Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012155361 Xt7.1-TTpA017k10.3.5 - 16 ESTs
                                                                       -290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA017k10.3.5                                                                                                                                                                                                                                                                                                   ATTTTTACTGATTAAGGAGATGTATTTGTCATATTCATTGCTTGAAATATAAATATTACTCAGAAGAAAGCTGGTGAAAGAGGCCATTAATAGTGGATTATTCCTCAAAGCCTATACATTCACCTGGATACTGAGAGTCACTGAGGAGAAGAAGATGATCTGGTGATCAGCGCGAGGATGTCATTGTGCCACCATTTGGCTGATGAGCTCAGGATTTATTGATGATTGTTTCTGTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAGCTTCAGTCCCCGGGATTTACCAATTCTCAGCCCCATGTCATATTGATCACAGTGAGATCAAGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTT
                                                  Xt7.1-CHK-1008266983                                                                                                                                                                                                                                                                                                         ACTGATTAAGGAGATGTATTTGTCATATTCATTGCTTGAAATATAAATATTACTCAGAAGAAAGCTGGTGAAAGAGGCCATTAATAGTGGATTATTCCTCAAAGCCTATACATTCACCTGGATACTGAGAGTCACTGAGGAGAAGAAGATGATCTGGTGATCAGCGCGAGGATGTCATTGTGCCACCATTTGGCTGATGAGCTCAGGATTTATTGATGATTGTTTCTGTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAGCTTCAGTCCCCGGGATTTACCAATTCTCAGCCCCATTTCATATTGATCACAGTGAGATCAAGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTTTCACAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                        2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     2     4     3     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     2     2     2     2     1     2     2     2     3     3     4     4     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     7     7     7     7     7     5     5     5     5     4     5
  5   1   2      ests                                 Xt7.1-XZT71182.5                                                                                                                                                                                                                                                                                                   ATTTTTACTGATTAAGGAGATGTATTTGTCATATTCATTGCTTGAAATATAAATATTACTCAGAAGAAAGCTGGTGAAAGAGGCCATTAATAGTGGATTATTCCTCAAAGCCTATACATTCACCTGGATACTGAGAGTCACTGAGGAGAAGAAGATGATCTGGTGATCAGCGCGAGGATGTCATTGTGCCACCATTTGGCTGATGAGCTCAGGATTTATTGATGATTGTTTCTGTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAGCTTCAG
  5   1   2      ests                               Xt7.1-TTpA017k10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATCAAGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------G----
                                               BLH ATG     605     806                                                                                                                                                                                                                                                                                                   
                                               BLH MIN     605      77                                                                                                                                                                                                                                                                                                   
                                               BLH MPR     539      77                                                                                                                                                                                                                                                                                                   
                                               BLH OVR     605     471                                                                                                                                                                                                                                                                                                   
