Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAR11043.5                          77 END     2           5        2                Unknown (protein for IMAGE:4724622) [Xenopus laevis]
     2   2.0    0Xt7.1-CAAM2991.3                           27 END     1           2        3                chromodomain helicase DNA binding protein 9 [Homo sapiens]
     3   1.0    0Xt7.1-st8i18.5                             19 END     8          22       44                Unknown (protein for MGC:154762) [Xenopus laevis]
     4   2.0    0Xt7.1-CAAJ14366.5                           9 END     1           2       11                chromodomain helicase DNA binding protein 8 [Mus musculus]
     5   2.0    0Xt7.1-TEgg038b19.3                          6 END     1           2       16                chromodomain helicase DNA binding protein 7 [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012155340 Xt7.1-st14h01.3.5 - 35 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-st14h01.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGATTAGTTAATAATACAGGGATGAATCAGAATTTAGGCCTTACAAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTTAATGAACACAGAAGATTTCTTGCCATCCATGCAGTCCCAGACACCACAAAAGAAAAGGAAGAAAAAAAACAACCACATTGCTACTGATAAAACTGTTGGAGGGTTTGGGCTGGAAGGTTTCCCTGGGGAAAACTCTGACCTCTTAATTGACGGAGCACCAGATGGAAAGAAAAAGAAAAAGCCTAAAGTCAAAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAGAAAAAAGTTAATAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTGAAGAATTTGAGAAACTTCAGAGCAGGGAGCCAGAAACAGAGCGCGTGGAGCGACCTCCTGCCGATGACTGGAAGAAATCTGAGAGTTCCAGGGAGTATAAAAATAATAACAGTCTCAGGGAATACCAGTTGGAGGGAGTAAACTGGCTGCTGTTCAATTGGTACAACAAACGAAATTGCATTTTAGCAGATGAAATGGGTTTGGGGAAGACAATTCAGTCGATCACTTTTCTGTATGAGATATACTTAAAGGGAATTCATGGGCCCTTTTTGGTCATTGCTCCACTGTCAACAATCCCAAACTGGGAAAGGGAGTTTCGCACTTGGACAGAGTTGAATGTGGTCGTTTATCATGGGAGTCAAGCAAGCAGGAAAACTATACAACTTTATGAAATGTACTTCAAGGATCCACAGGGAAAAATTATAAAAGGGGCTTATAAGTTTCATGCGATCATTACAACATTTGAAATGATTTTAACGGACTGCCCCGAGCTCAGGAACATCCATTGGCGATGTGTGGTTATTGATGAGGCTCATCGACTGAAGAACAGAAACTGTAAACTTTTGGAAGGCCTGAAGATGATGGATCTGGAGCACAAAGTACTGCTAACAGGAACTCCTTTACAAAACACCGTGGAGGAGCTTTTTAGTCTGCTTAACTTTTTGGAACCAGACCGTTTTCCTTCAGAGAGCAATTTCATGCAAGAATTTGGAGATTTGAAAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAGAAATCGAAGACCTGCTGCGTAAAGGTGCTTATGGAGCACTGATGGATGAAGAAGATGAAGGCTCCAAATTCTGTGAAGAAGATATTGATCAAATTCTCTCTCGTCGCACTCATACAATAACAATAGAGTCTGAAGGAAAGGGGTCTACGTTTGCGAAGGCTAGTTTTGTTGCATCTGGAAACAGGACAGACATTTCTCTGGATGATCCCAATTTCTGGCAAAAATGGGCAAAGAAAGCTGAACTGGATCTTGATGTACTAA
                                                  Xt7.1-CHK-1008266978                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGTTAATAATACAGGGATGAATCAGAATTTAGGCCTTACAAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTTAATGAACACAGAAGATTTCTTGCCATCCATGCAGTCCCAGACACCACAAAAGAAAAGGAAGAAAAAAAACAACCACATTGCTACTGATAAAACTGTTGGAGGGTTTGGGCTGGAAGGTTTCCCTGGGGAAAACTCTGACCTCTTAATTGACGGAGCACCAGATGGAAAGAAAAAGAAAAAGCCTAAAGTCAAAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAGAAAAAAGTTAATAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTGAAGAATTTGAGAAACTTCAGAGCAGGGAGCCAGAAACAGAGCGCGTGGAGCGACCTCCTGCCGATGACTGGAAGAAATCTGAGAGTTCCAGGGAGTATAAAAATAATAACAGTCTCAGGGAATACCAGTTGGAGGGAGTAAACTGGCTGCTGTTCAATTGGTACAACAAACGAAATTGCATTTTAGCAGATGAAATGGGTTTGGGGAAGACAATTCAGTCGATCACTTTTCTGTATGAGATATACTTAAAGGGAATTCATGGGCCCTTTTTGGTCATTGCTCCACTGTCAACAATCCCAAACTGGGAAAGGGAGTTTCGCACTTGGACAGAGTTGAATGTGGTCGTTTATCATGGGAGTCAAGCAAGCAGGAAAACTATACAACTTTATGAAATGTACTTCAAGGATCCACAGGGAAAAATTATAAAAGGGGCTTATAAGTTTCATGCGATCATTACAACATTTGAAATGATTTTAACGGACTGCCCCGAGCTCAGGAACATCCATTGGCGATGTGTGGTTATTGATGAGGCTCATCGACTGAAGAACAGAAACTGTAAACTTTTGGAAGGCCTGAAGATGATGGATCTGGAGCACAAAGTACTGCTAACAGGAACTCCTTTACAAAACACCGTGGAGGAGCTTTTTAGTCTGCTTAACTTTTTGGAACCAGACCGTTTTCCTTCAGAGAGCAATTTCATGCAAGAATTTGGAGATTTGAAAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAGAAATCGAAGACCTGCTGCGTAAAGGTGCTTATGGAGCACTGATGGATGAAGAAGATGAAGGCTCCAAATTCTGTGAAGAAGATATTGATCAAATTCTCTCTCGTCGCACTCATACAATAACAATAGAGTCTGAAGGAAAGGGGTCTACGTTTGCGAAGGCTAGTTTTGTTGCATCTGGAAACAGGACAGACATTTCTCTGGATGATCCCAATTTCTGGCAAAAATGGGCAAAGAAAGCTGAACTGGATCTTGATGTACTAAATGGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     