGCACTTATGGAATCAGATACTTTGGGCCAATGGGCACAGAGGTCACAAGGTGCCCCTAAAGGGCCAATAAAACGGACCATCTTGCACTAATGGGGCGAGGGAAGTGCCGCTAGCCATGCCTGCTGCCCCCCCCCGGTGCCCACCCAACCCCCACACAGGTTTCCAACAAGCCCCCGCTGTGGCTACGGGACTCGCATGCCTGACTAGTACTGTGCCTTCCCGGTGCATCCAATGCCCACAGGGCACTGCCACCTGCCAAATCAGCGACCACAGCAGCCATAGGCCCAAGTGCATTACATTGTGGTTATTGTGCTTTAAAGCGACCCANAGTTATCCGAGTAACCCCTCAGTGCCCAGGGAGCCCGCTATGCCCAAGTCATGCCCATGGGCACTGAGGGGAGACGGAATGGGAAGGGAGAGCACTTTCTGCTTTATTTATTGTGTTGATAATATTCTCTGTGTCCGTGCTAAATGCCTGTGCCGCCCATAGGTGGGCAAGGATTCTACAGTAAGTTATGTATGTTGTCCCATTGGCCTCATAGAGACAGCGCTGAGCCATAGCGGGGATAGTGCTGCTGCCTGTGAGAGCTCAGATGGGGCAACGCTTTAGGGTGGGGGAGGGGTGGGCAAGCCATATGCTCACTGTACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATxAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     1     1     2     2     1     1     2     2     2     2     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     0     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     5     5     5     5     4     6     5     6     5     6     6     8     6     8     6     8     6     8     6     8     6     9     5     8     5     8     5     8     5     9    11    11     6    10     6    10     6    10     5    10     5    10     5    10     5    10     5    10     5     9     5     9     6    10     6     9     6    10     6    11     6    13     9    13     8    14     8    15    13    15    15    15    15    15    14    14    14    14    15    15    15    15    15    15    15    15    14    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    14    15    12    13    11    12    11    12     4     5
  5   1   2      ests                                 Xt7.1-XZT10312.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCCGTGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGNGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTT
  5   1   2      ests                               Xt7.1-TTbA062e11.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTGTACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A----G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---T--------
                                               BLH ATG     130     921                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MIN     130      82                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH OVR     130      49                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               EST CLI       0      57                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               ORF LNG     130       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- ?? ---- 4e-015     NP_536709.1 zinc finger protein 358 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 2e-024     NP_504694.1 Nervous fingers, EGg Laying defective EGL-46 (32.5 kD) (egl-46) [Caenorhabditiselegans] -------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-035     NP_524300.1 nervous fingers 2 CG12809-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 1e-038     XP_001198951.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 8e-118     NP_991207.1 hypothetical protein zgc:77257 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 5e-124     NP_058585.2 insulinoma-associated 1 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 4e-124     NP_002187.1 insulinoma-associated 1 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          NP_001076827.1 insulinoma-associated 1 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTbA062e11.