Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ5367.3.5                         29 END     2          10        6                (no blast hit)
     2   2.0    0Xt7.1-XZG28351.5                            5 END     1           5       25                MGC68512 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012155290 Xt7.1-CABK4836.3.5 - 20 ESTs
                                                                       ........-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABK4836.3.5                                                                                                                                                                                                                                                                                                                                                                       TTGCACCATTTTGGAACCCCAGTTTTTCTTTTTTCTGTGCACTTTTTTCTACAAGTTTGGACCAAAGTAAAAATTGCCTTATAAGTCACTGTTATGCTGTTCTGTGTGATTGTGGAGGTAGCCGCGATGATCTTCAGCTCCCAGCAGCTTCCAACTGCAAATAAGATCAAGTAGAATGAAGAGGCTGACATATCTGCTGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAGGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCAGAGTTGCAGTTTATGGCATTGGCATTTCGCACTTAGGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAAAAAAACTGTGTATGTTAGAGCCCTAAGCATGTACTTACTAAATAAAGTACATACTGTATGTCAAGCCTACCCATAATGACAATTGAGCAATTTTGGGAGACATTTTTGAGGGAATTTAATAAAAACCTTAAAAAAAAAATGCTTAAATTTGGACAAAAATTCTGTTAATGATTTTTATTAGATTCTTATATTAGTCACCAAGGTTTTTTGTTGTTTTAAAATTATAGTGACTTGTAACCCTGCTTTACGCTATTGCCAGGAGCAAATGGGCAGTGCCAAACCTACAGATAAGCTGCAGGCAAAACACTAATAAGGCAGATTTATCAAAATTACAATACATCATTTTTTTGAAGAACAGAATGTGATTTCACTGAATTTGAGTTGTTTTCTCACAATTTTAAGTTTTCAAGTTTCAAGTTCTTACATGGATAAACGAACATTCGAGATTTAAAAAAAATTATTAAAATTCAAATTTGATGTTTTTTTTCATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATGCTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAAGGGTAGAACTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCAAATTTGAAATTTGTCTCAAAATCATCGTTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCTGTGAAAACCGTGAATCATTGTAAAAAAAAAAATGGAATGTTGATAAATCTGTAAAATTCAGGCATTTTTCAACAACACACCTCTCATACACGGCACACCTTTCAGTTAACTTAAAGCTCTATGGCATGTTTTTGGAAAAAAGGTGATCATTTATACTGATTAGTAATTCAGGGTAAAGTCATGCTCAAATATACATATTTGGACTAAATCAACAACAGGTCCTTTATTTTTCCTGTGCATGTCCATTTATGCGGTGTCCATGTAGAGGACTGTTACGCAATCTTTATTATTGCCAAAACAAAGCATTTTCCGGAAATGCCCTTTTCCGAATAGTGAATAATACTAACTGGCTTCCCTAGACAGGTACATTTTGGTAACCAAAGCAAAGCAAACAAATACCACACTAACTGCAAGGTTCACCCTTGTGTGACTGAGGTGGGTTAAAGCCATACTTCATGGTTGTGGACACACCTCACTCTGTATGCATTAGCATGCAAAGTTGGCTGCACCTGGGGCCATATGTATATGCTTATGCTACTAGAGGAAAGAAACCTCTGGAACAGGGAATGGACTTTGTGCGGATGTGCAGGGGTTAAACTCAGGCATTTTCTCTATGCAGATTTGATGGTCAATAGAAATGAATGTTATCTGTGCTGGAATGTTTGGCTTCTTTTCAGTTCTCTGAAAAATATGTTTTATATTGTATTTAATATGTTTGTATGGTACTACTTTATATAATGCTGAAGGATTTTAATAGGAAATTAGAAGCTATTTTTTCCATATGTACTAATTTTATATGCTGTAATGTAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCTCAACAT
                                                  Xt7.1-CHK-1008267240                                                                                                                                                                                                                                                                                                                                                                             