Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 40%

 1012155394 Xt7.1-CAAQ1659.3.5 - 22 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAQ1659.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGTACCCTACAATCTCACCTGTCTTGCCCCTGTGGCCAAGCCGGCGGCAGAGATCACCTGGTACCGCGATGGCAAGAAGCTGGATTCAGCTGTCTACACCAAGGAGCTTCTGTCCGACGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGCTAATCACCCCAAGTCTGGCGGATTCCGGATCCAGTTACACCTGCCGCGTGAGGAACGAGGCCCTGCCAGAGGGCAGAGAGAAGTCCGTGACGCTGAGTGTGCAGTATCCCCCCAAAGTAACGCTGTCGGTAGAACCCCCGACTATCACCGAGGGCGGTTCCGTCACTTTTCTATGTGGTGCCGTTTCCAACCCAGAAGTGACTGGATACAGGTGGGCAAAGGGGGGTGTCCCTCTGGCCGTATCTGGAGACAAATACACCGTGGAGGTGGATCACACTTTCTTCACTGCCCCGGTCTCGTGCGAGGTGTCCAACAGCGTGGGAGCCAGTAACGTCAGTACGGCCGTCAATGTGCTGTTTGGGCCACGCCTCCTCACGGAGCCCCGCCCCATGACGGTGGACATAGGTGATGACGCCTCCTTCTTTTGTGGCTGGACTGGAAATCCGACGCCTACCCAGTTCTGGAGCAAGAAAGGAACCGGAGAGGTTCTCAGCAATGGAAACACTCTGCTGCTGACCAAAGTAACTCGGGAAGATGCCGGGATCTACGTCTGTAAAGCCATCGTGCCGCGAATGGGGAGTACGGAGAAAGAAGTGACCCTCACAGTGAGAGGGCCACCAATCATCACTAGCGAGATGCACTATGAGACCACACTTGGAGGAAAGGCACGGATGGAGTGCCTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCATGGGACAAGCAAAGCCTGGAGGACGGTTCGTGGGGTCGTTTCTCAGTCGAGACCGAAGTGACTGAAGTTGGTGCCATCTCCGTCCTGGTCATTGATGGAGCAGAGCAGTCAGATTTTCTCACTGAGTTCAACTGCAGCGCCATCAATCAGTATGGGGAGGATTCGGTCATCGTTTCTCTGCGGCAGCAAGCCGCTCTTCCTCTGACGCTCTTGCTGATTGCCGTCGGCTCGGGGACCCTGTGCATCTTTGTACTCGTCATCACTTCCATCCTTTGTTGCCGACGACCAAAAAAAGCCGTGAAGGACACACAGATTCTAGCCGTGGACGTGTCAGGGAGCGAGCCCAGCGAGAGGCACCCTAGCGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACCGAATCCCAGAGGACATCTCAGACCGAGCACAGCGATATCCCTGATGAGCCCCAGGACCCAACCAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCCGGCCTACAACCATAACGTACCCAGAATTCTCCTCTCCACCGCGTCCCCTCTACTCAACCACATCTTCTCTGTCGCCGCTGTGCCCCACCCCTTCTGGGCCTCCTAAAATCTACGATTACGCTCATCGCTACGCCACCACTCCCAGGTCTGGAGGCCACCACATGCCCCAGGGGTCATCGTCTCATTTGCCGCAAGGAACGACTCATTTGCCCCAAGGCCCCATGCATTTACCACAGGTCCCAACTCATTTGCCACAAGCTCCGACTTATTTACCACAAGGCCCGACACATTTGCCACAAGGCCCAACTCATTTGCCACAGGGACCAACTCATTTGCCACATGGACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGTAAAGGCGAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008267268                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTACAATCTCACCTGTCTTGCCCCTGTGGCCAAGCCGGCGGCAGAGATCACCTGGTACCGCGATGGCAAGAAGCTGGATTCAGCTGTCTACACCAAGGAGCTTCTGTCCGACGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGCTAATCACCCCAAGTCTGGCGGATTCCGGATCCAGTTACACCTGCCGCGTGAGGAACGAGGCCCTGCCAGAGGGCAGAGAGAAGTCCGTGACGCTGAGTGTGCAGTATCCCCCCAAAGTAACGCTGTCGGTAGAACCCCCGACTATCACCGAGGGCGGTTCCGTCACTTTTCTATGTGGTGCCGTTTCCAACCCAGAAGTGACTGGATACAGGTGGGCAAAGGGGGGTGTCCCTCTGGCCGTATCTGGAGACAAATACACCGTGGAGGTGGATCACACTTTCTTCACTGCCCCGGTCTCGTGCGAGGTGTCCAACAGCGTGGGAGCCAGTAACGTCAGTACGGCCGTCAATGTGCTGTTTGGGCCACGCCTCCTCACGGAGCCCCGCCCCATGACGGTGGACATAGGTGATGACGCCTCCTTCTTTTGTGGCTGGACTGGAAATCCGACGCCTACCCAGTTCTGGAGCAAGAAAGGAACCGGAGAGGTTCTCAGCAATGGAAACACTCTGCTGCTGACCAAAGTAACTCGGGAAGATGCCGGGATCTACGTCTGTAAAGCCATCGTGCCGCGAATGGGGAGTACGGAGAAAGAAGTGACCCTCACAGTGAGAGGGCCACCAATCATCACTAGCGAGATGCACTATGAGACCACACTTGGAGGAAAGGCACGGATGGAGTGCCTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCATGGGACAAGCAAAGCCTGGAGGACGGTTCGTGGGGTCGTTTCTCAGTCGAGACCGAAGTGACTGAAGTTGGTGCCATCTCCGTCCTGGTCATTGATGGAGCAGAGCAGTCAGATTTTCTCACTGAGTTCAACTGCAGCGCCATCAATCAGTATGGGGAGGATTCGGTCATCGTTTCTCTGCGGCAGCAAGCCGCTCTTCCTCTGACGCTCTTGCTGATTGCCGTCGGCTCGGGGACCCTGTGCATCTTTGTACTCGTCATCACTTCCATCCTTTGTTGCCGACGACCAAAAAAAGCCGTGAAGGACACACAGATTCTAGCCGTGGACGTGTCAGGGAGCGAGCCCAGCGAGAGGCACCCTAGCGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACCGAATCCCAGAGGACATCTCAGACCGAGCACAGCGATATCCCTGATGAGCCCCAGGACCCAACCAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCCGGCCTACAACCATAACGTACCCAGAATTCTCCTCTCCACCGCGTCCCCTCTACTCAACCACATCTTCTCTGTCGCCGCTGTGCCCCACCCCTTCTGGGCCTCCTAAAATCTACGATTACGCTCATCGCTACGCCACCACTCCCAGGTCTGGAGGCCACCACATGCCCCAGGGGTCATCGTCTCATTTGCCGCAAGGAACGACTCATTTGCCCCAAGGCCCCATGCATTTACCACAGGTCCCAACTCATTTGCCACAAGCTCCGACTTATTTACCACAAGGCCCGACACATTTGCCACAAGGCCCAACTCATTTGCCACAGGGACCAACTCATTTGCCACATGGACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGTAAAGGCGAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     7     8     9     9     9     9     9     9     8     9     8     9     9    10     9    10     9    10     9    10    10    10    10    10    11    11    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     7     9     7     9     7     9     9     9     9     9     9     9     9     9     9     9     9     9     6     9     5     7     5     7     5     5     2     4     3     4
  5   1   2      ests                                  Xt7.1-st39a20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCGGATTCATCCAGGGACACCTACCCCGGGCATCCTATCCCTGCCCCGACTACCCCACACTCTGGGCTACAAACCCACTCAGGAGAGGAGGCAGCAAGTGGTGGAAATGAAGAATCTCTGGCTGTTACTTTGGATCCATGTGGGGCTCCTACTGGGGAAAAGTTTTGGGGCCCATTTCTCGCAACAACCCTCGGACAAGGTAATCGTGGCCGGCAAATCGGTGACCCTTCCCTGCGTAGTGATTGGCTACAGAGGCGTGGTCCAGTGGACGATGGACGGGCTGGCACTGGGAGCTGAAAGAGACCTTCCAGGGTGGTCCCGTTATTCTGTGGTGGGAGACCCTTCTCTAGGGGAACATAACCTGCACATTGAAGGGGTTGAGCTTAGTGACGATGCCATCTACGAGTGCCAAGCGACCCAGGCAGCGCTGAGGTCACAGCGGGCACGTCTCACTGTGCTACTTCCCCCTGGAGATCCAATGATACCAGGCTCCCCAGTTGCCAATGTCCTGCTTAACGTACCCTACAATCTCACCTGTCTTGCCCCTGTGGCCAAGCCGGCGGCAGAGATCACCTGGTACCGCGATGGCAAGAAGCTGGATTCAGCTGTCTACACCAAGGAGCTTCTGTCCGACGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGCTAATCACCCCAAGTCTGGCGGATTCCGGATCCAGTTACACCTGCCGCGTGAGGAACGAGGCCCTGCCAGAGGGCAGAGAGAAGTCCGTGACGCTGAGTGTGCAGTATCCCCCCAAAGTAACGCTGTCGGTAGAACCCCCGACTATCACCGAGGGCGGTTCCGTCACTTTTCTATGTGGTGCCGTTTCCAACCCAGAAGTGACTGGATACAGGTGGGCAAAGGGGGGTGTCCCTCTGGCCGTATCTGGAGACAAATACACCGTGGAGGTGGATCACACTTTCTTCACTGCCCCGGTCTCGTGCGAGGTGTCCAACAGCGTGGGAGCCAGTAACGTCAGTACGGCCGTCAATGTGCTGTTTGGGCCACGCCTCCTCACGGAGCCCCGCCCCATGACGGTGGACATAGGTGATGACGCCTCCTTCTTTTGTGGCTGGACTGGAAATCCGACGCCTACCCAGTTCTGGAGCAAGAAAGGAACCGGAGAGGTTCTCAGCAATGGAAACACTCTGCTGCTGACCAAAGTAACTCGGGAAGATGCCGGGATCTACGTCTGTAAAGCCATCGTGCCGCGAATGGGGAGTACGGAGAAAGAAGTGACCCTCACAGTGAGAGGGCCACCAATCATCACTAGCGAGATGCACTATGAGACCACACTTGGAGGAAAGGCACGGATGGAGTGCCTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCATGGGACAAGCAAAGCCTGGAGGACGGTTCGTGGGGTCGTTTCTCAGTCGAGACCGAAGTGACTGAAGTTGGTGCCATCTCCGTCCTGGTCATTGATGGAGCAGAGCAGTCAGATTTTCTCACTGAGTTCAACTGCAGCGCCATCAATCAGTATGGGGAGGATTCGGTCATCG