3     4     4     4     5     5     6     6     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     9     8     9     9    10     9    10     9    10     8    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10     8    11    10    11    10    11    10    11     9    11     9    11    10    11    10    11     9    11     9    11    10    11    10    11    10    12     9    12    10    12     9    12     9    12    10    12    10    12    10    12     9    11     9    11     9    11     9    10     9    10     9    10     9    10     9    10     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     5     5     5     5     4     4     4     4     5     5     5     5     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     5     6     5     6     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     5     5     5     6     6     6     6     6     6     6     6     6     7     6     7     7     8     7     8     6     8     8     9     8     9     7     9     7     9     7     9     8     9     8     9     9    10     9    10     8    10     8    10     8    10     8    10     8    10     8    10     9    10     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8    10     9    10     9    10     8    10     9    10     9    10     9    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    11    10    11    10    11    10    11    10    11    10    11     9    11    10    11    10    11    10    11     9    11     9    11     3     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                                  Xt7.1-st14h01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGATTAGTTAATAATACAGGGATGAATCAGAATTTAGGCCTTACAAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTTAATGAACACAGAAGATTTCTTGCCATCCATGCAGTCCCAGACACCACAAAAGAAAAGGAAGAAAAAAAACAACCACATTGCTACTGATAAAACTGTTGGAGGGTTTGGGCTGGAAGGTTTCCCTGGGGAAAACTCTGACCTCTTAATTGACGGAGCACCAGATGGAAAGAAAAAGAAAAAGCCTAAAGTCAAAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAGAAAAAAGTTAATAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTGAAGAAT
  5   1   2      ests                               Xt7.1-TEgg061h15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAATTGGTACAACAAACGAAATTGCATTTTAGCAGATGAAATGGGTTTGGGGAAGACAATTCAGTCGATCACTTTTCTGTATGAGATATACTTAAAGGGAATTCATGGGCCCTTTTTGGTCATTGCTCCACTGTCAACAATCCCAAACTGGGAAAGGGAGTTTCGCACTTGGACAGAGTTGAATGTGGTCGTTTATCATGGGAGTCAAGCAAGCAGGAAAACTATACAACTTTATGAAATGTACTTCAAGGATCCACAGGGAAAAATTATAAAAGGGGCTTATAAGTTTCATGCGATCATTACAACATTTGAAATGATTTTAACGGACTGCCCCGAGCTCAGGAACATCCATTGGCGATGTGTGGTTATTGATGAGGCTCATCGACTGAAGAACAGAAACTGTAAACTTTTGGAAGGCCTGAAGATGATGGATCTGGAGCACAAAGTACTGCTAACAGGAACTCCTTTACAAAACACCGTGGAGGAGCTTTTTAGTCTGCTTAACTTTTTGGAACCAGACCGTTTTCCTTCAGAGAGCAATTTCATGCAAGAATTTGGAGATTTGAAAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAGAAATCGAAGACCTGCTGCGTAAAGGTGCTTATGGAGCACTGATGGATGAAGAAGATGAAGGCTCCAAATTCTGTGAAGAAGATATTGATCAAATTCTCTCTCGTCGCACTCATACAATAACAATAGAGTCTGAAGGAAAGGGGTCTACGTTTGCGAAGGCTAGTTTTGTTGCATCTGGAAACAGGACAGACATTTCTCTGGATGATCCCAATTTCTGGCAAAAATGGGCAAAGAAAGCTGAACTGGATCTTGATGTACTAAAT
