Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG5295.5                            13 END     2           9       15                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012155388 Xt7.1-TGas089h02.3.5 - 22 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas089h02.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGCTGCACTATCATGGCACCCGTCTGGAAATCACAGTCTCGCCACTAAAACGCTCAAGCTGGCAATGTCCTGAATGTAAAGTGTGCCAAACCTGCAAGCAGCCAGGGGAAGACACAATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGCCAAGAGAAGAGGAATCGGGCAGAAACTTGTGTCTTGTGTAGTCACGCTCTGCCAAAGGAGAAGTGTCCCAATTGTATCAATGTCCATCAAACCGTTTGTGCACAAGCTGATTACTCTACACCGTGCAGTGCTAATAGCCCATTAACTGATAAAAGGCAATTGCTGCAGGAAAATGGCAGTGAGATCTCTAACACAGAGCTGTCAGAATGTGAAGCCAAACCACTAGGGATGTCAGAGATGAATCTGGATCCCCTTCAGAAGAAAGTTTCATCTGAAACACTGATGGAGCCTATATCGGATTCTATGTCTCTGGAGGATATTGTAACAACGGAAGAAGATGGTCCTTCCACTTCTGACAATGAAGCTGCTGAGGCACCCCTATAATGACCCGTGCCGTTAAGGGAAAAAAGCCCACCCCCTTTGGAAGCTGAACTGCCACCTCTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTGGTCACTGTAGAAGATGAAGAAATGGAAACCGAAGATACAGAGACTGAGATTCATGAGGTGCAAAAGGAAGTGACTGGTTTAGCGCTTGTTAGCTCCAGCATTAAGACTGCTTCCCCTACTTTAGTTTCTGATACATCCCAGGCATGTGCCTCAGTGATTGAAGGCTCTGACATAAGGTTTACAGACACCGTACATCTAACTAGTGGGCCTTGTCAGAGTCCTTCAAAGACACCTAGCTGCTCTCAACAACCATCTCTTTCAGACTCTGAAATGACTATTGAGTCCGAAGATCCTCCCTGCCAGCCTAATACAGAGATGTTGAATAATGACAATACATTTTGTCAAGAACATTTTGGGGACTACTCTGTTAACAAAGATCAAGGGCCACTCAGGCCTGGTCTTATAAAGTCTGACATTGTAAATGAGATCTCTAATTTGAGCCAGGGGGACACCACAGGTAGCTATCATGGCTCTGATGCACTAGGTTCCCCTGACCCTGAGGGCGGGTCCCTCTCTATGGAGATGTGTTTGCATAAAGAGGATGGATCTTTGCGGTTGTGCAATGACTCTATAACAGAGACCGATGATTCTCTGCTCTATGATCCCTCTGGGGGAAAACTAGATGCTGAAAAGACACGTCGAAAAAGCTCACCAGGACGCTCAAGGGTTAAACAAGGTCGAAGTAGCAGCTTTCCTGGAAGAAGACGACCCCGAGGGGGAAGTGGTTCTGGAACTAGTCGAGGTAGAGGAAGATCTCGACTAAAATCTACAGCTTCTTCCATAGAGACTCTTCCGGTGGTAGATGTGGAGAGCTCTCCCAGCAAAGAGGAGGAGGAGGAAGAGGATGATACCATGCAGAACACAGTTGTGCTTTTTTCCAACACTGATAAGTTTGTTCTCATGCAGGACATGTGTGTTGTATGCGGTAGCTTTGGTCGAGGCTCAGAAGGGCATCTGCTAGCGTGTTCTCAGTGTTCTCAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGT
                                                  Xt7.1-CHK-1008266991                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACTATCATGGCACCCGTCTGGAAATCACAGTCTCGCCACTAAAACGCTCAAGCTGGCAATGTCCTGAATGTAAAGTGTGCCAAACCTGCAAGCAGCCAGGGGAAGACACAATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGCCAAGAGAAGAGGAATCGGGCAGAAACTTGTGTCTTGTGTAGTCACGCTCTGCCAAAGGAGAAGTGTCCCAATTGTATCAATGTCCATCAAACCGTTTGTGCACAAGCTGATTACTCTACACCGTGCAGTGCTAATAGCCCATTAACTGATAAAAGGCAATTGCTGCAGGAAAATGGCAGTGAGATCTCTAACACAGAGCTGTCAGAATGTGAAGCCAAACCACTAGGGATGTCAGAGATGAATCTGGATCCCCTTCAGAAGAAAGTTTCATCTGAAACACTGATGGAGCCTATATCGGATTCTATGTCTCTGGAGGATATTGTAACAACGGAAGAAGATGGTCCTTCCACTTCTGACAATGAAGCTGCTGAGGCACCxCxxxxATGACCxxxxCxGTTAAGGGAAAAAAGCCCACCCCCTTTGGAAGCTGAACTGCCACCTCTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTGGTCACTGTAGAAGATGAAGAAATGGAAACCGAAGATACAGAGACTGAGATTCATGAGGTGCAAAAGGAAGTGACTGGTTTAGCGCTTGTTAGCTCCAGCATTAAGACTGCTTCCCCTACTTTAGTTTCTGATACATCCCAGGCATGTGCCTCAGTGATTGAAGGCTCTGACATAAGGTTTACAGACACCGTACATCTAACTAGTGGGCCTTGTCAGAGTCCTTCAAAGACACCTAGCTGCTCTCAACAACCATCTCTTTCAGACTCTGAAATGACTATTGAGTCCGAAGATCCTCCCTGCCAGCCTAATACAGAGATGTTGAATAATGACAATACATTTTGTCAAGAACATTTTGGGGACTACTCTGTTAACAAAGATCAAGGGCCACTCAGGCCTGGTCTTATAAAGTCTGACATTGTAAATGAGATCTCTAATTTGAGCCAGGGGGACACCACAGGTAGCTATCATGGCTCTGATGCACTAGGTTCCCCTGACCCTGAGGGCGGGTCCCTCTCTATGGAGATGTGTTTGCATAAAGAGGATGGATCTTTGCGGTTGTGCAATGACTCTATAACAGAGACCGATGATTCTCTGCTCTATGATCCCTCTGGGGGAAAACTAGATGCTGAAAAGACACGTCGAAAAAGCTCACCAGGACGCTCAAGGGTTAAACAAGGTCGAAGTAGCAGCTTTCCTGGAAGAAGACGACCCCGAGGGGGAAGTGGTTCTGGAACTAGTCGAGGTAGAGGAAGATCTCGACTAAAATCTACAGCTTCTTCCATAGAGACTCTTCCGGTGGTAGATGTGGAGAGCTCTCCCAGCAAAGAGGAGGAGGAGGAAGAGGATGATACCATGCAGAACACAGTTGTGCTTTTTTCCAACACTGATAAGTTTGTTCTCATGCAGGACATGTGTGTTGTATGCGGTAGCTTTGGTCGAGGCTCAGAAGGGCATCTGCTAGCGTGTTCTCAGTGTTCTCAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTTGAAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     3     3     3     2     3     2     3     2     3     2     3     1     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     2     3     3     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     3     4     3     4     3     4     5     6     5     7     4     6     4     6     5     7     5     6     5     6     5     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     7    10     6     9     6     9     6     9     6     9     6     9     5     8     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     8     6     8     6     8     6     8     5     7     5     7     5     7     5     7     4     6     4     6
  5   1   2      ests                               Xt7.1-TNeu054n19.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGGACTGGACTGATCAATGTGGACAAAGCTGTATACTCAGGGATATCACAGAAATGTGAATACTGTAATCGGATGGGTGCTACCATTCATTGCCACTCGACAGGGTGTTTGCGCCGGTACCATTTTCCCTGCGCAGCTGCGAGTGGATCCTTCCAGTCCATGAAGACCTTAAAACTGCTGTGCACTGAACATCTTGGAGAAGCTATTGCAATGGATGACTCTCGTTGTGTGCTGTGCGACAAGCCTGGTGACCTCATAGACCTCCTCTTCTGCACCAGTTGCGGGCTGCACTATCATGGCACCCGTCTGGAAATCACAGTCTCGCCACTAAAACGCTCAAGCTGGCAATGTCCTGAATGTAAAGTGTGCCAAACCTGCAAGCAGCCAGGGGAAGACACAATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGCCAAGAGAAGAGGAATCGGGCAGAAACTTGTGTCTTGTGTAGTCACGCTCTGCCAAAGGAGAAGTGTCCCAATTGTATCAATGTCCATCAAACCGTTTGTGCACAAGCTGATTACTCTACACCGTGCAGTGCTAATAGCCCATTAACTGATAAAAGGCAATTGCTGCAGGAAAATGGCAGTGAGATCTCTAACACAGAGCTGTCAGAATGTGAAGCCAAACCACTAGGGATGTCAGAGATGAATCTGGATCCCCTTCAGAAGAAAGTTTCATCTGAAACACTGATGGAGCCTATATCGGATTCTATGTCTCTGGAGGATATTGTAACAACGGAAGAAGATGGTCCTTCCACTTCTGACAATGAAGCTGCTGAGGCACCTCTATAATGACCGTGCC