                                               CDS MIN     605      77                                                                                                                                                                                                                                                                                                   
                                               ORF LNG     605      72                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Hs ---- 4e-050     XP_001127207.1 PREDICTED: hypothetical protein LOC151176 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Dr ==== 9e-086     XP_696577.1 PREDICTED: similar to RIKEN cDNA 1110035L05 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Mm ==== 1e-092     NP_080401.1 RIKEN cDNA 1110035L05 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Gg ==== 2e-129     XP_417583.1 PREDICTED: similar to RIKEN cDNA 1110035L05 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          AAI35358.1 LOC549119 protein [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTpA017k10.3.5                                                                                                                                                                                                                                                                                                           TGA---------------------------------------------------------------TGA------------------------------------------------------TGA---------------------TGA------------------------------------------TGATGA---------------ATG------------------------------------------------------------TGA---ATG---------ATG------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------TAA------------------------------------------------------------------------------------TAA---------------------------------------ATG---------------ATG---------------------------------------------TAG------------------------------------ATG---------------------TGA------TAA---------------------------------------------------------------------------------------------ATG------------------------------------TGA---------------------------ATG------------------------------------TGA------------TGA---------ATG---------------------------------------------------------------------------TAA---------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  0   1   1           Tad5 FL                          XZT27177.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAGCTTCAGTCCCCGGGATTTACCAATTCTCAGCCCATGTTCATATTGATCACAGTGAGATCAAGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTTTCACATTAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FLq                    TEgg121f14.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGACTGGAGAACAAAAAATCTCGATGGCCCTTCCTGCTGCTGACTGGCACAGCTTGCTGCAACTTCATTTATTATCTTCAAGTACTGCAAGGAACCTATACATTAAGGGTGCATTTAACTCAAGGATATAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAGCTTCAGTCCCCGGGATTTACCAATTCTCAGCCCATGTTCATATTGATCACAGTGAGATCAAGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTTACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTTTCACATTAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-XZT71182.5                                                                                                                                                                                                                                                                                                   ATTTTTACTGATTAAGGAGATGTATTTGTCATATTCATTGCTTGAAATATAAATATTACTCAGAAGAAAGCTGGTGAAAGAGGCCATTAATAGTGGATTATTCCTCAAAGCCTATACATTCACCTGGATACTGAGAGTCACTGAGGAGAAGAAGATGATCTGGTGATCAGCGCGAGGATGTCATTGTGCCACCATTTGGCTGATGAGCTCAGGATTTATTGATGATTGTTTCTGTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAGCTTCAG