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 5e-112     BAE06719.1 Ci-SWI/SNF [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 4e-138     XP_781410.2 PREDICTED: similar to Chromodomain helicase DNA binding protein 1 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sc ---- 4e-143     NP_011091.1 Sole S. cerevesiae member of CHD gene family containing Chromodomain, Helicasedomain, and DNA-binding domain; Chd1p [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xt ---- 6e-150     AAI33720.1 Unknown (protein for MGC:145363) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 0          NP_491426.1 SNF2 helicase related protein [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Xl ---- 0          AAI28692.1 Unknown (protein for MGC:154762) [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...REMOVED --- Dm ---- 0          NP_523441.1 PROBABLY REMOVED OR REPLACED [Drosophila melanogaster]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Dr ---- 0          XP_697996.1 PREDICTED: similar to chromodomain helicase DNA binding protein 7 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PREDICTED - Mm ---- 0          XP_910521.1 PREDICTED: similar to chromodomain helicase DNA binding protein 7 isoform 2 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   
                                                                                                        PROTEIN --- Gg ---- 0          NP_001071054.1 chromodomain helicase DNA binding protein 7 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Hs ---- 0          NP_060250.2 chromodomain helicase DNA binding protein 7 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-st14h01.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------ATG---------------------------------------------------------------ATG---------------------------------------ATG------------ATG------------------------------------------ATG---------------ATG---------------------------------------------------------ATG---------------------ATG------------------------------------ATG---ATG------------------------------------------------ATG---ATG------------------ATG---------ATG---------------------------------------------------------ATGATG------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  5   1   2      ests                                  Xt7.1-st14h01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGATTAGTTAATAATACAGGGATGAATCAGAATTTAGGCCTTACAAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTTAATGAACACAGAAGATTTCTTGCCATCCATGCAGTCCCAGACACCACAAAAGAAAAGGAAGAAAAAAAACAACCACATTGCTACTGATAAAACTGTTGGAGGGTTTGGGCTGGAAGGTTTCCCTGGGGAAAACTCTGACCTCTTAATTGACGGAGCACCAGATGGAAAGAAAAAGAAAAAGCCTAAAGTCAAAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAGAAAAAAGTTAATAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTGAAGAAT
                                                  Xt7.1-CHK-1008230351                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGTTAATAATACAGGGATGAATCAGAATTTAGGCCTTACAAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTTAATGAACACAGAAGATTTCTTGCCATCCATGCAGTCCCAGACACCACAAAAGAAAAGGAAGAAAAAAAACAACCACATTGCTACTGATAAAACTGTTGGAGGGTTTGGGCTGGAAGGTTTCCCTGGGGAAAACTCTGACCTCTTAATTGACGGAGCACCAGATGGAAAGAAAAAGAAAAAGCCTAAAGTCAAAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAGAAAAAAGTTAATAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTG
  5   1   0       add Neu       in                   TNeu078e09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGGCTCTATGTGGGGACCCAAGGCTGTGCAGGTGCCGGACCAGATACGACCACCTTACCAGCAGCAGTCACAACAGCAGCAACCAGCACCTTCCGGACCCCAAGGTCCTCCTCACCCTCAGCATGTTCAACAGATGGGAAATTATATGGTGCGAGGAGATTTTTCAATGCAACAACATGGTCCACTACAGTCACAAAGGATGAACCAGTTTTCACAAGGGCAAGAGGGTCTTAATCAGGGAAATCCTTTCCTTGGTGCTTCAGGACCAGGTCACTTGTCACATGTGCCCCAGCAAAATCCTAACATGGGATCTTCTCTACGTCATACAGTACAACAGTTTCATCATCACCCTCCCACTACTCTGCATGGGGAATCTGTTGCTCACAGTCCTCGATTTCTCCTAATCCTTCTCAGCAAGGTGCAGTGAGGCCACAGTCCCTTAATTTAATTCTCGTAACCAGACTGTACCTTCACCCACGTTAAACAACTCAGGGCAGTATTCCCGATATCCTTATAGT