  5   1   2      ests                                 Xt7.1-CAAQ1659.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCACAGCGATATCCCTGATGAGCCCCAGGACCCAACCAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCCGGCCTACAACCATAACGTACCCAGAATTCTCCTCTCCACCGCGTCCCCTCTACTCAACCACATCTTCTCTGTCGCCGCTGTGCCCCACCCCTTCTGGGCCTCCTAAAATCTACGATTACGCTCATCGCTACGCCACCACTCCCAGGTCTGGAGGCCACCACATGCCCCAGGGGTCATCGTCTCATTTGCCGCAAGGAACGACTCATTTGCCCCAAGGCCCCATGCATTTACCACAGGTCCCAACTCATTTGCCACAAGCTCCGACTTATTTACCACAAGGCCCGACACATTTGCCACAAGGCCCAACTCATTTGCCACAGGGACCAACTCATTTGCCACATGGACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGTAAAGGCGAAAAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------C---
                                               BLH ATG    -409      62                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Sc ---- 2e-011     NP_010141.1 RNA polymerase II large subunit; Rpo21p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 2e-012     BAC57517.1 neural cell adhesion molecule homologue [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 1e-020     AAI36020.1 Unknown (protein for MGC:122264) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PREDICTED - Sp ---- 1e-021     XP_796903.2 PREDICTED: similar to CG33141-PB [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 1e-028     NP_508457.3 SYnaptoGenesis abnormal family member (syg-1) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 1e-043     NP_726844.1 CG3653-PA, isoform A [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ---- 5e-052     XP_423078.2 PREDICTED: similar to NEPH1 protein, partial [Gallus gallus] -------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 1e-114     NP_115920.1 NEPH2 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 9e-117     NP_570937.2 X kin of IRRE like 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Dr ---- 2e-159     XP_694625.1 PREDICTED: similar to membrane protein mKirre [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xl ---- 0          AAH57728.1 MGC68902 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - ?? ---- 0          NP_001079957.1 hypothetical protein LOC379648 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAQ1659.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------TGA------------------------------------------ATG------------TAG------------------------------------------------------------------------------------------------------------------ATG------------------TAATGA---------------------------------------TAG---------------------------------------------------------------------------ATG------------------------------------------------------------------TAA------------------TGA---------TAATAA---------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TAG---ATG------------------------TAG------TAATAA------------------TGA---------------------------------------------------------------------------------------------TGA---------------------------------------------------------------TAA---------------------ATG---------TAA------------------------------------------------------------------------------------------ATG------------------ATG---------TAA------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2      ests                                  Xt7.1-st39a20.