  5   1   2      ests                               Xt7.1-TGas089h02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAAAAGCCCACCCCCTTTGGAAGCTGAACTGCCACCTCTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTGGTCACTGTAGAAGATGAAGAAATGGAAACCGAAGATACAGAGACTGAGATTCATGAGGTGCAAAAGGAAGTGACTGGTTTAGCGCTTGTTAGCTCCAGCATTAAGACTGCTTCCCCTACTTTAGTTTCTGATACATCCCAGGCATGTGCCTCAGTGATTGAAGGCTCTGACATAAGGTTTACAGACACCGTACATCTAACTAGTGGGCCTTGTCAGAGTCCTTCAAAGACACCTAGCTGCTCTCAACAACCATCTCTTTCAGACTCTGAAATGACTATTGAGTCCGAAGATCCTCCCTGCCAGCCTAATACAGAGATGTTGAATAATGACAATACATTTTGTCAAGAACATTTTGGGGACTACTCTGTTAACAAAGATCAAGGGCCACTCAGGCCTGGTCTTATAAAGTCTGACATTGTAAATGAGATCTCTAATTTGAGCCAGGGGGACACCACAGGTAGCTATCATGGCTCTGATGCACTAGGTTCCCCTGACCCTGAGGGCGGGTCCCTCTCTATGGAGATGTGTTTGCATAAAGAGGATGGATCTTTGCGGTTGTGCAATGACTCTATAACAGAGACCGATGATTCTCTGCTCTATGATCCCTCTGGGGGAAAACTAGATGCTGAAAAGACACGTCGAAAAAGCTCACCAGGACGCTCAAGGGTTAAACAAGGTCGAAGTAGCAGCTTTCCTGGAAGAAGACGACCCCGAGGGGGAAGTGGTTCTGGAACTAGTCGAGGTAGAGGAAGATCTCGACTAAAATCTACAGCTTCTTCCATAGAGACTCTTCCGGTGGTAGATGTGGAGAGCTCTCCCAGCAAAGAGGAGGAGGAGGAAGAGGATGATACCATGCAGAACACAGTTGTGCTTTTTTCCAACACTGATAAGTTTGTTCTCATGCAGGACATGTGTGTTGTATGCGGTAGCTTTGGTCGAGGCTCAGAAGGGCATCTGCTAGCGTGTTCTCAGTGTTCTCAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAAAGAAGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGAGGTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAGAAGAACG
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sc ---- 2e-011     NP_012653.1 Hypothetical ORF; Yjr119cp [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 2e-018     BAE06775.1 zinc finger protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 5e-018     BAA77571.1 Requiem protein [Xenopus laevis] ---------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 3e-018     AAH75306.1 D4, zinc and double PHD fingers family 2 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 4e-049     NP_499819.1 myeloid lymphoid mixed-lineage like (3O745) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 2e-062     NP_611847.2 CG5591-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 1e-103     XP_795757.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 2e-118     XP_689216.1 PREDICTED: similar to Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog (Histone-lysine N-methyltransferase, H3 lysine-4 specific MLL3) [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       
                                                                       ...PREDICTED - Mm ---- 3e-169     XP_001002529.1 PREDICTED: myeloid/lymphoid or mixed-lineage leukemia 3 isoform 4 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---- 0          XP_423552.2 PREDICTED: similar to ALR, partial [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_003473.1 myeloid/lymphoid or mixed-lineage leukemia 2; ALL1-related gene [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas089h02.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------ATG------------------ATG---------------------------------------------------------------------------TAATGA---------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2      ests                               Xt7.1-TNeu054n19.