  5   1   2       bld Neu                            TNeu015p10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCAGTTTTCACAAGGCAAGAGGTCTTAATCAGGGGAAATCCTTTCCTTGGTGCTTCAGGACCAAGTCACTTGTCACATGTGCCCCACAAAACCTAACATGGGATCTTCTCTACGTCATACAGTACAACAGTTTCATCATCACCCTCCCACTACTCTGCATGGGGAATCTGTTGCTCACAGTCCTCGATTTTCTCCTAATCCTTCTCAGCAGGGTGCAGTGAGGCCACAGTCCCTTAATTTTAATTCTCGTAACCAGACTGTACCTTCACCCACGTTAAACAACTCAAGGCAGTATTCCCGATATCCTTATAGTAACCTTAATCAGGGATTAGTTAATAATACAGGGATGAATCAGAATTTAGGCCTTACAAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAAGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATG
  3   1   2       bld Egg       out                   TEgg016n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAATCAGGGATTAGTTAATAATACAGGGATGAATCAGAATTTAGGCCTTACAAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTTTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTTCTGGAGTTAGCCATGCAGATCCCCAGGCAATTCAAGAAAGGATGATGTTTGGTCAGCAGCATTCTGGTCATCAATTTTTTCAACAGCAAATGGCAAACTGTTAGCCTTATCCAGGTATGCACCATCAGTTTTCACCTCCGTTACATTTTTATTCCCAACCAAGGGCTTTGGTTTATCAGTTCCCTTAGAACCCCCCT
  3   1   2       bld Gas8      out                         st52i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCAGGATTAGTTAATAATACAGGGATGATCAGAATTTAGGCCTTACAAACAACANTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCT
  3   1   2       bld Gas8      out                         st14h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAATACAGGGATGAATCAGNATTTAGGCTTACAAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTTAATGAACACAGAAGATTCTG
  3   1   2       bld Gas8      out                          st8i18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACAACACTCCAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCT
  3   1   2       bld Gas8      out                        st103g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATGACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCNTAGTGGCTCACTTAACCAAATGAACCCACAAANTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCNCCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCNTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTT
  3   1   2      seed Gas8      out                          st4c24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTCCATCTGTACCTAGATACCCAAATGCTGTGGGGTTTCCATCAAATAGTAGTCAAGGACTGATGCACCAGCAACCTATTCATCCTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTT
  3   1   2       bld Gas8      out                         st94n11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGGACTGATGCACCAGCAACCTATTCATCNTAGTGGCTCACTTAACCAAATGAACCCACAAACTATGCATCCTTCACAGCCTCAGGGAACCTATGCTTCTCCACCTCCCATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCT
  3   1   2       bld Egg  FLt3 out                   TEgg049h17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTCACCACTGAAAGCAATGAGTAACCCAGCCGGTACCCCTCCACCACCAAGTTAGGCCTGGCAGTGCTGGGATACCTATGGATGTGGAAAGTTTACCCAAAATATGCCCCATCTTCCNTCCAACTCACCAGCCCCCTGGCAGCATGGGTATGGGGCAAAGGAATATCGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTCTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGCTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTTAATGAACACAGAAGATTTCTTGCCATCCATGCAGTCCCAGACACCACAAAAGAAAAGGAAGAAAAAAAACAACCACATTGCTACTGATAAAACTGTTGGAGGGTTTGGGCTGGAAGGTTTCCCTGGGGAAAACTCTGACCTCTTAATTGACGGAGCACCAGATGGAAAGAAAAAGAAAAAGCCTAAAGTCAAAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAGACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAAAAAAAAAAAAA
  3   1   2       bld Gas8                                  st15h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCNCAAGNTAGNCCTGGCAGTGCTGGGATACCTATGGATGTTGGAAGTTACCCAAATATGCCCCATCCTCCTNCAACTCACCAGCNCCCTGGCAGCATGGGTNTGGGGCAAAGGAATATNGGCCCTAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTANGTNTTCAGCACCAAGGGAGATGGGTGGGCNCATGAGACCAAATGGNTGTCCTGGAGTTAGCCATGCAGATCCACAGGCAATACAAGAAAGGATGATGTCTGGTCAGCAGCATCNTGGTCATCAATCTTTTCAACAGCAAATGGCAAACTGTCAGCCTCATCCAGNTATGCACCATCAGTCTTCACNTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCTGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTNTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGC
  3   1   2       bld Gas8                                  st52e15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGATACNTATGGATGNTGGAAGTTACCCAAATANGCCCCATCNTCTTCCAACTCACCAGCCNCCNGGCAGCATGGGTATGGGGCAAAGGAATATNGGCCCNAGAAACATTCAGCAGAGTCAAGCCTTCATGGGTATGTNTTCAGCACCAAGGGAGATGGGTGGGCACATGAGACCAAATGGNTGTCNTGGANTTAGNCANGCAGATCCACAGGCAATACAAGAAAGGATGATGTNTGGTCAGCAGCATCCTGGTCATCAATCTTTTCAACAGCAAATGGCAAAGNTGTCAGCCTCATCCAGCTATGCANCNTCAGTGTTCACNTNCGTCACATTTTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGNGCCTGTCCATCAGCATTCTCCNTCAGAAT
  3   1   2       bld Egg       in                    TEgg031c07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTATATGGGTGGGGCCGATGGACTGACATACTCTCACATGGCNCGATTCAAACGTCAGCTTTCTGAGCAAGATGTGGAAACCATCTGCCGTACCATTCTGGTCTACTGTCTCAACCATTACAGAGGGGATGAAAACATCAAAGGTTTCATATGGGACCTGATTACACCAACAGAAGATGGACAGACAAGAGCTTTGGTTAATCACTCAGGTCTGTCTGCCCCTGTGCCCAGGGGAAGGAAAGGGAAGAAAGTAAAAAGCCAGAATTCACAGCCTGTGTTAAAGCATGCCGACTGGCTCCAGAGCTGTAACCCCGACACCTTGTTTCAAGAGGACAGCTACAAAAAGCACCTGAAGCATCACTGTAACAAGGTCCTGCTGCGTGTCCGCATGCTGTACTATTTGAGGCAAGAAGTGATAGGGGACCAAGCTGACAAAACTGTTGGAGGGTTTGGGCTGGAAGGTTTCCCTGGGGAAAACTCTGACCTCTTAATTGACGGAGCACCAGATGGAAAGAAAAAGAAAAAGCCTAAAGTCAAAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te4       in                         CAAN1225.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAACTGTCAGCCTCATCCAGCTATGCACCATCAGTCTTCACCTCCGTCACATTCTCATCACCAACCATGGACTTCGCTTCATCAGTCACCTCAGAACACCCCTCAGAAAGTGCCTGTCCATCAGCATTCTCCTTCAGAATCTTTCCTTGATAACTCTGTGCCGGATATGACTCGGATAAGTGGCCCCAATGCTTCTTTAATGAACACAGAAGATTTCTTGCCATCCATGCAGTCCCAGACACCACAAAAGAAAAGGAAGAAAAAAAACAACCACATTGCTACTGATAAAACTGTTGGAGGGTTTGGGCTGGAAGGTTTCCCTGGGGAAAACTCTGACCTCTTAATTGACGGAGCACCAGATGGAAAGAAAAAGAAAAAGCCTAAAGTCAAAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAGAAAAAAGTTAATAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCT
  3   1   2       add TbA       out                   TTbA062c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGATTGGGTGTCAGAATGTAAAAAGAATTGTAGAAGGCCCTCTTTCTTAAGGAGCTGGCATAAAAACCTGTTGAAAATTACTTTCGTTGCGGAACAGCAATACCATGTATTTTCAGTGACCGGTTGTGAACATAACGGATCTTTACTTAATAGACTTATTAGTCTTTTTCGGTTTTTTTTTTTTTAATCAGCAAAAAGTCGGATGCAGAGGGCAGTGTTCAGAAGAAAAAAGTTAGTAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTGGGATAAAACCCCACCCCCTTCTTTTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGGTAATACTTATGTATTTAGATATAAATGTTAGATTTTGCACATAAAATTGTGGACATATCACATAAAAGTGAAAGCAGACACAATGTAATAGTTTTTTGTACACAATAGAACATATACAGTGAAGCACTGGTGCTCACCACCCACAAAATCTTTTTCTTCAAGCTAATGTGAAAACAAGCAAATGATATTTGGATTTTCATGTAAGGGAAATTTATGCAAAAAATATATGGCTTTTGGCACAGTATGTGGTTTCCCTGGAAGGGGCAGTGCTGTAAATAGATTAGGATGAACTTGCCA
  5   1   2       bld Te3       out                        CAAM7018.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAGAGCCCAAGGAGCCAAAAGAGCCCAAAGCAAAGAAAGAGCCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAGAAAAAAGTTAATAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGANAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAGATTGAAGAATTGAGAACTTCAG