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCGGATTCATCCAGGGACACCTACCCCGGGCATCCTATCCCTGCCCCGACTACCCCACACTCTGGGCTACAAACCCACTCAGGAGAGGAGGCAGCAAGTGGTGGAAATGAAGAATCTCTGGCTGTTACTTTGGATCCATGTGGGGCTCCTACTGGGGAAAAGTTTTGGGGCCCATTTCTCGCAACAACCCTCGGACAAGGTAATCGTGGCCGGCAAATCGGTGACCCTTCCCTGCGTAGTGATTGGCTACAGAGGCGTGGTCCAGTGGACGATGGACGGGCTGGCACTGGGAGCTGAAAGAGACCTTCCAGGGTGGTCCCGTTATTCTGTGGTGGGAGACCCTTCTCTAGGGGAACATAACCTGCACATTGAAGGGGTTGAGCTTAGTGACGATGCCATCTACGAGTGCCAAGCGACCCAGGCAGCGCTGAGGTCACAGCGGGCACGTCTCACTGTGCTACTTCCCCCTGGAGATCCAATGATACCAGGCTCCCCAGTTGCCAATGTCCTGCTTAACGTACCCTACAATCTCACCTGTCTTGCCCCTGTGGCCAAGCCGGCGGCAGAGATCACCTGGTACCGCGATGGCAAGAAGCTGGATTCAGCTGTCTACACCAAGGAGCTTCTGTCCGACGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGCTAATCACCCCAAGTCTGGCGGATTCCGGATCCAGTTACACCTGCCGCGTGAGGAACGAGGCCCTGCCAGAGGGCAGAGAGAAGTCCGTGACGCTGAGTGTGCAGTATCCCCCCAAAGTAACGCTGTCGGTAGAACCCCCGACTATCACCGAGGGCGGTTCCGTCACTTTTCTATGTGGTGCCGTTTCCAACCCAGAAGTGACTGGATACAGGTGGGCAAAGGGGGGTGTCCCTCTGGCCGTATCTGGAGACAAATACACCGTGGAGGTGGATCACACTTTCTTCACTGCCCCGGTCTCGTGCGAGGTGTCCAACAGCGTGGGAGCCAGTAACGTCAGTACGGCCGTCAATGTGCTGTTTGGGCCACGCCTCCTCACGGAGCCCCGCCCCATGACGGTGGACATAGGTGATGACGCCTCCTTCTTTTGTGGCTGGACTGGAAATCCGACGCCTACCCAGTTCTGGAGCAAGAAAGGAACCGGAGAGGTTCTCAGCAATGGAAACACTCTGCTGCTGACCAAAGTAACTCGGGAAGATGCCGGGATCTACGTCTGTAAAGCCATCGTGCCGCGAATGGGGAGTACGGAGAAAGAAGTGACCCTCACAGTGAGAGGGCCACCAATCATCACTAGCGAGATGCACTATGAGACCACACTTGGAGGAAAGGCACGGATGGAGTGCCTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCATGGGACAAGCAAAGCCTGGAGGACGGTTCGTGGGGTCGTTTCTCAGTCGAGACCGAAGTGACTGAAGTTGGTGCCATCTCCGTCCTGGTCATTGATGGAGCAGAGCAGTCAGATTTTCTCACTGAGTTCAACTGCAGCGCCATCAATCAGTATGGGGAGGATTCGGTCATCG
                                                  Xt7.1-CHK-1008246389                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCATCCAGGGACACCTACCCCGGGCATCCTATCCCTGCCCCGACTACCCCACACTCTGGGCTACAAACCCACTCAGGAGAGGAGGCAGCAAGTGGTGGAAATGAAGAATCTCTGGCTGTTACTTTGGATCCATGTGGGGCTCCTACTGGGGAAAAGTTTTGGGGCCCATTTCTCGCAACAACCCTCGGACAAGGTAATCGTGGCCGGCAAATCGGTGACCCTTCCCTGCGTAGTGATTGGCTACAGAGGCGTGGTCCAGTGGACGATGGACGGGCTGGCACTGGGAGCTGAAAGAGACCTTCCAGGGTGGTCCCGTTATTCTGTGGTGGGAGACCCTTCTCTAGGGGAACATAACCTGCACATTGAAGGGGTTGAGCTTAGTGACGATGCCATCTACGAGTGCCAAGCGACCCAGGCAGCGCTGAGGTCACAGCGGGCACGTCTCACTGTGCTACTTCCCCCTGGAGATCCAATGATACCAGGCTCCCCAGTTGCCAATGTCCTGCTTAACGTACCCTACAATCTCACCTGTCTTGCCCCTGTGGCCAAGCCGGCGGCAGAGATCACCTGGTACCGCGATGGCAAGAAGCTGGATTCAGCTGTCTACACCAAGGAGCTTCTGTCCGACGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGCTAATCACCCCAAGTCTGGCGGATTCCGGATCCAGTTACACCTGCCGCGTGAGGAACGAGGCCCTGCCAGAGGGCAGAGAGAAGTCCGTGACGCTGAGTGTGCAGTATCCCCCCAAAGTAACGCTGTCGGTAGAACCCCCGACTATCACCGAGGGCGGTTCCGTCACTTTTCTATGTGGTGCCGTTTCCAACCCAGAAGTGACTGGATACAGGTGGGCAAAGGGGGGTGTCCCTCTGGCCGTATCTGGAGACAAATACACCGTGGAGGTGGATCACACTTTCTTCACTGCCCCGGTCTCGTGCGAGGTGTCCAACAGCGTGGGAGCCAGTAACGTCAGTACGGCCGTCAATGTGCTGTTTGGGCCACGCCTCCTCACGGAGCCCCGCCCCATGACGGTGGACATAGGTGATGACGCCTCCTTCTTTTGTGGCTGGACTGGAAATCCGACGCCTACCCAGTTCTGGAGCAAGAAAGGAACCGGAGAGGTTCTCAGCAATGGAAACACTCTGCTGCTGACCAAAGTAACTCGGGAAGATGCCGGGATCTACGTCTGTAAAGCCATCGTGCCGCGAATGGGGAGTACGGAGAAAGAAGTGACCCTCACAGTGAGAGGGCCACCAATCATCACTAGCGAGATGCACTATGAGACCACACTTGGAGGAAAGGCACGGATGGAGTGCCTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCATGGGACAAGCAAAGCCTGGAGGACGGTTCGTGGGGTCGTTTCTCAGTCGAGACCGAAGTGACTGAAGTTGGTGCCATCTCCGTCCTGGTCATTGATGGAGCAGAGCAGTCAGATTTTCTCACTGAGTTCAACTGCAGCGCCATCAATCAGTATGGGGAGGATTCGGTCATCGTTTCTC