CATTTTGGAACCCCAGTTTxTxTTTTTTCTGTGCACTTTTTTCTACAAGTTTGGACCAAAGTAAAAATTGCCTTATAAGTCACTGTTATGCTGTTCTGTGTGATTGTGGAGGTAGCCGCGATGATCTTCAGCTCCCAGCAGCTTCCAACTGCAAATAAGATCAAGTAGAATGAAGAGGCTGACATATCTGCTGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAGGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCAGAGTTGCAGTTTATGGCATTGGCATTTCGCACTTAGGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAAAAAAACTGTGTATGTTAGAGCCCTAAGCATGTACTTACTAAATAAAGTACATACTGTATGTCAAGCCTACCCATAATGACAATTGAGCAATTTTGGGAGACATTTTTGAGGGAATTTAATAAAAACCTTAAAAAAAAAATGCTTAAATTTGGACAAAAATTCTGTTAATGATTTTTATTAGATTCTTATATTAGTCACCAAGGTTTTTTGTTGTTTTAAAATTATAGTGACTTGTAACCCTGCTTTACGCTATTGCCAGGAGCAAATGGGCAGTGCCAAACCTACAGATAAGCTGCAGGCAAAACACTAATAAGGCAGATTTATCAAAATTACAATACATCATTTTTTTGAAGAACAGAATGTGATTTCACTGAATTTGAGTTGTTTTCTCACAATTTTAAGTTTTCAAGTTTCAAGTTCTTACATGGATAAACGAACATTCGAGATTTAAAAAAAATTATTAAAATTCAAATTTGATGTTTTTTTTCATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATGCTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAAGGGTAGAACTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCAAATTTGAAATTTGTCTCAAAATCATCGTTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCTGTGAAAACCGTGAATCATTGTAAAAAAAAATATGGAATGTTGATAAATCTGTAAAATTCAGGCATTTTTCAACAACACACCTCTCATACACGGCACACCTTTCAGTTAACTTAAAGCTCTATGGCATGTTTTTGGAAAAAAGGTGATCATTTATACTGATTAGTAATTCAGGGTAAAGTCATGCTCAAATATACATATTTGGACTAAATCAACAACAGGTCCTTTATTTTTCCTGTGCATGTCCATTTATGCGGTGTCCATGTAGAGGACTGTTACGCAATCTTTATTATTGCCAAAACAAAGCATTTTCCGGAAATGCCCTTTTCCGAATAGTGAATAATACTAACTGGCTTCCCTAGACAGGTACATTTTGGTAACCAAAGCAAAGCAAACAAATACCACACTAACTGCAAGGTTCACCCTTGTGTGACTGAGGTGGGTTAAAGCCATACTTCATGGTTGTGGACACACCTCACTCTGTATGCATTAGCATGCAAAGTTGGCTGCACCTGGGGCCATATGTATATGCTTATGCTACTAGAGGAAAGAAACCTCTGGAACAGGGAATGGACTTTGTGCGGATGTGCAGGGGTTAAACTCAGGCATTTTCTCTATGCAGATTTGATGGTCAATAGAAATGAATGTTATCTGTGCTGGAATGTTTGGCTTCTTTTCAGTTCTCTGAAAAATATGTTTTATATTGTATTTAATATGTTTGTATGGTACTACTTTATATAATGCTGAAGGATTTTAATAGGAAATTAGAAGCTATTTTTTCCATATGTACTAATTTTATATGCTGTAATGTAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                            2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     1     2     1     2     1     2     1     2     1     2     2     2     1     2     1     3     3     3     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     4     4     5     4     5     4     5     4     5     4     5     4     5     5     5     7     7     7     7     8     8     8     8     8     8     8     9     8     9     8     9     8     9     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     8    10     9    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     8    10     9    10     8     9     8     9     7     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     8     9     8     9     7     9     7     9     5     8     5     6     4     6     4     5     4     5     3     5
  5   1   2       e50                                 Xt7.1-CABC9315.5 AGCTACATTTTTTATTTTTGCTGGTGAGCACCACCAATTAGCTAGTCTGGCCAGTTAAAGTATAGGAATAAGAGCAAAAAATCCCAGTATGCATATACTTTGCAGATCAGTCAGCCAGACAGATAAGGAAGATTGCTTTTAGAGAAGGTTTTTCCCTTTGTCAGAATTACCTGGTTATATTTTTTGAAGACACTGTCCCTCTAAAAATAAGCATTTGCCTAGTTCTTATACAGTCCAGACTAGTAGGTCCTGGCATTTCATATACAGGCTCAAAACAGCCCCCGCCCCCACCTATGGAATCTTACAGTAGCCCCTCTGCCATTTTCCAGTATCCAAATTGCCAGTCTGGAACTGGTTCTTGCACCATTTTGGAACCCCAGTTTCTCTTTTTTCTGTGCACTTTTTTCTACAAGTTTGGACCAAAGTAAAAATTGCCTTATAAGTCACTGTTATGCTGTTCTGTGTGATTGTGGAGGTAGCCGCGATGATCTTCAGCTCCCAGCAGCTTCCAACTGCAAATAAGATCAAGTAGAATGAAGAGGCTGACATATCTGCTGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAGGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCAGAGTTGCAGTTTATGGCATTGGCATTTCGCACTTAGGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAAAAAAACTGTGTATGTTAGAGCCCTAAGCATGTACTTACTAAATAAAGTACATACTGTATGTCAAGCCTACCCATAATGACAATTGAGCAATTTTGGGAGACATTTTTGAGGGAATTTAATAAAAACCTTAAAAAAAAAATGCTTAAATTTGGACAAAAATTCTGTTAATGATTTTTATTAGATTCTTATATTAGTCACCAAGGTTTTTTGTTGTTTTAAAATTATAGTGACTTGTAACCCTGCTTTACGCTATTGCCAGGAGCAAATGGGCAGTGCCAAACCTACAGATAAGCTGCAGGCAAAACACTAATAAGGCAGATTTATCAAAATTACAATACATCATTTTTTTGAAGAACAGAATGTGATTTCACTGAATTTGAGTTGTTTTCTCACAATTTTAAGTTTTCAAGTTTCAAGTTCTTACATGGATAAACGAACATTCGAGATTTAAAAAAAATTATTAAAATTCAAATTTGATGTTTTTTTTCATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATACTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAGGGGTAGAACTCTGAAGATGTTTCATTTTTATT