  5   1   2       bld Brn3      in                        CAAK10207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAAGGAACCTAAGGCTCCCAAACAACCCAAGCCCCCCAAAGAGCCAAAAGAGAAGAAGGTGAAGACAACCACGCCAAAACCAAAGGCAAGCAAAAAGACCAGCAATAAGTCGGATGCAGAGGGCAGTGCTCAGAAGAAAAAAGTTAATAAAGTGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGNGAACTGAAGCAGGACTTTGGATCAGCAAAGATTGAAAGAATTTGAGAAACTTCAGAAGCAGGAGCCAGAAACAGAGCGCGTGGAGCGACCTCCTGCCGATGACTGGAAGAAATCTG
  5   1   2       bld Egg       in                   TEgg031c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAACCAGAAGGGGTTGAACCTTTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTG
  5   1   2       bld Egg       in                   TEgg060a24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTGAAGAATTTGA
  5   1   2       bld Egg       in                   TEgg061h15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTAGATTTGGATAAAACCCCACCCCCTTCTTCTCCCCCTCCTCCTCCAGAAGAGGAAGATGACTCGGGAGTACAGAAGAGGCGCTCTAGCAGGCAGGTTAAAAGGAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTGAAGAATTTGAG
  5   1   2       bld Gas                            TGas100j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGCGCTACACTGAAGACCTAGAATTTAAGATTTCAGATGAAGAGCCTGATGATGCAGATGGAAGAGACTCTCCTTCCAACACATCTCAGTCGGAGCTGCAGGATGGACTAGATGCTGAAGGACCCGTGGTGGAGAAAATCATGAGTTGCCGGTTAACAAAAAAACAACTGGAATCTGGTGAAGAGGTGGAGATAGAAGAATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTGAAGAATT
  5   1   2      ests                               Xt7.1-TEgg061h15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAATTGGTACAACAAACGAAATTGCATTTTAGCAGATGAAATGGGTTTGGGGAAGACAATTCAGTCGATCACTTTTCTGTATGAGATATACTTAAAGGGAATTCATGGGCCCTTTTTGGTCATTGCTCCACTGTCAACAATCCCAAACTGGGAAAGGGAGTTTCGCACTTGGACAGAGTTGAATGTGGTCGTTTATCATGGGAGTCAAGCAAGCAGGAAAACTATACAACTTTATGAAATGTACTTCAAGGATCCACAGGGAAAAATTATAAAAGGGGCTTATAAGTTTCATGCGATCATTACAACATTTGAAATGATTTTAACGGACTGCCCCGAGCTCAGGAACATCCATTGGCGATGTGTGGTTATTGATGAGGCTCATCGACTGAAGAACAGAAACTGTAAACTTTTGGAAGGCCTGAAGATGATGGATCTGGAGCACAAAGTACTGCTAACAGGAACTCCTTTACAAAACACCGTGGAGGAGCTTTTTAGTCTGCTTAACTTTTTGGAACCAGACCGTTTTCCTTCAGAGAGCAATTTCATGCAAGAATTTGGAGATTTGAAAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAGAAATCGAAGACCTGCTGCGTAAAGGTGCTTATGGAGCACTGATGGATGAAGAAGATGAAGGCTCCAAATTCTGTGAAGAAGATATTGATCAAATTCTCTCTCGTCGCACTCATACAATAACAATAGAGTCTGAAGGAAAGGGGTCTACGTTTGCGAAGGCTAGTTTTGTTGCATCTGGAAACAGGACAGACATTTCTCTGGATGATCCCAATTTCTGGCAAAAATGGGCAAAGAAAGCTGAACTGGATCTTGATGTACTAAAT
                                                  Xt7.1-CHK-1008232828                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGTACAACAAACGAAATTGCATTTTAGCAGATGAAATGGGTTTGGGGAAGACAATTCAGTCGATCACTTTTCTGTATGAGATATACTTAAAGGGAATTCATGGGCCCTTTTTGGTCATTGCTCCACTGTCAACAATCCCAAACTGGGAAAGGGAGTTTCGCACTTGGACAGAGTTGAATGTGGTCGTTTATCATGGGAGTCAAGCAAGCAGGAAAACTATACAACTTTATGAAATGTACTTCAAGGATCCACAGGGAAAAATTATAAAAGGGGCTTATAAGTTTCATGCGATCATTACAACATTTGAAATGATTTTAACGGACTGCCCCGAGCTCAGGAACATCCATTGGCGATGTGTGGTTATTGATGAGGCTCATCGACTGAAGAACAGAAACTGTAAACTTTTGGAAGGCCTGAAGATGATGGATCTGGAGCACAAAGTACTGCTAACAGGAACTCCTTTACAAAACACCGTGGAGGAGCTTTTTAGTCTGCTTAACTTTTTGGAACCAGACCGTTTTCCTTCAGAGAGCAATTTCATGCAAGAATTTGGAGATTTGAAAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAGAAATCGAAGACCTGCTGCGTAAAGGTGCTTATGGAGCACTGATGGATGAAGAAGATGAAGGCTCCAAATTCTGTGAAGAAGATATTGATCAAATTCTCTCTCGTCGCACTCATACAATAACAATAGAGTCTGAAGGAAAGGGGTCTACGTTTGCGAAGGCTAGTTTTGTTGCATCTGGAAACAGGACAGACATTTCTCTGGATGATCCCAATTTCTGGCAAAAATGGGCAAAGAAAGCTGAACTGGATCTTGATGTACTAAATGGAAGG