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGGACTGGACTGATCAATGTGGACAAAGCTGTATACTCAGGGATATCACAGAAATGTGAATACTGTAATCGGATGGGTGCTACCATTCATTGCCACTCGACAGGGTGTTTGCGCCGGTACCATTTTCCCTGCGCAGCTGCGAGTGGATCCTTCCAGTCCATGAAGACCTTAAAACTGCTGTGCACTGAACATCTTGGAGAAGCTATTGCAATGGATGACTCTCGTTGTGTGCTGTGCGACAAGCCTGGTGACCTCATAGACCTCCTCTTCTGCACCAGTTGCGGGCTGCACTATCATGGCACCCGTCTGGAAATCACAGTCTCGCCACTAAAACGCTCAAGCTGGCAATGTCCTGAATGTAAAGTGTGCCAAACCTGCAAGCAGCCAGGGGAAGACACAATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGCCAAGAGAAGAGGAATCGGGCAGAAACTTGTGTCTTGTGTAGTCACGCTCTGCCAAAGGAGAAGTGTCCCAATTGTATCAATGTCCATCAAACCGTTTGTGCACAAGCTGATTACTCTACACCGTGCAGTGCTAATAGCCCATTAACTGATAAAAGGCAATTGCTGCAGGAAAATGGCAGTGAGATCTCTAACACAGAGCTGTCAGAATGTGAAGCCAAACCACTAGGGATGTCAGAGATGAATCTGGATCCCCTTCAGAAGAAAGTTTCATCTGAAACACTGATGGAGCCTATATCGGATTCTATGTCTCTGGAGGATATTGTAACAACGGAAGAAGATGGTCCTTCCACTTCTGACAATGAAGCTGCTGAGGCACCTCTATAATGACCGTGCC
                                                  Xt7.1-CHK-1008250939                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGGACTGATCAATGTGGACAAAGCTGTATACTCAGGGATATCACAGAAATGTGAATACTGTAATCGGATGGGTGCTACCATTCATTGCCACTCGACAGGGTGTTTGCGCCGGTACCATTTTCCCTGCGCAGCTGCGAGTGGATCCTTCCAGTCCATGAAGACCTTAAAACTGCTGTGCACTGAACATCTTGGAGAAGCTATTGCAATGGATGACTCTCGTTGTGTGCTGTGCGACAAGCCTGGTGACCTCATAGACCTCCTCTTCTGCACCAGTTGCGGGCTGCACTATCATGGCACCCGTCTGGAAATCACAGTCTCGCCACTAAAACGCTCAAGCTGGCAATGTCCTGAATGTAAAGTGTGCCAAACCTGCAAGCAGCCAGGGGAAGACACAATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGCCAAGAGAAGAGGAATCGGGCAGAAACTTGTGTCTTGTGTAGTCACGCTCTGCCAAAGGAGAAGTGTCCCAATTGTATCAATGTCCATCAAACCGTTTGTGCACAAGCTGATTACTCTACACCGTGCAGTGCTAATAGCCCATTAACTGATAAAAGGCAATTGCTGCAGGAAAATGGCAGTGAGATCTCTAACACAGAGCTGTCAGAATGTGAAGCCAAACCACTAGGGATGTCAGAGATGAATCTGGATCCCCTTCAGAAGAAAGTTTCATCTGAAACACTGATGGAGCCTATATCGGATTCTATGTCTCTGGAGGATATTGTAACAACGGAAGAAGATGGTCCTTCCACTTCTGACAATGAAGCTGCTGAGGCACCTCTATAATGAC
  5   1   2       bld Gas       in                   TGas065b24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGGACTGGACTGATCAATGTGGACAAAGCTGTATACTCAGGGATATCACAGAAATGTGAATACTGTAATCGGATGGGTGCTACCATTCATTGCCACTCGACAGGGTGTTTGCGCCGGTACCATTTTCCCTGCGCAGCTGCGAGTGGATCCTTCCAGTCCATGAAGACCTTAAAACTGCTGTGCACTGAACATCTTGGAGAAGCTATTGCAATGGATGACTCTCGTTGTGTGCTGTGCGACAAGCCTGGTGACCTCATAGACCTCCTCTTCTGCACCAGTTGCGGGCTGCACTATCATGGCACCCGTCTGGAAATCACAGTCTCGCCACTAAAACGCTCAAGCTGGCAATGTCCTGAATGTAAAGTGTGCCAAACCTGCAAGCAGCCAGGGGAAGACACAATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGC
  5   1   2       bld Neu                            TNeu054n19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGCTGCACTATCATGGCACCTGTCTGGAAATCACAGTCTCGCCACTAAAACGCTCAGGCTGGCAATGTCCTGAATGTAAAGTGTGCCAAACCTGCAGGCAGCCAGGGGAAGACACAATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGCCAAGAGAAGAGGAATCGGGCAGAAACTTGTGTCTTGTGTAGTCACGCTCTGCCAAAGGAGAAGTGTCCCAATTGTATCAATGTCCATCAAACCGTTTGTGCACAAGCTGATTACTCTACACCGTGCAGTGCTAATAGCCCATTAACTGATAAAAGGCAATTGCTGCAGGAAAATGGCAGTGAGATCTCTAACACAGAGCTGTCAGAATGTGAAGCCAAACCACTAGGGATGTCAGAGATGAATCTGGATCCCCTTCAGAAGAAAGTTTCATCTGAAACACTGATGGAGCCTAT