  5   1   2      ests                                 Xt7.1-CABK4836.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATGCTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAAGGGTAGAACTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCAAATTTGAAATTTGTCTCAAAATCATCGTTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCTGTGAAAACCGTGAATCATTGTAAAAAAAAAAATGGAATGTTGATAAATCTGTAAAATTCAGGCATTTTTCAACAACACACCTCTCATACACGGCACACCTTTCAGTTAACTTAAAGCTCTATGGCATGTTTTTGGAAAAAAGGTGATCATTTATACTGATTAGTAATTCAGGGTAAAGTCATGCTCAAATATACATATTTGGACTAAATCAACAACAGGTCCTTTATTTTTCCTGTGCATGTCCATTTATGCGGTGTCCATGTAGAGGACTGTTACGCAATCTTTATTATTGCCAAAACAAAGCATTTTCCGGAAATGCCCTTTTCCGAATAGTGAATAATACTAACTGGCTTCCCTAGACAGGTACATTTTGGTAACCAAAGCAAAGCAAACAAATACCACACTAACTGCAAGGTTCACCCTTGTGTGAC
  5   1   2      ests                                 Xt7.1-CABK4836.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCTGCACCTGGGGCCATATGTATATGCTTATGCTACTAGAGGAAAGAAACCTCTGGAACAGGGAATGGACTTTGTGCGGATGTGCAGGGGTTAAACTCAGGCATTTTCTCTATGCAGATTTGATGGTCAATAGAAATGAATGTTATCTGTGCTGGAATGTTTGGCTTCTTTTCAGTTCTCTGAAAAATATGTTTTATATTGTATTTAATATGTTTGTATGGTACTACTTTATATAATGCTGAAGGATTTTAATAGGAAATTAGAAGCTATTTTTTCCATATGTACTAATTTTATATGCTGTAATGTAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCTC
                                                    Xt7.1-CABK4836.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAA------------TGA------TGA------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------ATG------------------------------------------TAATGA---------------------------TGA---------------------------------------------------------------------TAG------------------------------------------------------------------------------------ATG---------------------------------------TAATAA---------------------------------------------------------------------------------------------------------------ATG---------------------TAA------------------------------------------------------TAA------------------------------------------------------------TGA---------------TAA---------------ATG------TAG---TAATAATAA---------------TGA------------------------------------------------------------------------------------------------------------------------------TGAATG---------------------------------------------------------------------------------------------------TAA---------------------------------------------ATG------------TAA---------------------------------------------------------TAA------ATG---------------------------------TGA---------------------ATG---------------------TAA------------------------------------------------------------------------------------------------------------ATG------------TAGTGA---------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------ATG---ATG---ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------ATG---------------------TAA---TGA------------------TAG---------------------------------------ATGTAG------------------------------------------------TAA---------------------------------------------------------------------------------TAA------------------------------TAA---TGA------------------TGA---------------------------------------------------------------------------------TGA---------------------------------------------------------------------ATG------------ATG------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------TAA---------------------------------------------------------------TAATAG---------TAG---------------------------------ATG------------------------------------------------------------------TGA---------------------------------------TAA---------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                   ]