  5   1   2       bld Te4       out                       CAAN12191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTCTATGTGAAATATAAGAACTACTCATACTTGCACTGCCATTGGGCTACTTTGGAAGAACTGGAGAAAGACAAGAGGATCCAACAGAAAATAAAGCGATTTAAAGCAAAGCAAGGGCAAAACAAGTTTCTTTCAGAGATTGAGGATGATCTGTTTAATCCTGACTACGTTGAAGTTGATCGGATACTGGATGTGGCTACCAGCACAGATGAAAATGGAGAGCCTGTCTGTCACTACTTGGTGAAATGGTGTTCCCTTCCGTATGAAGACAGCACTTGGGAACTGAAGCAGGACTTGGATCAAGCAAAGATTGAAGAATTTGAGAAACTTCAGAGCAGGGAGCCAGAAACAGAGCGCGTGGAGCGACCTCCTGCCGATGACTGGAAGAAATCTGAGAGTTCCAGGGAGTATAAAAATAATAACAGTCTCAGGGAATACCAGTTGGAGGGAGTAAACTGGCTGCTGTTCAATTGGTACAACAAACGAAATTGCATTTTAGCAGATGAAATGGGTTTGGGGAAGACAATTCAGTCGATCACTTTTCTGTATGAGATATACTTAAAGGGAATTCATGGGCCCTTTTTGGTCATTGCTCCACTGTCAACAATCCCAAACTGGGAAAGGGAGTTTCGCACTTGGACAGAGTTGAATGTGGTCGTTTATCATGGGAGTCAAGCAAGCAGGAAAACTATACAACTTTATGAAATGTACTTCAAGGATCCACAGGGAAAAATTATAAAAGGGGCTTATAAGTTTCATGCGATCATTACAACATTTGAAATGATTTTAACGGACTGCCCCGAGCTCAGGAACATCCATTGGCGATGTG
  5   1   2       bld Egg       in                  TEgg057p16.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCAATTGGTACAACAAACGAAATTGCATTTTAGCAGATGAAATGGGTTTGGGGAAGACAATTCAGTCGATCACTTTTCTGTATGAGATATACTTAAAGGGAATTCATGGGCCCTTTTTGGTCATTGCTCCACTGTCAACAATCCCAAACTGGGAAAGGGAGTTTCGCACTTGGACAGAGTTGAATGTGGTCGTTTATCATGGGAGTCAAGCAAGCAGGAAAACTATACAACTTTATGAAATGTACTTCAAGGATCCACAGGGAAAAATTATAAAAGGGGCTTATAAGTTTCATGCGATCATTACAACATTTGAAATGATTTTAACGGACTGCCCCGAGCTCAGGAACATCCATTGGCGATGTGTGGTTATTGATGAGGCTCATCGACTGAAGAACAGAAACTGTAAACTTTTGGAAGGCCTGAAGATGATGGATCTGGAGCACAAAGTACTGCTAACAGGAACTCCTTTACAAAACACCGTGGAGGAGCTTTTTAGTCTGCTTAACTTTTTGGAACCAGACCGTTTTCCTTCAGAGAGCAATTTCATGCAAGAATTTGGAGATTTGAAAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGA
  5   1   2       bld Te3                                 CAAM14195.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGGGAGTCAAGCAAGCAGGAAAACTATACAACTTTATGAAATGTACTTCAAGGATCCACAGGGAAAAATTATAAAAGGGGCTTATAAGTTTCATGCGATCATTACAACATTTGAAATGATTTTAACGGACTGCCCCGAGCTCAGGAACATCCATTGGCGATGTGTGGTTATTGATGAGGCTCATCGACTGAAGAACAGAAACTGTAAACTTTTGGAAGGCCTGAAGATGATGGATCTGGAGCACAAAGTACTGCTAACAGGAACTCCTTTACAAAACACCGTGGAGGAGCTTTTTAGTCTGCTTAACTTTTTGGAACCAGACCGTTTTCCTTCAGAGAGCAATTTCATGCAAGAATTTGGAGATTTGAAAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCC
  3   1   2       bld Egg       in                    TEgg057p16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGAGCAATTTCATGCAAGAATTTGGAGATTTGAAAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTTCCAAAAAAAAAAAAAAAAAA
  3   1   2      seed Egg       in                    TEgg061h15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACTGAAGAACAGGTGCAAAAACTCCAAGGCATTCTAAAACCAATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAAAAAAAAAAAAA
  5   1   2       add Te3       out                        CAAM2991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATCCTTAAGCCCATGATGCTGAGGCGTTTAAAGGAAGATGTGGAAAAGAAACTAGCTCCTAAAGAGGAGACTATCATTGAGGTTGAACTTACCAACATACAGAAGAAATATTATCGCGCCATCTTGGAGAAGAACTTTGCATTCCTTTCAAAGGGGGCAGGACAGGCTAATGTGCCAAACCTTGTTAATACTATGATGGAGCTGCGTAAATGTTGTAACCATCCATATCTCATTAAAGGTGCTGAAGAAAAGATCCTCGGAGAGTTTCGTGAAACATACAACCAAATGGCAGCAGATTTTTATCTCCAGGCTATGATCCAATCTGCAGGAAAGCTGGTTCTCATAGACAAGCTGTTGCCAAAAATGAAGGCAGGGGGTCACAAGGTTCTAATTTTCTCCCAAATGGTGCGATGTTTAGATATTCTGGAGGATTATCTAATGCATAAACGGTACCTGTATGAACGAATTGATGGAAGAGTTCGTGGAAATCTTCGCCAGGCTGCAATTGACCGCTTTAGCAAACCTGACTCTGACAGATTTGTATTCCTTTTGTGTACCAGGGCAGGTGGCCTTGGAATTAATTTAACTGCAGCTGACACATGCATTATATTTGATTCTGATTGGAACCCACAGAATGATCTTCAAGCACAAGCACGTTGCCACCGAATTGGACAAAACAAAGCTGTAAAGGTTTACAGATTAATAACAAGGAACTCATATGAGCGAGAGATGTTTGACCGGGCCAGTTTGAAGTTAGGACTGGATAAAGCTGTCTTGCAGAGCATGAGTGGCAGAGAAAACAGTGTTGGCGGAATTCAGCAGCTTTCAAGAAGGAGATAGA