                                                  Xt7.1-CHK-1008239677                                                                                                                                                                                                                                                                                                         ACTGATTAAGGAGATGTATTTGTCATATTCATTGCTTGAAATATAAATATTACTCAGAAGAAAGCTGGTGAAAGAGGCCATTAATAGTGGATTATTCCTCAAAGCCTATACATTCACCTGGATACTGAGAGTCACTGAGGAGAAGAAGATGATCTGGTGATCAGCGCGAGGATGTCATTGTGCCACCATTTGGCTGATGAGCTCAGGATTTATTGATGATTGTTTCTGTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAG
  5   1   2       bld TpA       in                   TTpA017k10.p1kSP6 CAGTGAGAGAAGAGAAAATATATATGCTGGAGCTGAGAGCAAACTACCATCTATCTAAGCAATCATTAGAACCCTGCACGTGTGTAGGAATAAGGAAGGACTTATTTCAGAGAATTGCTGGATTTTTTTCTCTTTTTTTATCTGCAGTAGAAATTCAGACTTTCTTTCTTTTCTTTTCTTTTTTTTTTTTTTAATAATCCTGGCTGCTGTTTAAAGAAAAAGAGCTGAATTACTGTCTTCGCCTTAAAGCCAAGAATAAAAAAATAAAAATACTAAACCTACATTAAGGTATTTTTACTGATTAAGGAGATGTATTTGTCATATTCATTGCTTGAAATATAAATATTACTCAGAAGAAAGCTGGTGAAAGAGGCCATTAATAGTGGATTATTCCTCAAAGCCTATACATTCACCTGGATACTGAGAGTCACTGAGGAGAAGAAGATGATCTGGTGATCAGCGCGAGGATGTCATTGTGCCACCATTTGGCTGATGAGCTCAGGATTTATTGATGATTGTTTCTGTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATA
  5   1   2       bld In63 5g                         IMAGE:8959255.5p                                                                                                                                                                                                                                                                                       TAATCCTTAAGGATTTTTACTGATTAAGGAGATGTATTTGTCATATTCATTGCTTGAAATATAAATATTACTCAGAAGAAAGCTGGTGAAAGAGGCCATTAATAGTGGATTATTCCTCAAAGCCTATACATTCACCTGGATACTGAGAGTCACTGAGGAGAAGAAGATGATCTGGTGATCAGCGCGAGGATGTCATTGTGCCACCATTTGGCTGATGAGCTCAGGATTTATTGATGATTGTTTCTGTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGCAGCTAAAAGGAACGCAAGAAAGGAAAAGACCTCATCAGTCACTGAATCCTTTATGTCTTCTTGTCAACAGTGAGAGTACATGAAACGGACAGTTGTCTGAACTCGATCTGACTACGATGCTAACAACTGCTGGGGTTGTGGGCGACTGATGATGGGCACCTAAAAGATGAGGAAGACAGAAACTACTGACTGTTTTGACATCAGAACCATCGGA
  5   1   2       bld In63 5g                         IMAGE:8961180.5p                                                                                                                                                                                                                                                                                                                                                                                              GTTGGATTATTCCTCAAAGCCTATACATTCACCTGGATACTGAGAGTCACTGAGGAGAAGAAGATGATCTGGTGATCAGCGCGAGGATGTCATTGTGCCACCATTTGGCTGATGAGCTCAGGATTTATTGATGATTGTTTCTGTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACTCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAACTCCAGATCCTGACTACCAGATGCTTACACAACCTGATGGGGTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAGAATGTAAGGGGAGACAAGAAACTACGTGGACTGTTGGACACAGACCACGGGACCTCAGACCACCTGTCTCAGATGCTGAGCTGAGTAATATGAGTCTTGCTACGGATTCACATGCTGAGAGCCAGACGCCCTGATCAGTGATTCGACCACACGACTGCCTCATGGTACTGTGAGACTTCTACGACGCATGAGTCATGGCACTGAGCGCTTGGCAAGACTGGCAATCGATCTAATCCAGGAAGGTCG
  5   1   2   22 seed Tad5 5g                              XZT71182.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGTGTGATCTTTCACTGCGAATCACTGCATACACTGATGGGTCTCTATGCTGACAGATGTGGGCTGAGATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGNGAAGGACAAGAAACTACGTGGACTGTTTGGACTACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAG
  5   1   2       bld Tad5 FL   in                         XZT27177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGCTGCCCTGATACTTCAGACTTTACAGGCTTCATAGCTCAGTGAGTTTTAATTACACTTTATGGACTTCTGAGCAAGTCGATAGGAGAGAATTTGTTTTCAACCCATCCTTTTATGCGGAGAAAGACCTGGTGGGATTAATTTATGCTTTATCTCAACCCTTTTGTCTTGGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTTGTGTACCCTGTGAGGACCTTTCTCCTTACCGACGGNTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTG
  5   1   2   12  bld Tad5 5g3  in                         XZT65713.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCCAGTCTGTATCTACACTGAAGGAGCTATTCTTTCCACTTGTTTTGTCCTGTTAAGCATCTTTGAAAGATACCTGGAGTGCTTTCCAGCTCAGCTTTCTAACTCCTGAAGGATATATTTCCCAGAACATAATGAGGTGTTGGGTATGGCTGTTAGTGGCCATAGTTCTGTGCCAGCAGCTTTCTGTCGTTCGAGTCCTGGCAGCTAAAAAGGAACGCAAGAAAGGAAAAGACCCTCATCAGTTCACTGAACCCTTTAATGTCTCCTTGTCCAACAGTGAGGAGTTACATGAAACGGACAAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAGCTTCAGTCCCCGGGATTTACCAATTCTCAGCCCCATGTCATATTGATCACAGTGAGATCAAGAGTAAAGCGCAATTGC