  5   1   2       e50                                 Xt7.1-CABC9315.5 AGCTACATTTTTTATTTTTGCTGGTGAGCACCACCAATTAGCTAGTCTGGCCAGTTAAAGTATAGGAATAAGAGCAAAAAATCCCAGTATGCATATACTTTGCAGATCAGTCAGCCAGACAGATAAGGAAGATTGCTTTTAGAGAAGGTTTTTCCCTTTGTCAGAATTACCTGGTTATATTTTTTGAAGACACTGTCCCTCTAAAAATAAGCATTTGCCTAGTTCTTATACAGTCCAGACTAGTAGGTCCTGGCATTTCATATACAGGCTCAAAACAGCCCCCGCCCCCACCTATGGAATCTTACAGTAGCCCCTCTGCCATTTTCCAGTATCCAAATTGCCAGTCTGGAACTGGTTCTTGCACCATTTTGGAACCCCAGTTTCTCTTTTTTCTGTGCACTTTTTTCTACAAGTTTGGACCAAAGTAAAAATTGCCTTATAAGTCACTGTTATGCTGTTCTGTGTGATTGTGGAGGTAGCCGCGATGATCTTCAGCTCCCAGCAGCTTCCAACTGCAAATAAGATCAAGTAGAATGAAGAGGCTGACATATCTGCTGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAGGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCAGAGTTGCAGTTTATGGCATTGGCATTTCGCACTTAGGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAAAAAAACTGTGTATGTTAGAGCCCTAAGCATGTACTTACTAAATAAAGTACATACTGTATGTCAAGCCTACCCATAATGACAATTGAGCAATTTTGGGAGACATTTTTGAGGGAATTTAATAAAAACCTTAAAAAAAAAATGCTTAAATTTGGACAAAAATTCTGTTAATGATTTTTATTAGATTCTTATATTAGTCACCAAGGTTTTTTGTTGTTTTAAAATTATAGTGACTTGTAACCCTGCTTTACGCTATTGCCAGGAGCAAATGGGCAGTGCCAAACCTACAGATAAGCTGCAGGCAAAACACTAATAAGGCAGATTTATCAAAATTACAATACATCATTTTTTTGAAGAACAGAATGTGATTTCACTGAATTTGAGTTGTTTTCTCACAATTTTAAGTTTTCAAGTTTCAAGTTCTTACATGGATAAACGAACATTCGAGATTTAAAAAAAATTATTAAAATTCAAATTTGATGTTTTTTTTCATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATACTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAGGGGTAGAACTCTGAAGATGTTTCATTTTTATT
                                                  Xt7.1-CHK-1008246451       ATTTTTTATTTTTGCTGGTGAGCACCACCAATTAGCTAGTCTGGCCAGTTAAAGTATAGGAATAAGAGCAAAAAATCCCAGTATGCATATACTTTGCAGATCAGTCAGCCAGACAGATAAGGAAGATTGCTTTTAGAGAAGGTTTTTCCCTTTGTCAGAATTACCTGGTTATATTTTTTGAAGACACTGTCCCTCTAAAAATAAGCATTTGCCTAGTTCTTATACAGTCCAGACTAGTAGGTCCTGGCATTTCATATACAGGCTCAAAACAGCCCCCGCCCCCACCTATGGAATCTTACAGTAGCCCCTCTGCCATTTTCCAGTATCCAAATTGCCAGTCTGGAACTGxxTxTTGCACCATTTTGGAACCCCAGTTTCTTTTTTTTCTGTGCACTTTTTTCTACAAGTTTGGACCAAAGTAAAAATTGCCTTATAAGTCACTGTTATGCTGTTCTGTGTGATTGTGGAGGTAGCCGCGATGATCTTCAGCTCCCAGCAGCTTCCAACTGCAAATAAGATCAAGTAGAATGAAGAGGCTGACATATCTGCTGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAGGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCAGAGTTGCAGTTTATGGCATTGGCATTTCGCACTTAGGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAAAAAAACTGTGTATGTTAGAGCCCTAAGCATGTACTTACTAAATAAAGTACATACTGTATGTCAAGCCTACCCATAATGACAATTGAGCAATTTTGGGAGACATTTTTGAGGGAATTTAATAAAAACCTTAAAAAAAAAATGCTTAAATTTGGACAAAAATTCTGTTAATGATTTTTATTAGATTCTTATATTAGTCACCAAGGTTTTTTGTTGTTTTAAAATTATAGTGACTTGTAACCCTGCTTTACGCTATTGCCAGGAGCAAATGGGCAGTGCCAAACCTACAGATAAGCTGCAGGCAAAACACTAATAAGGCAGATTTATCAAAATTACAATACATCATTTTTTTGAAGAACAGAATGTGATTTCACTGAATTTGAGTTGTTTTCTCACAATTTTAAGTTTTCAAGTTTCAAGTTCTTACATGGATAAACGAACATTCGAGATTTAAAAAAAATTATTAAAATTCAAATTTGATGTTTTTTTTCATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATACTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAGGGGTAGAACTCTGAAGATGTTTCATT
  3  -1   2       bld Ovi1      in                         CABI6917.3p AGCTACATTTTTTATTTTTGCTGGTGAGCACCACCAATTAGCTAGTCTGGCCAGTTAAAGTATAGGAATAAGAGCAAAAAATCCCAGTATGCATATACTTTGCAGATCAGTCAGCCAGACAGATAAGGAAGATTGCTTTTAGAGAAGGTTTTTCCCTTTGTCAGAATTACCTGGTTATATTTTTTGAAGACACTGTCCCTCTAAAAATAAGCATTTGCCTAGTTCTTATACAGTCCAGACTAGTAGGTCCTGGCATTTCATATACAGGCTCAAAACAGCCCCCGCCCCCACCTATGGAATCTTACAGTAGCCCCTCTGCCATTTTCCAGTATCCAAATTGCCAGTCTGGAACTGGTTCTTTTGCACCATTTTGGAACCCCAGTTTCTTTTTTCTGTGCACTTTTTTCTACAAGTTTGGACCAAAGTAAAAATTGCCTTATAAGTCACTGTTATGCTGTTCTGTGTGATTGTGGAGGTAGCCGCGATGATCTTCAGCTCCCAGCAGCTTCCAACTGCAAATAAGATCAAGTAGAATGAAGAGGCTGACATATCTGCTGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAGGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCAGAGTTGCAGTTTATGGCATTGGCATTTCGCACTTAGGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAN
  5   1   2       bld TbA       in                   TTbA033c10.p1kSP6                                                                                                                                                                                                                                                                                                           CTTACAGTAGCCCCTCTGCCATTTTCCAATATCCAAATTGCCAGTCTGGAACTGGTTCTTTTGCACCATTTTGGAACCCCAGTTTCTTTTTTCTGTGCACTTTTTTCTACAAGTTTGGACCAAAGTAAAAATTGCCTTATAAGTCACTGTTATGCTGTTCTGTGTGATTGTGGAGGTAGCCGCGATGATCTTCAGCTCCCAGCAGCTTCCAACTGCAAATAAGATCAAGTAAAATGAAGAGGCTGACATATCATGCTCGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAGGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCAGAGTTGCAGTTTATGGCATTGGCATTTCGCACTTAAGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAAAAAAACTGTGTATGTTAGAGCCCTAAGCATGTACTTACTAAATAAAGTACATACTGTATGTCAAGCCTACCCATAATGACAATTGAGCAATTTTGGGAGACATTTTTGAGGGAATTTAATAAAAACCTTAAAAAAAAAATGCTTAAATTTGGACAAAAATTCTGTTAATGATTTTTATTAGATTCTTATATTAGTCACCAAGGTTTTTTGTTGTTTTAAAATTATAGTGACTTGTAACCCTGCTTTACGCTATTGCCAGGAGCAAATGGGCAGTGCCAAACCTACAGATAAGCTGCAGGCAAAACACTAATAAGGCAGATTTATCAAAATTACAATACATCATTTTTTTAAAGAACAGAATGTGATTTCACTGAATTTGAGTTGTTTT
  5   1   2       bld Neu0      out                    NISC_ng03f08.y1                                                                                                                                                                                                                                                                                                                                                                GGTTCTTTTGCACCATTTTGGAACCCCAGTTTCTTTTTTTTCTGTGCACTTTTTTCTACAAGTTTGGACCAAAGTAAAAATTGCCTTATAAGTCACTGTTATGCTGTTCTGTGTGATTGTGGAGGTAGCCGCGATGATCTTCAGCTCCCAGCAGCTTCCAACTGCAAATAAGATCAAGTAGAATGAAGAGGCTGACATATCTGCTGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAAGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCACAGTTGCAGATTATGGCATTGGCATTTGGCACTTAGGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAAAAAAACTGTGTATGTTAGAGCCCTAAGCATGTACTTACTAAATAAAGTACATACTGTATGTCAAGCCTACCCATAATGACAATTGAGCAATTTTGGGAGACATTTTTGAGGGAATTTAATAAAAACCTTAAAAAAAAAATGCTTAAATTTGGACAAAAATTCTGTTAATGATTTTTATTACATTCTTATATTAGTCACCAAGGTTTTTTGCTGTTT
  5   1   2      seed Fat1      in                         CABC9315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAATAAGATCAAGTAGAATGAAGAGGCTGACATATCTGCTGTCTTACACACAGGCCTTTTTATGCATTTATCGCAGGTTTGAGATGCAGGTTTGAGTGCACCTAAACACATCAGCTATTTGATTCCATTATATTCTGCCTGGTTGTACTCAGTGTTCAGAGTTGCAGTTTATGGCATTGGCATTTCGCACTTAGGTGTGTTTTGATGCACTTAGCATGCATTAAAAAATGTATGAAAAAAACTGTGTATGTTAGAGCCCTAAGCATGTACTTACTAAATAAAGTACATACTGTATGTCAAGCCTACCCATAATGACAATTGAGCAATTTTGGGAGACATTTTTGAGGGAATTTAATAAAAACCTTAAAAAAAAAATGCTTAAATTTGGACAAAAATTCTGTTAATGATTTTTATTAGATTCTTATATTAGTCACCAAGGTTTTTTGTTGTTTTAAAATTATAGTGACTTGTAACCCTGCTTTACGCTATTGCCAGGAGCAAATGGGCAGTGCCAAACCTACAGATAAGCTGCAGGCAAAACACTAATAAGGCAGATTTATCAAAATTACAATACATCATTTTTTTGAAGAACAGAATGTGATTTCACTGAATTTGAGTTGTTTTCTCACAATTTTAAGTTTTCAAGTTTCAAGTTCTTACATGGATAAACGAACATTCGAGATTTAAAAAAAATTATTAAAATTCAAATTTGATGTTTTTTTTCATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATACTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAGGGGTAGAACTCTGAAGATGTTTCATTTTTATTTG