  5   1   2      seed Neu       in                   TNeu118a06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGCCAAGAGAAGAGGAATCGGGCAGAAACTTGTGTCTTGTGTAGTCACGCTCTGCCAAAGGAGAAGTGTCCCAATTGTATCAATGTCCATCAAACCGTTTGTGCACAAGCTGATTACTCTACACCGTGCAGTGCTAATAGCCCATTAACTGATAAAAGGCAATTGCTGCAGGAAAATGGCAGTGAGATCTCTAACACAGAGCTGTCAGAATGTGAAGCCAAACCACTAGGGATGTCAGAGATGAATCTGGATCCCCTTCAGAAGAAAGTTTCATCTGAAACACTGATGGAGCCTATATCGGATTCTATGTCTCTGGAGGATATTGTAACAACGGAAGAAGATGGTCCTTCCACTTCTGACAATGAAGCTGCTGAGGCACCTCTATAATGACCGTGCCGT
  5   1   2      ests                               Xt7.1-TGas089h02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAAAAGCCCACCCCCTTTGGAAGCTGAACTGCCACCTCTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTGGTCACTGTAGAAGATGAAGAAATGGAAACCGAAGATACAGAGACTGAGATTCATGAGGTGCAAAAGGAAGTGACTGGTTTAGCGCTTGTTAGCTCCAGCATTAAGACTGCTTCCCCTACTTTAGTTTCTGATACATCCCAGGCATGTGCCTCAGTGATTGAAGGCTCTGACATAAGGTTTACAGACACCGTACATCTAACTAGTGGGCCTTGTCAGAGTCCTTCAAAGACACCTAGCTGCTCTCAACAACCATCTCTTTCAGACTCTGAAATGACTATTGAGTCCGAAGATCCTCCCTGCCAGCCTAATACAGAGATGTTGAATAATGACAATACATTTTGTCAAGAACATTTTGGGGACTACTCTGTTAACAAAGATCAAGGGCCACTCAGGCCTGGTCTTATAAAGTCTGACATTGTAAATGAGATCTCTAATTTGAGCCAGGGGGACACCACAGGTAGCTATCATGGCTCTGATGCACTAGGTTCCCCTGACCCTGAGGGCGGGTCCCTCTCTATGGAGATGTGTTTGCATAAAGAGGATGGATCTTTGCGGTTGTGCAATGACTCTATAACAGAGACCGATGATTCTCTGCTCTATGATCCCTCTGGGGGAAAACTAGATGCTGAAAAGACACGTCGAAAAAGCTCACCAGGACGCTCAAGGGTTAAACAAGGTCGAAGTAGCAGCTTTCCTGGAAGAAGACGACCCCGAGGGGGAAGTGGTTCTGGAACTAGTCGAGGTAGAGGAAGATCTCGACTAAAATCTACAGCTTCTTCCATAGAGACTCTTCCGGTGGTAGATGTGGAGAGCTCTCCCAGCAAAGAGGAGGAGGAGGAAGAGGATGATACCATGCAGAACACAGTTGTGCTTTTTTCCAACACTGATAAGTTTGTTCTCATGCAGGACATGTGTGTTGTATGCGGTAGCTTTGGTCGAGGCTCAGAAGGGCATCTGCTAGCGTGTTCTCAGTGTTCTCAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTT
                                                  Xt7.1-CHK-1008230684                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCCCACCCCCTTTGGAAGCTGAACTGCCACCTCTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTGGTCACTGTAGAAGATGAAGAAATGGAAACCGAAGATACAGAGACTGAGATTCATGAGGTGCAAAAGGAAGTGACTGGTTTAGCGCTTGTTAGCTCCAGCATTAAGACTGCTTCCCCTACTTTAGTTTCTGATACATCCCAGGCATGTGCCTCAGTGATTGAAGGCTCTGACATAAGGTTTACAGACACCGTACATCTAACTAGTGGGCCTTGTCAGAGTCCTTCAAAGACACCTAGCTGCTCTCAACAACCATCTCTTTCAGACTCTGAAATGACTATTGAGTCCGAAGATCCTCCCTGCCAGCCTAATACAGAGATGTTGAATAATGACAATACATTTTGTCAAGAACATTTTGGGGACTACTCTGTTAACAAAGATCAAGGGCCACTCAGGCCTGGTCTTATAAAGTCTGACATTGTAAATGAGATCTCTAATTTGAGCCAGGGGGACACCACAGGTAGCTATCATGGCTCTGATGCACTAGGTTCCCCTGACCCTGAGGGCGGGTCCCTCTCTATGGAGATGTGTTTGCATAAAGAGGATGGATCTTTGCGGTTGTGCAATGACTCTATAACAGAGACCGATGATTCTCTGCTCTATGATCCCTCTGGGGGAAAACTAGATGCTGAAAAGACACGTCGAAAAAGCTCACCAGGACGCTCAAGGGTTAAACAAGGTCGAAGTAGCAGCTTTCCTGGAAGAAGACGACCCCGAGGGGGAAGTGGTTCTGGAACTAGTCGAGGTAGAGGAAGATCTCGACTAAAATCTACAGCTTCTTCCATAGAGACTCTTCCGGTGGTAGATGTGGAGAGCTCTCCCAGCAAAGAGGAGGAGGAGGAAGAGGATGATACCATGCAGAACACAGTTGTGCTTTTTTCCAACACTGATAAGTTTGTTCTCATGCAGGACATGTGTGTTGTATGCGGTAGCTTTGGTCGAGGCTCAGAAGGGCATCTGCTAGCGTGTTCTCAGTGTTCTCAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTTGAAGAT
  5   1   2       bld Gas                            TGas020f15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGGGGGAAGACACAATGATGCTTGTATGTGATGCCTGTGACAAGGGATATCACACCTTTTGTTTAAAACCAGCTATTGAGTGCTTGCCCACTGACTCATGGAAGTGCAAGACCTGCCGTGTTTGTCGCATATGTGGGTCTCGGACAGCACACATGGAACCTGGCAGTCAGTGGTATGACAATTATTCAGTGTGTTCAAAATGCCAAGAGAAGAGGAATCGGGCAGAAACTTGTGTCTTGTGTAGTCACGCTCTGCCAAAGGAGAAGTGTCCCAATTGTATCAATGTCCATCAAACCGTTTGTGCACAAGCTGATTACTCTACACCGTGCAGTGCTAATAGCCCATTAACTGATAAAAGGCAATTGCTGCAGGAAAATGGCAGTGAGATCTCTAACACAGAGCTGTCAGAATGTGAAGCCAAACCACTAGGGATGTCAGAGATGAATCTGGATCCCCTTCAGAAGAAAGTTTCATCTGAAACACTGATGGAGCCTATATCGGATTCTATGTCTCTGGAGGATATTGTAACAACGGAAGAAGATGGTCCTTCCACTTCTGACAATGAAGCTGCTGAGGCACCTCCTATAATGACCGTGCCGTTAAGGGAAAAAAGCCCACCCNCTTTGGAAGCTGAACTGCCACCTCTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTG
  5   1   2       bld Gas0      in                         dad34c07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGCTGGAGGATTTGTTCAACGGAAGAAGAGGTCCTTCCACTTCTGACAATGAAGCTGCTGAGGCACCTCCTATAATGACCGTGCCGTTAAGGGGAAAAAAGCCCACCCCCTTTGGAAGCTGAACTGCCACCTCTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTGGTCACTGTAGAAGATGAAGAAATGGAAACCGAAGATACAGAGACTGAGATTCATGAGGTGCAAAAGGAAGTGACTGGTTTAGCGCTTGTTAGCTCCAGCATTAAGACTGCTTCCCCTACTTTAGTTTCTGATACATCCCAGGCATGTGCCTCAGTGATTGAAGGCTCTGACATAAGGTTTACAGACACCGTACATCTAACTAGTGGGCCTTGTCAGAGTCCTTCAAAGACACCTAGCTGCTCTCAACAACCATCTCTTTCAGACTCTGAAATGACTATTGAGTCCGAAGATCCTCCCTGCCAGCCTAATACAGAGATGTTGAATAATGACAATACAT
  5   1   2       bld Gas       in                  TGas089h02.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGCTGAACTGCCACCTCTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTGGTCACTGTAGAAGATGAAGAAATGGAAACCGAAGATACAGAGACTGAGATTCATGAGGTGCAAAAGGAAGTGACTGGTTTAGCGCTTGTTAGCTCCAGCATTAAGACTGCTTCCCCTACTTTAGTTTCTGATACATCCCAGGCATGTGCCTCAGTGATTGAAGGCTCTGACATAAGGTTTACAGACACCGTACATCTAACTAGTGGGCCTTGTCAGAGTCCTTCAAAGACACCTAGCTGCTCTCAACAACCATCTCTTTCAGACTCTGAAATGACTATTGAGTCCGAAGATCCTCCCTGCCAGCCTAATACAGAGATGTTGAATAATGACAATACATTTTGTCAAGAACATTTTGGGGACTACTCTGTTAACAAAGATCAAGGGCCACTCAGGCCTGGTCTTATAAAGTCTGACATTGTAAATGAGATCTCTAATTTGAGCCAGGGGGACACCACAGGTAGCTATCATGGCTCTGATGCACTAGGTTCCCCTGACCCTGAGGGCGGGTCCCTCTCTATGGAGATGTGTTTGCATAAAGA
  5   1   2       bld Gas7      in                         XZG48151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTAAACACCATGTCTGATGCTTGTGATTTACTTGATGAGGCTCCTGTGCTGGTCACTGTAGAAGATGAAGAAATGGAAACCGAAGATACAGAGACTGAGATTCATGAGGTGCAAAAGGAAGTGACTGGTTTAGCGCTTGTTAGCTCCAGCATTAAGACTGCTTCCCCTACTTTAGTTTCTGATACATCCCAGGCATGTGCCTCAGTGATTGAAGGCTCTGACATAAGGTTTACAGACACCGTACATCTAACTAGTGGGCCTTGTCAGAGTCCTTCAAAGACACCTAGCTGCTCTCAACAACCATCTCTTTCAGACTCTGAAATGACTATTGAGTCCGAAGATCCTCCCTGCCAGCCTAATACAGAGATGTTGAATAATGACAATACATTTTGTCAAGAACATTTTGGGGACTACTCTGTTAACAAAGATCAAGGGCCACTCAGGCCTGGTCTTATAAAGCCTGACATTGCAAATGAGATCTCTAATTTGAGCCCAGGGGGACACCACAGGTAGCTATCATGCCTCTGATGCACTAGGTTCCCCTGACCCTGAGGGCG