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAA------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------TAG------------------------------------------TAA------------------------ATGTAA---ATG---------------ATG------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------TAA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAA---------------TAG------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------TGA---------TAA---------------------------TGA---TGATGA---------------------------------TAG------------------------ATG------------------------------------------------TGATGA------------------------------------------------------------TAG---------------------------------------------TAA---TAATAG---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  0   1   1           Tad5 FL                          XZT45231.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCCGTGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCGGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGGGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTTCTACAGCTCCCCCGGCCTGACCCGCCACATCAACAAGTGCCACCCCTCCGAGAACCGGCAGGTCATCCTGCTCCAAGTGCCGGTGCGCCCGGCCTGCTGACTTTGTGGGGACTTGTTCCAAGGAGAAATGTAGGGGTGTGCCCACCCCTCCCCCACATGGACCTGACGGGGGCCCCAAAATGAGAATATTGCACCAATTGTAAGTGCCGGGGGGCTGCAGCATATTGCGGGGCAGTGTGTTGTCTCTCTCAGGCACTTATGGAATCAGATACTTTGGGCCAATGGGCACAGAGGTCACAAGGTGCCCCTAAAGGGCCAATAAAACGGACCATCTTGCACTAATGGGGCGAGGGAAGTGCCGCTAGCCATGCCTGCTGCCCCCCCCGGTGCCCACCCAACCCCCACACAGGTTTCCAACAAGCCCCCGCTGTGGCTACGGGACTCGCATGCCTGACTAGTACTGTGCCTTCCCGGTGCATCCAATGCCCACAGGGCACTGCCACCTGCCAAATCAGCGACCACAGCAGCCATAGGCCCAAGTGCATTACATTGTGGTTATTGTGCTTTAAAGCGACCCAGAGTTATCCGAGTAACCCCTCAGTGCCCAGGGAGCCCGCTATGCCCAAGTCATGCCCATGGGCACTGAGGGGAGACGGAATGGGAAGGGAGAGCACTTTCTGCTTTATTTATTGTGTTGATAATATTCTCTGTGTCCGTGCTAAATGCCTGTGCAAGGATTCTACAGTAAGTTATGTATGTTGTCCCATTGGCCTCATAGAGACAGCGCTGAGCCATAGCGGGGCTAGTGCTGCTGCCTGTGAGAGCTCAGATGGGGCAACGCTTTAGGGTGGGGGAGGGGTGGGCAAGCCATATGCTCACTGTACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATCAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Brn3 FLt5                       CAAK11420.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGGGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTTCTACAGCTCCCCCGGCCTGACCCGCCACATCAACAAGTGCCACCCCTCCGAGAACCGGCAGGTCATCCTGCTCCAAGTGCCGGTGCGCCCGGCCTGCTGACTTTGTGGGGACTTGTTCCAAGGAGAAATGTAGGGGTGTGCCCACCCCTCCCCCACATGGACCTGACGGGGGCCCCAAAATGAGAATATTGCACCAATTGTAAGTGCCGGGGGGCTGCAGCATATTGCGGGGCAGTGTGTTGTCTCTCTCAGGCACTTATGGAATCAGATACTTTGGGCCAATGGGCACAGAGGTCACAAGGTGCCCCTAAAGGGCCAATAAAACGGACCATCTTGCACTAATGGGGCGAGGGAAGTGCCGCTAGCCATGCCTGCTGCCCCCCCCGGTGCCCACCCAACCCCCACACAGGTTTCCAACAAGCCCCCGCTGTGGCTACGGGACTCGCATGCCTGACTAGTACTGTGCCTTCCCGGTGCATCCAATGCCCACAGGGCACTGCCACCTGCCAAATCAGCGACCACAGCAGCCATAGGCCCAAGTGCATTACATTGTGGTTATTGTGCTTTAAAGCGACCCAGAGTTATCCGAGTAACCCCTCAGTGCCCAGGGAGCCCGCTATGCCCAAGTCATGCCCATGGGCACTGAGGGGAGACGGAATGGGAAGGGAGAGCACTTTCTGCTTTATTTATTGTGTTGATAATATTCTCTGTGTCCGTGCTAAATGCCTGTGCAAGGATTCTACAGTAAGTTATGTATGTTGTCCCATTGGCCTCATAGAGACAGCGCTGAGCCATAGCGGGGATAGTGCTGCTGCCTGTGAGAGCTCAGATGGGGCAACGCTTTAGGGTGGGGGAGGGGTGGGCAAGCCATATGCTCACTGTACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATCAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-XZT10312.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCCGTGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGNGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTT
                                                  Xt7.1-CHK-1008238577                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGGGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTTCTACAG
  5   1   2       bld HdA  5g3  in                   THdA006b20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCCGTGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCTCCCGCCGGTCAGTTCGGGAACCCCGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCA
  5   1   2      seed Tad5 FL   in                         XZT45231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCCGTGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCGGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAA
  5   1   2       bld HdA  5g                        THdA026n01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGTGCAGCTGCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCTTATTAACTATTAACTCCCCACACTCCCTGAGACACTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCTCCCGCCGGTCAGTTCGGGAACCCCGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCC
  5   1   2   12  bld Tad5 5g3  in                         XZT10312.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCACCTCGGACAGTGCAGGAGAGCGGGAGGCACAGCAGCACCTCGGACAGTGCCAGACAGCCGCCTATTAACTATTAACTCCCCACACTCCCTGAGACTCTCCTTCGCACCAACATGCCTAAAGGGTTTCTGGTGAAACGCAGCAGGAAGTCCCCGCCGGTGTCCTACCGGGTGCGGGAAGAAGAAGAGCCCCGCGGGGAGTCGCTCCCGGGATGGATGCTCTTAGCTACAATGTGCCCGACCGGTGGGGCCCCGCCGCCCTGCAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCCGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCC
  5   1   2       bld TbA       in                   TTbA062e11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCCCAGACAGAGCCACCCAGGCCCCATGCTGCAGCAGCCCCCGGCCGCCCCCCGCCGGTCAGTTCGGGAACCCGGACACAGTGCAGCAGGCTCTGTACAGCCCGACCCGCCCGGTGAGCAGGGAGCAGCGGGAAAGGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCA
  5   1   2       bld Neu                            TNeu024h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACACAGTGCAGCAGGCTCTGTCAGCCCGCCCGCCCGGTGAGCAGGAGCAGCGGGAAAGAAATACCTGGGATCCCCGGTGTCTGCGGAGTCCTTTCCGGGCCTGGGCACCTCCAGCGAAGCGCTACTCTACCCTCCCACAGGCACTGCCAATGGGCATCACGGACTGGCACTGCTGCCCCCGGTCTCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAAGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGACGCTGGCACAAGCCCCGACCCCC
  5   1   2       bld Brn3 FLt5 in                        CAAK11420.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTCCTCCTCTTCAGTCAGCCGAAGCCAAGGCAAGAGGCCGGCCCCGGAGCCCGACAGCAAGCCCGCCGCTATGCCCGGCACTGGCCCAGGGGCCACAAGCAGCTCGGCCCCCAGCAAGCCCCCTGCGGCCAAGAAAACCAAAGCCATCCGCAAACTGACCTTTGAAGACGAGGTGACCACATCCCCGGTGCTGGGTCTGAAAATCAAGGAAGGACCGGTGGAGCCCCCCCGCCCCAGGGCAGCCAGCTCCGGGCCCCGACCCCTGGGGGAGTTCATCTGCCAACTGTGCAAGGAGGAGTACAGCGACCCCTTCTCCCTGGCGCAGCACAAATGCTCCAGAATCGTGAGGGTCGAGTACCGCTGCCCAGAGTGCCACAAGGTGTTCAGCTGCCCGGCCAACTTGGCATCGCACCGCCGCTGGCACAAGCCCCGACCCCCAGTCGCCTCCACAGCCCAAGCCAAGGAGGAGCCACTGAGTGACCGGGACACCCCCAGCCCAGGGGTCTCCGAGTCCGGCTCAGAAGATGGGCTGTACGAGTGCCCCCGGTGTGCCCGCAAGTTCCGCCGCCAGGCTTATCTGAGGAAGCACCTGCTGTCGCACCAAGCAGCCAAGGAGCCGGAGGAGCCCGGTGTCATGATGTTCCCGGGGGAGGAGCAGCGAGCCAAGAGCCCCCCCAGCCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGNGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTTCTACAGCTCCCTCGGCCTGACCCGCCACATCAACAAGT
  5   1   0       add Gas8      in                          st95e08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGCCCGGTGGTCATGATGTTCCCGGGGGAGGAGCATCGAGCCAAGAGCCCCCCCAGNCTGAATGCCCAGGAGTGCCACCCGTGCCCGGTGTGTGGGGAAACATTCCCGGGGAAGAGCAGCCAGGAGCGCCACATCCGCCTCCTCCACTCCTCCCAGCTGTACCCCTGCAAGTACTGCCCCGCCACCTTCTACAGCTCCCCCGGCCTGACCCGCCACATCAACAAGTGCCACCCCTCCGAGAACCGGCAGGTCATCCTGCTCNAAGTGCCGGTGCGCCCGGCCTGCTGACTTTGTGGGGACTTGTTCCAAGGAGAAATGTAGGGGTGTGCCCACCCCTCCCCCACATGGACCTGACGGGGGCCCCAAAATGAGAATATTGCACCAATTGTAAGTGCCGGGGGGCTGCAGCATATTGCGGGGCAGTGTGTTGTCTCTCTCAGGCACTTATGGAATCAGATACTTTGGGCCAATGGGCACAGAGGTCACAAGGTGCCCCTAAAGGGCCAATAAAACGGACCATCTTGCACTAATGGGGCGAGGGAAGTGCCGCTAGCCATGCCTGCTGCCCCCCCCCGGTGCCCACCCAANCCCCACACAGGTTTCCAACAAGCCCCCGCTGTGGCTACGGGACTCGCATGCC
  5   1   2      ests                               Xt7.1-TTbA062e11.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACTGTACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008229827                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAAAAAAA
  5   1   0       add Gas8      in                          st33i15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTCCCCCACATGGACCTGACGGGGGCCCCAAAATGAGAATATTGCACCAATTGTAAGTGCCGGGGGGCTGCAGCATATTGCGGGGCAGTGTGTTGTCTCTCTCAGGCACTTATGGAATCAGATACTTTGGGCCAATGGGCACAGAGGTCACAAGGTGCCCCTAAAGGGCCAATAAAACGGACCATCTTGCACTAATGGGGCGAGGGAAGTGCCGCTAGCCATGCCTGCTGCCCCCCCCCGGTGCCCACCCAACCCCCACACAGGTTTCCAACAAGCCCCCGCTGTGGCTACGGGACTCGCATGCCTGACTAGTACTGTGCCTTCCCGGTGCATCCAATGCCCACAGGGCACTGCCACCTGCCAAATCAGCGACCACAGCAGCCATAGGCCCAAGTGCATTACATTGTGGTTATTGTGCTTTAAAGCGACCCANAGTTATCCGAGTAACCCCTCAGTGCCCAGGGAGCCCGCTATGCCCAAGTCATGCCCATGGGCACTGAGGGGAGACGGAATGGGAAGGGAGAGCACTTTCTGCTTTATTTATTGTGTTGATAATATTCTCTGTGTCCGTGCTAAATGCCTGTGCCGCCCATAGGTGGGCAAGGATTCTACAGTAAGTTATGTATGTTGTCCCATTGGCCTCATAGAGACAGCGCTGA
  5   1   2       bld Tbd1      in                         CBXT2121.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCCCTCAGTGCCCAGGGAGCCCGCTATGCCCAAGTCATGCCCATGGGCACTGAGGGGAGACGGAATGGGAAGGGAGAGCACTTTCTGCTTTATTTATTGTGTTGATAATATTCTCTGTGTCCGTGCTAAATGCCTGTGCCGCCCATAGGTGGGCAAGGATTCTACAGTAAGTTATGTATGTTGTCCCATTGGCCTCATAGAGACAGCGCTGAGCCATAGCGGGGATAGTGCTGCTGCCTGTGAGAGCTCAGATGGGGCAACGCTTTAGGGTGGGGGAGGGGTGGGCAAGCCATATGCTCACTGTACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTAGTCCCCCCCAGTGTAGGGACCCACAATCCGTCCCAATACAGGGATC
  5   1   2       bld Gas7                                 XZG13848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTAGAGACAGCGCTGAGCCATAGCGGGGCTAGTGCTGCTGCCTGTGAGAGCTCAGATGGGGCAACGCTTTAGGGTGGGGGAGGGGTGGGCAAGCCATGCTCACTGTACTTTTTAAAAATGTCAGATCGCAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGA
  5   1   2       bld Neu                            TNeu137n20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCGCTGTACTTTTTCAAAATGTTAAATCGCAGGGGGGGCCGTGTACTTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCTGTAATTCACACAAAACCCCCTGCCCACTCTGGCTGCGTTTAACCCTTCACATGCCATTTGGGAGAGCCCTTCTATCATCAAATTATGTCACCTGTGCTTTTCTAGCGGGGCCTCTTGTCTTGATATAAATGGGCTGTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTTGCTTTATACACTGGCCGGGGG
  5   1   2       bld TpA       in                   TTpA016o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGGTTTGTCATGTAATTGATGTGCTTAACCCCTAAAATGCTGGAGGGAGCTGCGGTAATTCGCAGAGAAGCCCCTGCCCAATCTGGCTGCGTTTAACCCGTCACTGCCATTTGGGAGAGCCCTTCTAGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCACTGTGGGATTTTGGGGGGGGAG
  3   1   2       bld TbA       ?                     TTbA057i18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGCAGTTTATGTCGCCTGTGCTTTTGTAGCCTTTCCTCTTGTCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTTATATATATATTTTGC
  3   1   2       bld Brn3 FLt5 in                        CAAK11420.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTGGTAGCCTTTCCTCTGATCTTGATATAAATGTGCTTTCTAGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTCTTCAAATAAAATTATTTTCCAATTCAAATC
  3   1   2       bld BrSp                             EC2BBA31DD05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTAGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATGTGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAA
  3   1   2      seed TbA       in                    TTbA062e11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCTAAGGGGTTAATGTTCTGCCTTGATGCCCCCCGGCCTGCACACAACTATACCATTAGCTTTATACACTGGCCGGGGGGCTGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATCAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld HdA  5g3  in                   THdA006b20.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCATTAGCTTAATACACTGGCCGGGGGGCGGCTCAGCTCTGTCTTTCTCTCTTCTCAGCCCCAGCTGTGGATTTTGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTAGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATCAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 FL   in                         XZT45231.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCCCCAGCTGTGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCGGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATC
  5   1   2       bld Neu       in                   TNeu070f04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGGGTGGATTTTGGGGGGGGAGGAGGACACTTTACTTTTTTTTTATCCACAAATGCCTTGTAAGTCATTATTGTCTGCTTTAATAACTCTGGAGTAAGCTGTATCGACTGCCT
  3   1   2       bld Neu       in                    TNeu070f04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGATTTTGGGGGGGGAGGAGGAGACTTTACTTTAGTCTTAGCCACAAATGCCTTGAAGTCATTATTGTCTCTTTAATAACTCTGGAGTAAGCTGTAGCGACTGCCTGGTCCCCCCCAGTGTAGGGACCCACAATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas0                                 dad35b09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCCATCCCAATACAGGGATCCTGGCTACATTAAATCAACTTTTTGTCACGTGTTTTGTCCCCCCCCCCTCTAAAATATCTTTCTGTATGCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTCCAATTTCAAATCAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT2121.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATAAAATAAATTTTTTGCCAGGTTTTTTTCCCCCCCCCCCCCCCTTTAAAATATTTTTTTGTATCCCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATTTATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st95e08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AANTTTTTNNCNNNGNNTTTNNCCCCCCCCCCCCCTNTAAAATATCTTTCTGTATGCCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATTTATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAAACTGTTCTACTGTGAACGATTGC
  3   1   2       bld Tad5 5g3  in                         XZT10312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGGCCCCCCCCCCCCCCCTCTAAAATATTTTTCTGTATGCCCCCCCCCCATGCGTTTCCTATCCAAAATGTATATGTGGATTTTATGATTAATTATGTCTATTAATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATTTATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAA
  3   1   2       bld Gas8      in                          st33i15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNTTTNNCCCCCCCCCCCCCTNTAAAATATCTTTCTGTATGCCCCCCCCCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATTTATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGAACGATTG
  3   1   2       bld HdA                             THdA052p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCTAAAATATCTTTCTGTATGCCCCCCCTCCATGCGTTTACTATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATCATAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA       in                    TTpA016o10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTTGTATGCCCCCCCCCCATGCGTTNTATATCCAAAATGTATATGTTGATTTTATGATTAATTATGTTTATTTATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATCAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                 XZT66732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTTATTTATTTATGAGAATGATGAAGATATGACTTTTATTCGATCTCTTTCATTGCCTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Brn3      in                        CAAK10779.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATC
  5   1   2       bld Brn3      in                        CAAK10779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAGATATATAAATATATATATTTTGCCATGACTTCTCACTGTGGATTTCAGCCTTTTCTTTGCTTTAATACAACTGAATGATGAGAGAATGTAGATCTGGGCACATTCCGGACCTTGAGGGCAGCCAGCGCTCCGACCTTATTATAGCTCTTATGTCTAGAGAAATCTCTTTTGTACACAACATTATTTTCCTAACTGTAATAGGCATTTATAGAGTGCTTCAATAGAACTGTTCTACTGTGTAACGATTTGCTATTCAAATAAAATTATTTTCCAATTCAAATCAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)