  3   1   2       bld Neu       in                    TNeu078e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGATGCTGAGGCGCCTCAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                         CAAN1225.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGGAAGATGTGGAAAAGAATCTGGCTCCAAAAGAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCC
  3   1   2       bld Brn3      in                        CAAK10207.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGAAACCATAATAGAAGTAGAGCTGACAAACATTCAGAAGAAATATTATCGTGCAATTCTTGAGAAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCC
  3   1   2       bld Brn3      out                        CAAK2224.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGAGCTTACTAACATCCAGAAGAAGTATTACCGAGCAATACTGGAGAAGAATTTTTCTTTTCTGACCAAAGGAGCTAGTCAATCCAACACACCCAACTTGCTCAATACCATGATGGAACTACGCAAATGCTGCAACCACCCATACCTCATCACTGGAGCAGAAGAAAAGATCATATCTGAGTTCCGAGAAGCAACTCCAGTAGTTCCCCCTGACTTTCACGTCCAAGCAATGGTACGCTCCTCTGGCAAACTGGTGCTAATAGATAAGCTGCTCCCTAAACTAAGGGCTGGAGGCCACAAAGTTCTCATCTTTTCTCAGATGGTACGGTGCCTGGACATCCTGGAAGACTATCTCATTCAGAGAAGGTACCTTTATGAGCGTATTGATGGACGTGTCCGTGGCAACATGCGTCAGGCAGCCATTGATAGATTCAGCCGCCCAGATTCTGACCGATTTGTGTTTCTACTCTGTACACGAGCTGGTGGGCTTGGAATTAACTTGACAGCTGCTGATACTTGTATTATATTTGACTCGGACTGGAACCCTCAAAATGACCTTCAGGCTCAAGCTCGATGTCATCGTATTGGGCAAAGCAAAGCCGTTAAAATTTACAGACTCATCACTCGCAACTCCTATGAGAGAGAGATGTTTGATAAGGCCAGTCTCAAACTAGGACTAGACAAAGCTGTATTGCAGTCTATGAGTGGTCGGGATAATCACCTTAGTGGGCCTATTCAGCAATTCAC
  5   1   2       bld Te3       out                        CAAM4547.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAACTTTGCTTTCCTCTCCAAGGGTGGTGGAGGTGGTCATGCAAATGTCCCTAATCTTTTAAACACTATGATGGAACTCCGAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGNGGTGCAACAGCTATCCAAAAAAGAAATCGAAGACCTGCTGCGTAAAGGTGCTTATGGAGCACTGATGGATGAAGAAGATGAAGGCTCCAAATTCTGTGAA
  3   1   2       bld Egg       in                    TEgg060a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAATGCTGCAATCATCCTTACCTTATAAATGGTGCTGAAGAGAAAATTTTGGAAGAGTTTAGAGAAACGCACAATTGTGACCCTTCAGATTTTCAGCTTCAGGCAATGACCCAAGCCGCTGGCAAACTAGTTCTGATTGACAAGCTGCTGCCAAAGCTGAAGGCTGGTGGCCACAGGGTGCTTATCTTTTCACAGATGGTGCGGTGCTTGGACATACTGGAAGACTACCTCATTCAACGAAGGTATCCATATGAGAGAATTGATGGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg122m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCAGAGTAAGAGGCAACCTTCGTCAGGCTGCTATTGACAGATTTTCCAAACCCGATTCTGATAGGTTTGTGTTCCTGCTATGTACAAGGGCAGGAGGTCTGGGCATTAATTTAACTGCTGCTGATACTTGCATTATCTTTGATTCTGACTGGAACCCCCAGAATGACCTTCAGGCTCAAGCGCGATGCCATAGAATAGGCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAGAAATCGAAGACCTGCTGCGTAAAGGTGCTTATGGAGCACTGATGGATGAAGAAGATGAAGGCTCCAAATTCTGTGAAGAAGATATTGATCAAATTCTCTCTCGTCGCACTCATACAATAACAATAGAGTCTGAAGGAAAGGGGTCTACGTTTGCGAAGGCTAGTTTTGTTGCATCTGGAAACAGGACAGACATTTCTCTGGATGATCCCAATTTCTGGCAAAAATGGGCAAAGAAAGCTGAACTGGATCTTGATGTACTAAATGGAAGGAAC
  5   1   2       bld Gas                            TGas043b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCAAAGTAAATCTGTGAAAATTTACAGACTGATCACTCGGAATTCCTATGAGAGGGAAATGTTTGATAAGGCCAGTTTAAAGCTTGGGCTGGATAAAGCAGTCTTGCAGTCCATGAGTGGAAGAGACAATGCTACCAATGGGGTGCAACAGCTATCCAAAAAAGAAATCGAAGACCTGCTGCGTAAAGGTGCTTATGGAGCACTGATGGATGAAGAAGATGAAGGCTCCAAATTCTGTGAAGAAGATATTGATCAAATTCTCTCTCGTCGCACTCATACAATAACAATAGAGTCTGAAGGAAAGGGGTCTACGTTTGCGAAGGCTAGTTTTGTTGCATCTGGAAACAGGACAGACATTTCTCTGGATGATCCCAATTTCTGGCAAAAATGGGCAAAGAAAGCTGAACTGGATCTTGATGTACTAAATGGAAGGAACACTTTAGTAATTGACACGCCACGAGTAAGAAAGCAAACCAGACTGTTTAGTGCAGTGAAGGAGGATGAGCTCATGGAATTCTCTGATCTGGAGAGCGATTCTGAGGACAAACCAAGTATCAAACCACGAAGGCCTCAGGATAAATCTCTGGGCTATGCAAGGAGTGAATGTTTCANAGTTGAGAAGAATCTTCTAGTATATGGGTGGGGGCCGATGGACTGACATACTCTCACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)