  5   1   2      ests                                 Xt7.1-CABK4836.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATGCTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAAGGGTAGAACTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCAAATTTGAAATTTGTCTCAAAATCATCGTTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCTGTGAAAACCGTGAATCATTGTAAAAAAAAAAATGGAATGTTGATAAATCTGTAAAATTCAGGCATTTTTCAACAACACACCTCTCATACACGGCACACCTTTCAGTTAACTTAAAGCTCTATGGCATGTTTTTGGAAAAAAGGTGATCATTTATACTGATTAGTAATTCAGGGTAAAGTCATGCTCAAATATACATATTTGGACTAAATCAACAACAGGTCCTTTATTTTTCCTGTGCATGTCCATTTATGCGGTGTCCATGTAGAGGACTGTTACGCAATCTTTATTATTGCCAAAACAAAGCATTTTCCGGAAATGCCCTTTTCCGAATAGTGAATAATACTAACTGGCTTCCCTAGACAGGTACATTTTGGTAACCAAAGCAAAGCAAACAAATACCACACTAACTGCAAGGTTCACCCTTGTGTGAC
                                                  Xt7.1-CHK-1008243208                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATGCTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAAGGGTAGAACTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCAAATTTGAAATTTGTCTCAAAATCATCGTTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCTGTGAAAACCGTGAATCATTGTAAAAAAAAAAATGGAATGTTGATAAATCTGTAAAATTCAGGCATTTTTCAACAACACACCTCTCATACACGGCACACCTTTCAGTTAACTTAAAGCTCTATGGCATGTTTTTGGAAAAAAGGTGATCATTTATACTGATTAGTAATTCAGGGTAAAGTCATGCTCAAATATACATATTTGGACTAAATCAACAACAGGTCCTTTATTTTTCCTGTGCATGTCCATTTATGCGGTGTCCATGTAGAGGACTGTTACGCAATCTTTATTATTGCCAAAACAAAGCATTTTCCGGAAATGCCCTTTTCCGAATAGTGAATAATACTAACTGGCTTCCCTAGACAGGTACATTTTGGTAACCAAAGCAAAGCAAACAAATACCACACTAACTGCAAGGTTCACCCTTG
  5   1   2       bld Egg       in                   TEgg032g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGGGCCCGGGGCTGAATTTGAGTTGTTTTCTCACAATTTTAAGTTTTCAAGTTTCAAGTTCTTACATAAATAAACGAACATTCGAGATTTAAAAAAAATTATTAAAATTCAAATTTGATGTTTTTTTTATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATGCTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAAGGGTAGAACTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCAAATTTGAAATTTGTCTCAAAATCATCGTTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCTGTGAAAACCGTGAATCATTGTAAAAAAAAATGGAATGTTGATAAATCTGTAAAATTCAGGCATTTTTCAACAACACACCTCTCATACACGGCACACCTT
  5   1   2      seed Spl1      in                         CABK4836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCGATTCGGTTTTTTTTCATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTGTCCATTTTAGCATACTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAAGGGTAGAACTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCAAATTTGAAATTTGTCTCAAAATCATCGTTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCTGTGAAAACCGTGAATCATTGTAAAAAAAAAAATGGAATGTTGATAAATCTGTAAAATTCAGGCATTTTTCAACAACACACCTCTCATACACGGCACACCTTTCAGTTAACTTAAAGCTCTATGGCATGTTTTTGGAAAAAAGGTGATCATTTATACTGATTAGTAATTCAGGGTAAAGTCATGCTCAAATATACATATTTGGACTAAATCAACAACAGGTCCTTTATTTTTCCTGTGCATGTCCATTTATGCGGTGTCCATGTAGAGGACTGTTACGCAATCTTTATTATTGCCAAAACAAAGCATTTTCCGGAAATGCCCTTTTCCGAATAGTGAATAATACTAACTGGCTTCCCTAGACAGGTACATTTTGGTAACCAAAGCAAAGCAAACAAATACCACACTAACTGCAAGGGTCACCCTTGTGTGACTG
  5   1   2       bld TbA       out                  TTbA011h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTATCTGCCTCTTTGTCCCTAAAAATCTATATCTTGGGCAATAAAGCTCTTTTTTGTCCATTAGCATGCTGTGCTAAGGAATGAACTAAGGGAAAGAACTAAAAGCTTCGTAAATTGATGGCGCTATAGAAATAATAATAACTAAGGGTAGAACTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCAAATTTGAAATTTGTCTCAAAATCATCGTTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCTGTGAAAACCGTGAATCATTGTAAAAAAAAATGGA
  5   1   2       add Fat1      in                         CABC1618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTCACAGCAAACAATTATACATTTGGTTTCTGGAAGCTTGAATATTTGCTATTTATTAAACAAAAAATTTGAATAATAAACGATGATTCTGAGATTGTTTCATTTTTATTTGCTCTCCTTTTTATGCCTTTCAGTCAGGACTCAAATTTCAAGTGTGTGCTTATTTATGTGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCGTCATATTGAAAGAATTTGGCAAATTTGAAATGTGTCTCAAAATCACCGGTTATTATTCAAATTTTTTGTTTAAT