  5   1   2   15  bld Te4  PIPE in                         CAAN4148.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCGGATTCATCCAGGGACACCTACCCCGGGCATCCTATCCCTGCCCCGACTACCCCACACTCTGGGCTACAAACCCACTCAGGAGAGGAGGCAGCAAGTGGTGGAAATGAAGAATCTCTGGCTGTTACTTTGGATCCATGTGGGGCTCCTACTGGGGAAAAGTTTTGGGGCCCATTTCTCGCAACAACCCTCGGACAAGGTAATCGTGGCCGGCAAATCGGTGACCCTTCCCTGCGTAGTGATTGGCTACAGAGGCGTGGTCCAGTGGACGATGGACGGGCTGGCACTGGGAGCTGAAAGAGACCTTCCAGGGTGGTCCCGTTATTCTGTGGTGGGAGACCCTTCTCTAGGGGAACATAACCTGCACATTGAAGGGGTTGAGCTTAGTGACGATGCCATCTACGAGTGCCAAGCGACCCAGGCAGCGCTGAGGTCACAGCGGGCACGTCTCACTGTGCTACTTCCCCCTGGAGATCCAATGATACCAGGCTCCCCAGTTGCCAATGTCCTGCTTAACGTACCCTACAATCTCACCTGTCTTGCCCCTGTGGCCAAGCCGGCGGCAGAGATCACCTGGTACCGCGATGGCAAGAAGCTGGATTCAGCTGTCTACACCAAGGAGCTTCTGTCCGACGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGCTAATCACCCCAAGTCTGGCGGATTCCGGATCCAGTTACACCTGCCGCGTGAGGAACGAGGCCCTGCCAGAGGGCAGAGAGAAGTCCGTGACGCTGAGTGTGCAGTATCCCCCCAAAGTAACGCTGTCGGTAGAACCTCCGACTATCACCGAGGGCGGTTTCGTCACTTTTCTATG
  5   1   2      seed Gas8      in                          st39a20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGTACCCTACAATCTCACCTGTCTTGCCCCTGTGGCCAAGCCGGCGGCAGAGATCACCTGGTACCGCGATGGCAAGAAGCTGGATTCAGCTGTCTACACCAAGGAGCTTCTGTCCGACGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGCTAATCACCCCAAGTCTGGCGGATTCCGGATCCAGTTACACCTGCCGCGTGAGGAACGAGGCCCTGCCAGAGGGCAGAGAGAAGTCCGTGACGCTGAGTGTGCAGTATCCCCCCAAAGTAACGCTGTCGGTAGAACCCCCGACTATCACCGAGGGCGGTTCCGTCACTTTTCTATGTGGTGCCGTTTCCAACCCAGAAGTGACTGGATACAGGTGGGCAAAGGGGGGTGTCCCTCTGGCCGTATCTGGAGACAAATACACCGTGGAGGTGGATCACACTTTCTTCACTGCCCCGGTCTCGTGCGAGGTGTCCAACAGCGTGGGAGCCAGTAACGTCAGTACGGCCGTCAATGTGCTGTTTGGGCCACGCCTCCTCACGGAGCCCCGCCCCATGACGGTGGACATAGGTGATGACGCCTCCTTCTTTTGTGGCTGGACTGGAAATCCGACGCCTACCCAGTTCTGGAGCAAGAAAGGAACCGGAG
  5   1   2       bld HdA                            THdA008l13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTCCCTGTCTTGCCCCTGTGGCCAAGCCGGCGGCAGAGATCACCTGGTACCGCGATGGCAAGAAGCCAGATTCAGCTGTCTACACCAAGGAGCTTCTGTCCGACGGCAAGAGTGAGGGTTCGGCGAGCAGTCTGCTAATCACCCCAAGTCTGGCGGATTCCGGATCCAGTTACACCTGCCGCGTGAGGAACGAGGCCCTGCCAGAGGGCAGAGAGAAGTCCGTGACGCTGAGTGTGCAGTATCCCCCCAAAGTAACGCTGTCGGTAGAACCCCCGACTATCACCGAGGGCGGTTCCGTCACTTTTCTATGTGGTGCCGTTTCCAACCCGGAAGTGACTGGATACAGGTGGGCAAAGGGGGGTGTCCCTCTGGCCGTATCTGGAGACAAATACACCGTGGAGGTGGATCACACTTTCTTCACTGCCCCGGTCTCGTGCGAGGTGTCCAACAGCGTGGGAGCCAGTAACGTCAGTACGGCCGTCAATGTGCTGTTTGGGCCACGCCTCCTCACGGAGCCCCGCCCCATGACGGTGGACATAGGTGATGACGCCTCCTTCTTTTGTGGCTGGACTGGAAATCCGACGCCTACCCAGTTCTGGAGCAAGA