  5   1   2       bld Egg  FLq                       TEgg121f14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGACTGGGAGAACAAAAAATCTCGATGGCCCTTCCTGCTGCTGACTGGCACAGCTTGCTGCAACTTCATTTATTATCTTCAAGTACTGCAAGGAACCTATACATTAAGGGTGCATTTAACTCAAGGATATAGTTGTCTGAAACTCCAGATCCTGGACTACCAGATGCTTACACAACCTGGTTGGGGTTTGTGGGCCGAACTGATGATGGGGCAAACTCTAAAAAGAAATGTAAGGGGAAGGACAAGAAACTACGTGGACTGTTTGGACCACCAGGACCACCGGGACCCCAAGGACCACCTGGTCCTCCAGGAATGCCTGGAGCTGAGGTTACATATGAAGTCTTGCTACAGGATTTCAAACAAATGCTGAAAGAGGCCACAGAGCGCCGCTTGATGTCAGGTGACATCCCAGAACACACCAGCGAGCTGCCTCCCATTGTGTTACCTGTTGAGGACCTTTCTCCTTACCGACGGGTAGATGAAGGTTTCCATTGCAGACTGAAGGGACAAGTCATTGTGGACAAGAAGACTTTGGTCGAGCTCCAGAACTTTCAAATGCCAACAGCGAAGGGGTCATTCCTAAGAGGATCTGGACTGAATTTAGCGACAGGACGCTTCACAGCTTCAGTCCC
  5   1   2      ests                               Xt7.1-TTpA017k10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATCAAGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTT
                                                  Xt7.1-CHK-1008237419                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTTTCACAT
  5   1   2       bld Ova1                                 CABE4548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGACGCTTCACAGCTTCAGTCCCCGGGATTTACCAATTCTCAGCCCATGTTCATATTGATCACAGTGAGATCAAGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCGAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAAACTGAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTACTTCT
  3   1   2       bld TpA       in                    TTpA017k10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGATCAAGAGTAAAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACCAGTACTTTCACATTAATCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Limb      in                        CBSU8012.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGCGCAATTGCGCCCTCGTGACAACGTGCGGGTGTTAATATGCATTGAGTCCATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCGGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCGAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAG
  3   1   2      seed Tad5 FL   in                         XZT27177.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGTTAATATGCATTGAGTCTATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTTTCACATT
  3   1   2       bld Tad5 5g3  in                         XZT65713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGTGCCATCGATATACGTCGCTGGAAGTCATTGCTGGTTTGGAAAGCAACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTTCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTTTCCCCTT
  5   1   2       bld Tad5                                  XZT5698.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGCACAGTAAGATATTCACTGTTCACGTGCAAGGGTTGTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCAAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTTTCACATTAATT
  3   1   2       bld Limb      in                        CBSU8012.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTACAGTTGCAGGTTGGCCAATACACCTCTATATTTGTGGACAACAGTGCTGGAGCTCCAATCACTGTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCGAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCATTGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGCATACAATGGCTGTATGTTAATAAACAGTACTTTCACATTAATTCAACATTAC
  5   1   2       bld HeRe      in                     EC2CAA29CE07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTACAAAATGGGTCTGATTTTATGGGCATTCTTATGGGTCTTTAAGCAAACCCCGAGAACTGCAGAAAGCTTCTCTTTGACTCCAAACCAGCGACATTCCGACTAACACATTCAGACACCTGCAAAGAATAACAATTTCATGTGGTCCAGTCGAGATCTGCTCCAGATTATATGCTTGGCAATTACAGCATGAGGGACAGAAATGATGTAGGACTTTTTCCCTGCTGCTGCTGCTTATAGACCTTCTACATCCAGAGAAAACATATTTCAAAGATAATGCTTTGCAAGTTCCTTTACCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCAATGAGCCCTGTATTGTTTTTATATTATAAAGTGCTGC
  3   1   2       bld HeRe      in                     EC2CAA29CE07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCTTTTCCAGTGAAGGAGTTAATATATATCTTCTGGACACTGTAAAAATATAGTTTTAAGTAGAGGAACCCGCCCCCCTTTTTATTTGTTGCTATCGGTTGAGTCCTGGACTAGGATGGAGAGCTCAAAAAGTGCTTTTATTTTAAGACTATGCTGACTCTGTGCTGAATCAACTACTACGGACATGGTTTTTAAGGGGAACTTTTCGGTGTGGTTCCTGGATTGATCAGTAAGGAACTGAAGAAAAAGAATGGTTGTTCTTGTGACACTATTATTCCACAGATTGTTAACTCTTCGAAGCAATGAGCCCAGTATTGTTTTTATATTATAAAGTGCTGCATACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)