  5   1   2       bld Egg                            TEgg144e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGCTCTGTTACAAAGATCAAGGGCCACTCAGGCCTGGTCTTATAAAGTCTGACATTGTAAATGAGATCTCTAATTTGAGCCAGGGGGACACCACAGGTAGCTATCATGGCTCTGATGCACTAGGTTCCCCTGACCCTGAGGGCGGGTCCCTCTCTATGGAGATGTGTTTGCATAAAGAGGATGGATCTTTGCGGTTGTGCAATGACTCTATAACAGAGACCGATGATTCTCTGCTCTATGATCCCTCTGGGGGAAAACTAGATGCTGAAAAGACACGTCGAAAAAGCTCACCAGGACGCTCAAGGGTTAAACAAGGTCGAAGTAGCAGCTTTCCTGGAAGAAGACGACCCCGAGGGGGAAGTGGTTCTGGAACTAGTCGAGGTAGAGGAAGATCTCGACTAAATCTACAGCTTCTTCCATAGAGACTCTTCCGGTGGTAGATGTGGAGAGCTCTCCCAGCAAAGAGGAGGAGGAGGAAGAGGATGATACCATGCAGAACACAGTTGTGCTTTTTTCCAACACTGATAAGTTTGTTCTCATGCAGACATGTGTGTTGTATGCGTAGCTTTGGTCGAGGCTCAAAAGGGCATCTGCTAGCGTGTTCTCATGTTCTCAGTGTTATCATCCATACTGTGTAAATACAGATCACCAAGGTGATGCTTCTAAAGGGCTTGCCATGTGTGGAGTGCATTGTC
  5   1   2       bld Neu       in                   TNeu106m09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCGGGTCCCTCTCTATGGAGATGTGTTTGCATAAAGAGGATGGATCTTTGCGGTTGTGCAATGACTCTATAACAGAGACCGATGATTCTCTGCTCTATGATCCCTCTGGGGGAAAACTAGATGCTGAAAAGACACGTCGAAAAAGCTCACCAGGACGCTCAAGGGTTAAACAAGGTCGAAGTAGCAGCTTTCCTGGAAGAAGACGACCCCGAGGGGGAAGTGGTTCTGGAACTAGTCGAGGTAGAGGAAGATCTCGACTAAAATCTACAGCTTCTTCCATAGAGACTCTTCCGGTGGTAGATGTGGAGAGCTCTCCCAGCAAAGAGGAGGAGGAGGAAGAGGATGATACCATGCAGAACACAGTTGTGCTTTTTTCCAACACTGATAAGTTTGTTCTCATGCAGGACATGTGTGTTGTATGCGGTAGCTTTGGTCGAGGCTCAGAAGGGCATCTGCTAGCGTGTTCTCAGTGTTCTCAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAG
  5   1   2       bld Egg       in                   TEgg033p21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTCTATGGAGATGTGTTTGCATAAAGAGGATGGATCTTTGCGGTTGTGCAATGACTCTATAACAGAGACCGATGATTCTCTGCTCTATGATCCCTCTGGGGGAAAACTAGATGCTGAAAAGACACGTCGAAAAAGCTCACCAGGACGCTCAAGGGTTAAACAAGGTCGAAGTAGCAGCTTTCCTGGAAGAAGACGACCCCGAGGGGGAAGTGGTTCTGGAACTAGTCGAGGTAGAGGAAGATCTCGACTAAAATCTACAGCTTCTTCCATAGAGACTCTTCCGGTGGTAGATGTGGAGAGCTCTCCCAGCAAAGAGGAGGAGGAGGAAGAGGATGATACCATGCAGAACACAGTTGTGCTTTTTTCCAACACTGATAAGTTTGTTCTCATGCAGGACATGTGTGTTGTATGCGGTAGCTTTGGTCGAGGCTCAGAAGGGCATCTGCTACCGTGTTCTCAGTGTTCTCAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAA
  5   1   2       bld Gas                            TGas030k22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTTGTATGCGGTAGCTTTGGTCGAGGCTCAGAAGGCATCTGCTAGCGTGTTCTCAGTGTTCTCAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTC
  3   1   2      seed Gas       in                    TGas089h02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTGTTATCATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTTGAAGATTTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu106m09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCCATACTGTGTAAATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTGAAGATTTAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT70776.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACATAGCAGGATCACCAAGGTGATGCTTCTAAAGGGCTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTATCAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAATTACCACACATATTGCCTAGATCCACCACTACCTACAGTGCCCAAGGGTGACTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGT
  3   1   2       bld Tad5      in                         XZT70776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGCGATGTGTGGAGTGCATTGTCTGTGAAGTGTGTGGGAAAGCTACAGACCCTTCTCGCTTACTGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTTGAAGATGTT
  3   1   2       bld Gas8      out                         st56g09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTCTGTGATGACTGTGATATCAGTTACCACACATATTGCCTAGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGCTGCTTCTTCTGCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACCAGAGGCAATGGGCAGCCCCGAANCGGGAAGC
  3   1   2       bld Gas7      in                         XZG48151.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATCCACCACTACATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas       in                    TGas065b24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATACAGTGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAGAAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCTTGGAGTGTGATATAAAGA
  3   1   2       bld Egg       in                    TEgg033p21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCCCAAGGGTGGCTGGAAATGCAGATGGTGTGTGAGCTGCATGCAGTGTGGTGCAGTCACTCCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGCTGCTTCTTCTGCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTTGAAGATGTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas0      in                         dad34c07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGGATTTCGTTCAGAGTGGCAAAATAACTATACACATTGTGCACCATGTGCCAGTCTGGTAAGCTGTCCTGTTTGTCACCTTAAGTACTTGGAGGGAGATCTTCTTATCCAGTGTCGTCACTGCGAGAGGTGGCTACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCCTAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGCTTAAGGAACCAGAACCCCAGTACTTCCGTTTCGATGGAGTTTGGTTAACTGAAGCAGGCATGGCAGTGTTGAGAAGTCTTTCTCTGTCTCCAATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAACCAGTAAAAGGCATGGAAGATGTTGAAGATGTTAAAAAA
  3   1   2       bld Gas       out                   TGas051l15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACATGCTGTGTGTGAAAATTTGTTCACGGAAGAAGAGGTTGAGCAGGCTGCAGATGAGGGCTTTGACTGCTCATCATGTCAGCCATTCATCCATAAGCCAGTGGTTCCAATTGTCATTCCAGAAAGTCCAGTAAAGTTTAAGGACCCAGTTGTTTTTTTTGCAGAACCCCAGTATTTCGGTTTGGAGGGAGTTTGTTAAACTAAAGCAGGCATGGCAGTGTTGAAAAGTTTTTTTTTGTCTCCAATTAAAAAAAAGAAGCCCCGATTTTCACGTTTATGCACAGGAGGAGAGGTTTTTATTGATGCCCCTGACACAGTGGGGACAGAAGAACGCAAAGAGGGGGAAGTTGAGT
  3   1   2       bld Neu       in                    TNeu118a06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATTCAAAAAAAGAAGCCCCGACGTTCACGGTTATGCACAGGAGGAGAGGTTTTTATTGATGGCCCTGACACAGTAGGGACAGAAGAACGCAAAGAAGGGGAAGTTGAGTGTGAAGATCATAAATCTGACCACTGCAATGTGGAGCCCATGGAGTGTGATATAAAGACAGAGGCAATGGGCAGCCCCGAACGGGAAGCATGTGCAGAGACAGAANCCAGTAAAAGGCATGGAAGATGTTGAAGATGTAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)