  5   1   2       bld Gas       in                   TGas088l18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGCCTCCTTCTTTTGTGGCTGGACTGGAAATCCGACGCCTACCCAGTTCTGGAGCAAGAAAGGAACCGGAGAGGTTCTCAGCAATGGAAACACTCTGCTGCTGACCAAAGTAACTCGGGAAGATGCCGGGATCTACGTCTGTAAAGCCATCGTGCCGCGAATGGGGAGTACGGAGAAAGAAGTGACCCTCACAGTGAGAGGGCCACCAATCATCACTAGCGAGATGCACTATGAGACCACACTTGGAGGAAAGGCACGGATGGAGTGCCTCATTGAGTCCACCCCTGCCCCGGACAGAATTGTCTGGGCATGGGACAAGCAAAGCCTGGAGGACGGTTCGTGGGGTCGTTTCTCAGTCGAGACCGAAGTGACTGAAGTTGGTGCCATCTCCGTCCTGGTCATTGATGGAGCAGAGCAGTCAGATTTTCTCACTGAGTTCAACTGCAGCGCCATCAATCAGTATGGGGAGGATTCGGTCATCGTTTCTCTGC
  5   1   2      ests                                 Xt7.1-CAAQ1659.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGCACAGCGATATCCCTGATGAGCCCCAGGACCCAACCAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCCGGCCTACAACCATAACGTACCCAGAATTCTCCTCTCCACCGCGTCCCCTCTACTCAACCACATCTTCTCTGTCGCCGCTGTGCCCCACCCCTTCTGGGCCTCCTAAAATCTACGATTACGCTCATCGCTACGCCACCACTCCCAGGTCTGGAGGCCACCACATGCCCCAGGGGTCATCGTCTCATTTGCCGCAAGGAACGACTCATTTGCCCCAAGGCCCCATGCATTTACCACAGGTCCCAACTCATTTGCCACAAGCTCCGACTTATTTACCACAAGGCCCGACACATTTGCCACAAGGCCCAACTCATTTGCCACAGGGACCAACTCATTTGCCACATGGACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGTAAAGGCGAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008231197                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGCGATATCCCTGATGAGCCCCAGGACCCAACCAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCCGGCCTACAACCATAACGTACCCAGAATTCTCCTCTCCACCGCGTCCCCTCTACTCAACCACATCTTCTCTGTCGCCGCTGTGCCCCACCCCTTCTGGGCCTCCTAAAATCTACGATTACGCTCATCGCTACGCCACCACTCCCAGGTCTGGAGGCCACCACATGCCCCAGGGGTCATCGTCTCATTTGCCGCAAGGAACGACTCATTTGCCCCAAGGCCCCATGCATTTACCACAGGTCCCAACTCATTTGCCACAAGCTCCGACTTATTTACCACAAGGCCCGACACATTTGCCACAAGGCCCAACTCATTTGCCACAGGGACCAACTCATTTGCCACATGGACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGTAAAGGCGAAAAAAAAAAA
  5   1   2       bld Gas1      in                     NISC_mq10g06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGTCATTGATGGAGCAGAGCAGTCAGATTTTCTCACTGAGTTCAACTGCAGCGCCATCAATCAGTATGGGGAGGATTCGGTCATCGTTTCTCTGCGGCAGCAAGCCGCTCTTCCTCTGACGCTCTTGCTGATTGCCGTCGGCTCGGGGACCCTGTGCATCTTTGTACTCGTCATCACTTCCATCCTTTGTTGCCGACGACCAAAAAAAGCCGTGAAGGACACACAGATTCTAGCCGTGGACGTGTCAGGGAGCGAGCCCAGCGAGAGGCACCCTAGCGACTCTGAGGAGGATCTCAAGGAGCCATTGCACACAGACACCGAATCCCAGAGGACATCTCAGACCGAGCACAGCGATATCCCTGATGAGCCCCAGGACCCAACCAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCCGGCCTACAACCATAACGTACCCAGAATTCTCCTCTCCACCGCGTCCCCTCTACTCAACCACATCTTCTCTGTCGCCGCTGTGCCCCACCCCTTCTGGGCCTCCTAAAATCTACGATTACGCTCATCGCTACGCCACCACTCCCAGGTCTGGAGGCCACCACATGCCCCAGGGGTCATCGTCTCATTTGCCGCAAGGAACGACTCATTTGCCCCAAGGCCCCATG
  5   1   2       bld Gas8      in                          st26n13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGACACCGGAATCCCAGAGGNACATCTCAGAACCGAGCACAGCGATATCCCTGATGAGCCCCAGGACCCAACCAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCCGGCCTACAACCATAACGTACCCAGAATTCTCCTCTCCACCGCGTCCCCTCTACTCAACCACATCTTCTCTGTCGCCGCTGTGCCCCACCCCTTCTGGGCCTCCTAAAATCTACGATTACGCTCATCGCTACGCCACCACTCCCAGGTCTGGAGGCCACCACATGCCCCAGGGGTCATCGTCTCATTTGCCGCAAGGAACGACTCATTTGCCCCAAGGCCCCATGCATTTACCACAGGTCCCAACTCATTTGCCACAAGCTCCGACTTATTTACCACAAGGCCCGACACATTTGCCACAAGGCCCAACTCATTTGCCACAGGGACCAGCTCATTTGCCACATGGACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATA
  5   1   2       bld AbdN                               IMAGE:7022299                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACGGTTACTACAAAGTCCGAGCTCATGAAGACACCCGGCCTACAACCATAACGTACCCAGAATTCTCCTCTCCACCGCGTCCCCTCTACTCAACCACATCTTCTCTGTCGCCGCTGTGCCCCACCCCTTCTGGGCCTCCTAAAATCTACGATTACGCTCATCGCTACGCCACCACTCCCAGGTCTGGAGGCCACCACATGCCCCAGGGGTCATCGTCTCATTTGCCGCAAGGAACGACTCATTTGCCCCAAGGCCCCATGCATTTACCACAGGTCCCAACTCATTTGCCACAAGCTCCGACTTATTTACCACAAGGCCCGACACATTTGCCACAAGGCCCAACTCATTTGCCACAGGGACCAACTCATTTGCCACATGGACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGGCGGCGGTTACGTCCCCCGCTGCGTATAAAGTATAGTATTATAAAACCCCCGGGCTCT
  5   1   2       bld Hrt1      in                         CAAQ1659.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCATTTGCCACAGGGACCAACTCATTTGCCACATGGACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAACCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAAATACA
  5   1   2       bld Eye                                  CCAX9710.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACCAAGTCATTTACAGCAAGGCCTCAGTCATCTACCGCCGGGCCCCAGTCAACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCTCACTCCGCAGGAGCAGGGGAACCGCTGTCTCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTTCTTTCTGAACGAGACTATAATAAGTGAATAATCGGAAAAATAT
  5   1   2       bld Neu0                               IMAGE:6994377                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACATTCGGCACCTTACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAACCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTTCCCTTTGCACTTCTCAGCCGGGAGAATTACAGGCCCCCTGGGGTGCTCGCAAGCGGCCCGCGTTACACCANAATATTTTGTGGTTTATTGAAAATAAAATAATTTAATGCCCGCAAAGGTAAGTTTTTTATTTGGCCCTT
  3   1   2       bld Gas       in                    TGas088l18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACGCCAGGGCTTTCTGTAGCTACGTCCGCCCTGACAGGTTTGACTCAATGGACCAAGGCCCCGCCCTGGCCCGCCTCTCCTATGCCTCCCTAACCACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACATCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATAGTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn4      in                        CAAL21487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACACACAGCGATTTTGGCCGACCTTCACAGCAGCGAATGCAGACCCACGTATGACCTCATTGCCTGTCACGTGACCTCATACTTGACTGTGATACAATGGTTTCTATTGCATAGAAAACATTAGAGACTTTGACGGTGGCCATAAGTGGCCCAGATAAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACGTCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTTATTGCCTTGT
  5   1   2      seed Gas7      in                          XZG4170.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGATAGGTCCTACCTACCACTTCGGTATCTCCCAAACCGAGAGGTACATGCAATACCCGAACCACCGGCGGCGCAATGATACGAAAGGGGACTATTTAATGACTACTGGGGCGGCGTTACATCCCCGCTGCGTATAAAGTATAGTATTATAAAGCCCCCGGCTCTAGGATATTTCTGGAAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGTGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAACAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTAT
  3   1   2       bld Hrt1      in                         CAAQ1659.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGCTCTAGGATATTTCTGAAATCCATACCAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGTAAAGACGAAAAAAAGCCTCTCGCCCTATAG