  5   1   2      skin HdA       out                  THdA003c18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAAGGAGACCATTCAAATTCAGTGAAATCTTATTTTACCCTTCATATTGAATGAGTTTGGCTGATTTGATATTGGTCTCAAAATCAACATTTATTATTCAAATTTTTTGTTTAATAAATAGCAAATATTCAAGCTTCCAGAAACCAAATGTATAATTGTTTGCATGTGAAAACCGTGAATCATTGTAAAAAAAAATGGAATGTTGATAAATCTGTAAAATTCAGGCATTTTTCAACAACACACCTCTCATACACGGCACACCTTTCAGTTAACTTAAAGCTCTATGGCATGTTTTTGGAAAAAAGGTGATCATTTATACTGATTAGTAATTCAGGGTAAAGTCATGCTCAAATATACATATTTGGACTAAATCAACAACAGGTCCTTTATTTTTCCTGTGCATGTCCATTTATGCGGTGTCCATGTAGAGGACTGTTACGCAATCTTTATTATTGCCAAAACAAAGCATTTTCCGGAAATGCCCTTTTCCGAATAGTGAATAATACTAACTGGCTTCCCTAGACAGGTACATTTTGGTAACCAAAGCAAAGCAAACAAATACCACACTAACTGCAAGGTTCACCCTTGTGTGACTGAGGTGGGTTAAAGCCATACTTCATGGTTGTGGACACACCTCACTCTGTATGCATTAGCATGCAAAGTTGGCTGCACCTGNGGCCATATGTATATGCTTATGCTACT
  5   1   2      ests                                 Xt7.1-CABK4836.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCTGCACCTGGGGCCATATGTATATGCTTATGCTACTAGAGGAAAGAAACCTCTGGAACAGGGAATGGACTTTGTGCGGATGTGCAGGGGTTAAACTCAGGCATTTTCTCTATGCAGATTTGATGGTCAATAGAAATGAATGTTATCTGTGCTGGAATGTTTGGCTTCTTTTCAGTTCTCTGAAAAATATGTTTTATATTGTATTTAATATGTTTGTATGGTACTACTTTATATAATGCTGAAGGATTTTAATAGGAAATTAGAAGCTATTTTTTCCATATGTACTAATTTTATATGCTGTAATGTAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCTC
                                                  Xt7.1-CHK-1008235068                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACCTGGGGCCATATGTATATGCTTATGCTACTAGAGGAAAGAAACCTCTGGAACAGGGAATGGACTTTGTGCGGATGTGCAGGGGTTAAACTCAGGCATTTTCTCTATGCAGATTTGATGGTCAATAGAAATGAATGTTATCTGTGCTGGAATGTTTGGCTTCTTTTCAGTTCTCTGAAAAATATGTTTTATATTGTATTTAATATGTTTGTATGGTACTACTTTATATAATGCTGAAGGATTTTAATAGGAAATTAGAAGCTATTTTTTCCATATGTACTAATTTTATATGCTGTAATGTAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCTCAACATA
  5   1   2       bld Egg       in                   TEgg059i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAACTGCAAGGTTCACCCTTGTGTGACTGAGGTGGGTTAAAGCCATACTTCATGGTTGTGGACACACCTCACTCTGTATGCATTAGCATGCAAAGTTGGCTGCACCTGGGGCCATATGTATATGCTTATGCTACTAGAGGAAAGAAACCTCTGGAACAGGGAATGGACTTTGTGCGGATGTGCAGGGGTTAAACTCAGGCATTTTCTCTATGCAGATTTGATGGTCAATAGAAATGAATGTTATCTGTGCTGGAATGTTTGGCTTCTTTTCAGTTCTCTGAAAAATATGTTTTATATTGTATTTAATATGTTTGTATGGTACTACTTTATATAATGCTGAAGGATTTTAATAGGAAATTAGAAGCTATTTTTTCCATATGTACTAATTTTATATGCTGTAATGTAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTACACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTG
  5   1   2       bld Lun1      in                         CABD1956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCTGCACCTGGGGCCATATGTATATGCTTATGCTACTAGAGGAAAGAAACCTCTGGAACAGGGAATGGACTTTGTGCGGATGTGCAGGGGTTAAACTCAGGCATTTTCTCTATGCAGATTTGATGGTCAATAGAAATGAATGTTATCTGTGCTGGAATGTTTGGCTACTTTTCAGTTCTCTGAAAAATATGTTTTATATTGTATTTAATATGTTTGTATGGTACTACTTTATATAATGCTGAAGGATTTTAATAGGAAATTAGAAGCTATTTGTTCCATATGTACTAATTTTATATGCTGTAATGTAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCANGCTGCTGCAATTTTCAGCGAACAG
  3   1   2       bld Spl1      in                         CABK4836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTACTAATTTTATATGCTGTAATGTAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGC
  3   1   2       bld Egg       in                    TEgg059i13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGCTTCTATGTGCTGAAGAATGGATACAGATTTTAAATGAAAGCTTCTCATAATGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTTACTAGAAAAGATATTTACACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCCTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAGTGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGAAGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTTTGCTTTAAGTGTACCCCCGTGCCAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTAACTCCAGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGCATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTGTGCATGTTTTATTTTCATATAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                         CABC1618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGATACAGATTTTAAATGAAAGCTTCTCATATNGCAGAGCAATTGTAGCGCTGCTGGGAAATAACCACTTTACTAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCNCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCATATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTNGCAAAAAAAAGCCTCTCG
  3   1   2      seed Lun1      in                         CABD1956.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCTCAACATATAATATTTTTTCAGAAT
  3   1   2       bld Fat1      in                         CABC9315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAAAGATATTTTCACGTCGATAATTCCTTTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCTCAACCT
  5  -1   2       bld Ovi1      in                         CABI6917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATGGCTCTAATACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTAGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCTCAACATAT
  3   1   2       chi Egg       in                    TEgg032g17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACAGCAGTGGAAGCCCCTGTGATAGCCATTAAACCTGAGTTTTCAGCATCCAACCATGACTANGTATATAGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCTTGTGCCAACACTCCACCCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCGCAGTGATTATACTTGCTTACCTGCACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCCAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTAACTCCAGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGCATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTGTGCATGTTTTATTTTCATATTACACAGAGAGTTATGTACTGCTGTTCAGCCATAAAATTATTTCTCGAACATATAATATTTTTCAGAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FLsh out                   TEgg010o17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTGTCAAAAGTGGGTATATTTAAGGGTAGTAATATTGGCTGAACAAAGTGCTGGGGAAGTTGAGTGGGACTGACATCTGCCTGTGCCAACACTCCACCCAGCTGACAACACTAAGGTTAAAGATGAAGGAAAGGTATATCCCATGGCTGGTATCAAAATGTTAGGGCCCACCTCCCAATGATTATACTTGCTTACCTTTACCGGCTTAGGGTACTACTGCAGGATTTCCACTATACAGTACACATGTACTGGCCTGGGGCTGCATCAAAGAAGTGGAAGAAGTGCTGCAGATGTACCCCAGGCTGCTGCAATTTTCAGCGAACAGAAGCACTGGGCTGTCAGATGAAAAAATTATGATCATTGCGGAGTGTCCCCCAAAATAATTATACTTTTTCTGCTTTAAGTGTACCCCCGTGCTAGCCAGACACAGGATGCTGATAACACAAAAGGTGGCTGGTATAGGAACTAATAGCTGTATGTTTAGATTGTCTTGTTGTTTTTTAACTCCGGGAATGTCATGAAAGTTTTTCTCCAGCTGCTGTTGAATTACAATTCCTTTAGTCCCTGTATATTACTCCCTGACTGTTGAAAAGAAGTTGGTTGGAGAACCCCACTTAAATATGAAAAATAAAATGTTTTGTATGCATGTTTTATTTTCATATTAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA033c10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGGTTAAAGATGAAGGAAAGGTTTTTTCCCTGGCTGGTATCAAAAAGTTAGGGCCCCCCTCCCAATGATTTTACTTGGTTACCTTTTCCGGCTTAGGGTAATATTGCAGGATTTCCCCTTTACAGTACACATGTTCTGGCCTGGGGGTGCATCAAAGAAGTGGAAGAAGTTTTGCAGATGTTCCCCAGGGTGGTGCAATTTTTAGCGAACAGAAGCACTGGGGTGTTTGTTGAAAAAATTTTGATCCTTGCGGGGTGTCCCCCAAAAAAATTATATTTTTTTTGCTTTAAGTGTACCCCCGTGCTCGCCAGACACAGGTTGTTGATTACCCAAAAGGTGGCTGGTTTAGGAACTAATAGCTGTATGTTTAGATTGTTTTGTTGTTTTTTAACTCCGGGAAAGTCATGAAAGTTTTTTTCCAGCAGCGGTTGAATTACAATTCCTTTAGTCCCTGGATATTACTCCCTGACTTTTGAAAAGAAGTTGGTTGGGGAACCCCCCTTATAATATGAAAAATAAAATGTTTGGTTTGCAGGTTTTATTTTCTTATTACCCAGGGAGTTATGTTTTGCTGTTTAGCCTTAAAATTATTTTTCAGCATTTTAATATTTTTTCGGGATTAAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)