  3   1   2       bld Te4  PIPE in                         CAAN4148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGATATTTCTGGAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCGGCAGGAGCAGGGAAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGTGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATT
  3   1   2       bld Gas7      in                          XZG4170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATCCATAACAAGGATCACTTGCTGCCACCTACTGGCCAAATGGGATACCGTCACTCCGCAGGAGCAGGGGAACCGCTGTCCCTAGTGGAAACCCTAAGAACTGCAATATAATTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGTGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAACAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGAAAGACGCAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas8      in                          st39a20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGCAGGGGAACCGCTGTNCCTAGTGGAAACCCTAAGAACTGCAATATAANTTATACTTTTTTCTTTCTGAACGAGACTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTNTAANTGAAAAAAATCG
  3   1   2       bld Gas8      in                          st26n13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ANTATAATAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATNTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCNTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTNGTAGCGCCGGTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCNGACGTTCTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTNGACACTTTTCCACGTTTCATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTGAAAAAAATC
  3   1   2       bld Brn4      in                        CAAL21487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAGCGAATAATCGGAAAAATATATCGAAGAGGATTACACGGAAGGGGGAATTTTCTTTTTTTATTTGAGTATCAAGGGCCGTTTTGTTTGAGTCCCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTTTCCCCTCCCCGCCGCCCCCGTTCCGCACAATAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATT
  3   1   2       bld Gas1      in                     NISC_mq10g06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGGGATCCGGTTTCACTGTTCCCCCCAGAGCCGTTGGGCTGTTATTTATTACTTTCCCTTTGCACTTCTCAGCCGGAGGAATTACAGGCCCCTGGGTGCTCGCAAGCGCCGGCGTTACACTATATATTTGTGTTTATTGAAATAAATAGTTAATGCCGCAAGTAAGTTTTATTGCCTTGTAGCGCCGCTAATAAAAATCCCGCGGAATCCCATGAACAGCCCCGGGGCAGCTCTCGCCGCCGCCGAGACGGATTCAACTTGCCCTTTTTATTTTCTTTGGGTTTCGTGCCTGCGGTTTCGCTAGAATTTGATATTTTATTTCATCGTTCCGGGGGCCGACGTTTTCCCCTCCCCGCCGCCCCCGTTCCGCACAACAACTCGACACTTTTCCACGTTTTATGTTCCTGCCTTAATCCCCCGCGCTCCTGTATTTGTATAAGAAGAAACCCTCCCATTATATCTATATATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGTAAAGGCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGCGGCCGCTCTAGAGTTCCCTC
  3   1   2       bld Neu       in                    TNeu067e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATATATATATATAGATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAAATGTAAAGACGAAAAAAAAAAAAAAAAAA
  5   1   2       add Neu       in                  TNeu067e09.p1caSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCTCCTGTATTTGTATAAGAAGAAACCCTCACATTATATATATATATATAGATATATATATTATTTCTGCATCCGCTCTACTGGCAATATGCCCCGAGGCACAGACTATATGCTTTTTTTTTAATTTGTAAAAAAATCGGAGAGAATATTTATATTTAATTAAAAAAATGTGAAGACG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)