Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012155405 Xt7.1-CAAO4194.3.5 - 24 ESTs
                                                                       .......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAO4194.3.5                                                                                                                                                                                  CAGTATAATATGATTGGTCGGCTCCGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTCAGTGTCTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATTCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGATGGGCGTCTGCATGTTCTCTCGGATGGGGGAACATATCATTGCCCCCTTCATCCCGGCGCTGCGATTTGCCCACTGGGCTCTCCCATTCATCGTGCTCCCCGGCTCTGAGCTCTGTCCAAACCTATGCCCCCTCCTGCTCCCAGAAACCCTCAGTGCCCCCCTCCCCGAGACCCTGGCAGACCTGCGCGGGGCCCCGTACCGACGCCTGGAGCCGGATGGGGAGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGAGAGCTGGAGACACGGGGGGCGAGGGTGGAGTAGCTCCACCCACTGCTCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCCTGCTCCTGCGGGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCTATAAAAAAAAAA
                                                  Xt7.1-CHK-1008267548                                                                                                                                                                                        AATATGATTGGTxxGxTxCGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTxAxxxxCTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATTCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGATGGGCGTCTGCxxxxTxTxxxxxxxGxxxGAACATxxCxxxGCCCCCTTCATCCCGGCGCTGCGATTTGCCCACTGGGCTCTCCCATTCATCGTGxTCxxxGGCTCTGAGCTCTGTCCAAACCTATGCCCCxxCCxxCTCCCAGAAACCCTCAGTGCCCCCCTCCCCGAGACCCTGGCAGACCTGCGCGGGGCCCCGTACCGACGCCTGGAGCCGGATGGGGAGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATxxxxAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGxxAGxxGGAGACxxGGGGGGCGAGxGxGxxGTAGCTCCACCCACTGCTCxxxxxAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGxxxCTGCTCxxxxGxGGGCAGGGAAGGCTGCACxxxxAxxTxxGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATxxxxxATAAAA
                                                      consensus depths                                                                                                                                                                                       2     2     2     3     3     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     3     8     3     8     3     8     4     8     4     9     4     9     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     4    10     4     9     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     9     5     9     5     9     5     8     5     8     5     8     5     7     5     7     5     7     5     6     5     6     5     6     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     2     4     3     4     3     4     2     4     4     5     4     5     4     5     4     5     4     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     4     1     4     3     6     3     7     3     7     2     8     2     8     4    10     4    10     4    10     4    10     4    10     4    10     4    11     4    11     4    11     4    11     4    11     4    11     4    11     4    11     4    11     4    11     4    11     4    11     4    11     3    10     3    10     4    10     4    10     4    10     4    10     4    10     4    10     4    10     5    10     5    10     5    12     5    12     5    12     5    12     5    12     5    12     5    12     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     5    11     4     9     3     4
  5   1   2  SIG                                      Xt7.1-ANHP1195.5                                                                                                                                                                   GGATCAGTTCTGGGCCAGTATAATATGATTGGTCGGCTCCCTTACAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTCAGTGTGTCCAGCTCGGTGTATTTCGGAGGAGTTCTCATCGGGGTGATCAGCTTTGGGCAACTGTCGGACCGGTTTGGTAGGAAGCCGGTGTATGTGACGGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCCGCTGGCTGCACGCTCAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGAGGAAGATGAAGAGGAGGACCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCGCATCCCATGGTGCCCTGGGGCAGGAGGGGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGTTATAGGGCCAAGGGGCACAAGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCGGGGAAGGCTGTACAGTTACATCTGGGGGGGACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTGGAATGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAN10299.3                                                                                                                                                                                                   GAAGATACGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATTCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGTGGCGTCTGCTCCATGTTCTCTCGGATGGGGGAACATTGCCCCTTCTCCCGGCGCTGCGTTTGCCACTGGGCTCTCCCTTCTCGGTCGTGCTGCGTGCTCCCCGGCTCTGAGCTCTGTCCAAACCTATGCCCCTCCCAACTGCAACTGCCGGGCCCTACGCCTGAGCGAAGGAGCTGTGACGCGAGGAGTGGGCTCCATGGACATAGAAAAGAGATGTGAGAGATCACTCATATCGAGGGGCAAGGCCTGGATGCCTTGATGAGCGGCTGTAGACTCTGGTGGGGCTGAAAGCGGTAAGAGAAGAGGAGAGACCCTCCTTGGAGATTTTGTAGCAAGTTCAT------------GCTTGGGGCCTTCCCCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCGG
  5   1   2                                         Xt7.1-TNeu130a19.3                                                                                                                                                                                                    AAGATACGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCACCTTGCCCTGATTGGGTACTTTATCCACTCATGGAGGCTGGTGGCCCTGCTGGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTGGGGCCTTCACCAATGGNGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGAGTGGGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATA
  5   1   2                                         Xt7.1-TNeu115e05.3                                                                                                                                                                                                                       CCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTTCCCGCAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCCGTACCGACGCCTGGAGCCGGACAGGGAGGTCATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTA
  5   1   2  SIG                                      Xt7.1-CAAO4194.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGGTCGGATTCCCGGGTCGACCCACGCGTCCGCGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCCGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATCCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGATGGGCGTCTGCTCCATGTTCTCTCGGATTGGGGGAATCATTGCCCCCTTCATCCCGGCGCTGCGATTTGCCCACTGGGCTCTCCCATTCATCGTGTTCGGTGCTGCCGGTGTCTCCGCCGGGCTCCTGAGCCTCCTGCTCCCAGAAACCCTCAGTGCCCCCCTCCCCGAGACCCTGGCAGACCTGCGCGGGGCCCCGTACCGACGCCTGGAGCCGGATGGGGAGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCAGCTCGGTGTATTTCGGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAA
                                                                   SNP                                                                                                                                                                                                                                                          ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------GT
                                               BLH MIN     363     130                                                                                                                                                                                  
                                               BLH OVR     423     222                                                                                                                                                                                  
                                               EST CLI      17      12                                                                                                                                                                                  
                                               ORF LNG     423      62                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 1e-033     AAP91701.1 solute carrier family 22-like [Ciona intestinalis] ---------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 2e-040     NP_001021482.1 F52F12.1b [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                            PROTEIN --- Dm ---- 2e-047     NP_524479.1 Organic cation transporter CG6331-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED - Dr ---- 1e-054     XP_682820.1 PREDICTED: similar to MGC53252 protein [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PREDICTED - Sp ---- 3e-062     XP_793690.2 PREDICTED: similar to Down syndrome cell adhesion molecule, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PREDICTED - Gg ---- 9e-118     XP_416558.2 PREDICTED: similar to putative transmembrane transporter FLIPT 1 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PREDICTED - Mm ---- 2e-119     XP_996154.1 PREDICTED: similar to solute carrier family 22 (organic cation transporter), member 15 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED - Hs ---- 2e-119     NP_060890.1 solute carrier family 22 (organic cation transporter), member 15; fly-likeputative organic ion transporter 1 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN --- Xl ---- 1e-176     AAH68683.1 MGC81090 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PREDICTED - ?? ---- 1e-176     NP_001084547.1 hypothetical protein LOC414494 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                       PROTEIN --- Xt ---- 0          AAH76672.1 MGC79625 protein [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAO4194.3.5                                                                                                                                                                                           ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------ATG---TGA---------------TGA---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAA------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2  SIG                                      Xt7.1-ANHP1195.5                                                                                                                                                                   GGATCAGTTCTGGGCCAGTATAATATGATTGGTCGGCTCCCTTACAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTCAGTGTGTCCAGCTCGGTGTATTTCGGAGGAGTTCTCATCGGGGTGATCAGCTTTGGGCAACTGTCGGACCGGTTTGGTAGGAAGCCGGTGTATGTGACGGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCCGCTGGCTGCACGCTCAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AGTGAGGAAGATGAAGAGGAGGACCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCGCATCCCATGGTGCCCTGGGGCAGGAGGGGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGTTATAGGGCCAAGGGGCACAAGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCGGGGAAGGCTGTACAGTTACATCTGGGGGGGACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTGGAATGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAAAAAAA
                                                  Xt7.1-CHK-1008295720                                                                                                                                                                         GTTCTGGGCCAGTATAATATGATTGGTCGGCTCCCTTACAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTCAGTGTGTCCAGCTCGGTGTATTTCGGAGGAGTTCTCATCGGGGTGATCAGCTTTGGGCAACTGTCGGACCGGTTTGGTAGGAAGCCGGTGTATGTGACGGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCCGCTGGCTGCACGCTCAGGGGCGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGGAGCAGTGAGGAAGATGAAGAGGAGGACCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCGCATCCCATGGTGCCCTGGGGCAGGAGGGGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGTTATAGGGxCxAxGGGCACAAGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCGGGGAAGGCTGTACAGTTACATCTGGGGGGGACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTGGAATGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAAAAAAAAAAAAA
  5   1   1           Tbd0 FL                     IMAGE:6979900.FL-MGC                                                                                                                                                                     CAAGTTCTGGGCACAGTATAATATGATTGGTCGGTTCCCTTACAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTCAGTGTGTCCAGCTCGGTGTATTTCGGAGGAGTTCTCATCGGGGTGATCAGCTTTGGGCAACTGTCGGACCGGTTTGGTAGGAAGCCGGTGTATGTGACGGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCTGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATCCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGATGGGCGTCTGCTCCATGTTCTCTCGGATTGGGGGAATCATTGCCCCCTTCATCCCGGCGCTGCGATTTGCCCACTGGGCTCTCCCATTCATCGTGTTCGGTGCTGCCGGTGTCTCCGCCGGGCTCCTGAGCCTCCTGCTCCCAGAAACCCTCAGTGCCCCCCTCCCCGAGACCCTGGCAGACCTGCGCGGGGCCCCGTACCGACGCCTGGAGCCGGATGGGGAGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1       add Tbd0 5g                            IMAGE:6980309                                                                                                                                                                   GGATCAGTTCTGGGCCAGTATAATATGATTGGTCGGCTCCCTTACAGACACCCCATGCTCAGGCCGGCGGGTCCCACACATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCTGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTCAGTGTGTCCAGCTCGGTGTATTTCGGAGGAGTTTCTCATCGGGGTGATCAGCTTTGGGCAACTGTCTGACCGGTTTGGATATGAAGCCGGCGTATGTGATGGGTTTGGCCCTGGAGGTGGTAATTTGCCGTGATGAACGCTCTGACCCCCATATTCCCTCTGTTCCTGCTGACGCCGTTTCTCGTAAGAGTCATTAATGGCGGCAAGTCACCCGTGGTCCTTGTCCTGCACAATGCAAGTATAGTACCTCCTACTGGGCATCTGCAGGATCCGCTGGATTCCTCCTGCTTGCTGTGGCATTGCCATTTGCCCGATTGGTACTTAATCCGCTCATGGAGCTTTGGCTCTGCGGAAATATCAGGATCGCGTGTGGATTTTCATCTGTTCCCAAATCCCTGTGTTAN
  5   1   2       ext Tbd0 FL                            IMAGE:6979900                                                                                                                                                                      CAGTTCTGGGCACAGTATAATATGATTGGTCGGTTCCCTTACAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTCAGTGTGTCCAGCTCGGTGTATTTCGGAGGAGTTCTCATCGGGGTGATCAGCTTTGGGCAACTGTCGGACCGGTTTGGTAGGAAGCCGGTGTATGTGACGGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGANGCTGCTGGCCCCTGCTGTGAATGTGCAAGGAGCN
  5   1   4   14 seed Neu5 5g3  in                         ANHP1195.5p ..........................................................................................................................................................................................CATTCAGCGCAGAGGAACTAGCGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAGATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGGAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTGGTTCCTAGTGGGAGGGGCCGCGTACGAGGTCAGTGTGTCCAGCTCGGTGTATTTCGGAGGAGTTCTCATCGGGGTGATCAGCTTTGGGCAACTGTCGGACCGGTTTGGTAGGAAGCCGGTGTATGTGACGGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTC
  3   1   4      seed Neu5 5g3  in                         ANHP1195.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATGGGAGCAGTGAGGAAGATGAAGAGGAGGACCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCGCATCCCATGGTGCCCTGGGGCAGGAGGGGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCGGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTG
  5   1   2       ext Tbd1      in                        CBXT17165.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAAGGGCACAAGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCGGGGAAGGCTGTACAGTTACATCTGGGGGGGACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTGGAATGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAAAAAAAAAAAAAAA
  3   1   2       ext Tbd1      in                        CBXT17165.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAAGGGCACAAGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCGGGGAAGGCTGTACAGTTACATCTGGGGGGGACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTGGAATGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAAAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAN10299.3                                                                                                                                                                                                   GAAGATACGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATTCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGTGGCGTCTGCTCCATGTTCTCTCGGATGGGGGAACATTGCCCCTTCTCCCGGCGCTGCGTTTGCCACTGGGCTCTCCCTTCTCGGTCGTGCTGCGTGCTCCCCGGCTCTGAGCTCTGTCCAAACCTATGCCCCTCCCAACTGCAACTGCCGGGCCCTACGCCTGAGCGAAGGAGCTGTGACGCGAGGAGTGGGCTCCATGGACATAGAAAAGAGATGTGAGAGATCACTCATATCGAGGGGCAAGGCCTGGATGCCTTGATGAGCGGCTGTAGACTCTGGTGGGGCTGAAAGCGGTAAGAGAAGAGGAGAGACCCTCCTTGGAGATTTTGTAGCAAGTTCAT------------GCTTGGGGCCTTCCCCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCGG
                                                  Xt7.1-CHK-1008295724                                                                                                                                                                                                         ACGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATTCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGTGGCGTCTGCTCCATGTTCTCTCGGATGGGGGAACATTGCCCCTTCTCCCGGCGCTGCGTTTGCCACTGGGCTCTCCCTTCTCGGTCGTGCTGCGTGCTCCCCGGCTCTGAGCTCTGTCCAAACCTATGCCCCTCCCAACTGCAACTGCCGGGCCCTACGCCTGAGCGAAGGAGCTGTGACGCGAGGAGTGGGCTCCATGGACATAGAAAAGAGATGTGAGAGATCACTCATATCGAGGGGCAAGGCCTGGATGCCTTGATGAGCGGCTGTAGACTCTGGTGGGGCTGAAAGCGGTAAGAGAAGAGGAGAGACCCTCCTTGGAGATTTTGTAGCAA------------------------GGCCTTCCCCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAAT
  5   1   2   34  ext Brn3 5x3  out                        CAAK9174.5p ..................................................................................................................................................................................................GAAGATACGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATTCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTG
  5   1   4      seed Te4  5g3  in                        CAAN10299.5p                                                                                                                                                                                                          CGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATTCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTG
  5   1   2       ext In62                            IMAGE:8955286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCTTCTTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCTGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATCCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGTGGCGTCTGCTCCATGTTCTCTCGGATGGGGGAACATTGCCCCTTCTCCCGGCGCTGCGTTTGCCACTGGGCTCTCCCTTCTCGGTCGTGCTGCGTGCTCCCCGGCTCTGAGCTCTGTCCAAACCTATGCCCCTCCCAACTGCAACTGCCGGGCCCTACGCCTGAGCGAAGGAGCTGTGACGCGAGGAGTGGGCTCCATGGACATAGAAAAGAGATGTGAGAGATCACTCATATCGAGGGGCAAGGCCTGGATGCCTTGATGAGCGGCTGTAGACTCTGGTGGGGCTGAAAGCGGTAAGAGAAGAGGAGAGACCCTCCTTGGAGATTTTGTAGCAAGTTCAT
  3   1   4      seed Te4  5g3  in                        CAAN10299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTTGGGGCCTTCCCCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCGGT
  5   1   2                                         Xt7.1-TNeu130a19.3                                                                                                                                                                                                    AAGATACGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCACCTTGCCCTGATTGGGTACTTTATCCACTCATGGAGGCTGGTGGCCCTGCTGGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTTGGGGCCTTCACCAATGGNGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGAGTGGGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATA
                                                  Xt7.1-CHK-1008295716                                                                                                                                                                                                          CGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCACCTTGCCCTGATTGGGTACTTTATCCACTCATGGAGGCTGGTGGCCCTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGCGGAGCTTGGGGCCTTCACCAATGGNGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGAGTGGGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCTGT
  5   1   4      seed Neu  5g3  in                   TNeu130a19.p1cSP6                                                                                                                                                                                                    AAGATACGGGGGAGACACCCCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCGCTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCCCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCACCTTGCCCTGATTGGGTACTTTATCCACTCATGGAGGCTGGTGGCCCTGCTGGTGAATG
  3   1   4      seed Neu  5g3  in                    TNeu130a19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGGCGGAGCTTGGGGCCTTCACCAATGGNGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGAGTGGGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCTGTAAAAAAAAAAAAAAAAAA
  5   1   2                                         Xt7.1-TNeu115e05.3                                                                                                                                                                                                                       CCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTTCCCGCAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCCCGTACCGACGCCTGGAGCCGGACAGGGAGGTCATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTA
                                                  Xt7.1-CHK-1008295714                                                                                                                                                                                                                             TCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTTCCCGCAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCGGGGCCCCGTACCGACGCCTGGAGCCGGACAGGGAGGTCATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATC
  5   1   4      seed Neu       in                   TNeu115e05.p1cSP6                                                                                                                                                                                                                       CCATGCTCAGGCCGGCGGGTCCCACAGATGGAGGTGGAGGGGGCACTGAAGCTGGTGGGGGAAATGGGAATCTATCAGATCTACCTCTCCTTCCTATTGGCTGTACTGCTGCAGCTTTACTCTGCCACAGAAGCCATCATTATAACCATACTGGGGGCCACCCCCCCATACCACTGGATGAATGACAGCCTTACAGCCAATGGCAGCCGGGGGAAGCAATATGGGAGCCAATTACCTGCAGAGGGAGAACATGGACATGTGGTCTTTGATGGAAACTTTACCTCCATTGTGTCAGAGTTCCCGCAGGTTTGGCCCTGGAGGTGGTATTTGCCGTGATGAACGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTG
  3   1   4      seed Neu       in                    TNeu115e05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGCGGGGCCCCGTACCGACGCCTGGAGCCGGACAGGGAGGTCATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCAGCGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCTGAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAO4194.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGGTCGGATTCCCGGGTCGACCCACGCGTCCGCGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCCGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATCCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGATGGGCGTCTGCTCCATGTTCTCTCGGATTGGGGGAATCATTGCCCCCTTCATCCCGGCGCTGCGATTTGCCCACTGGGCTCTCCCATTCATCGTGTTCGGTGCTGCCGGTGTCTCCGCCGGGCTCCTGAGCCTCCTGCTCCCAGAAACCCTCAGTGCCCCCCTCCCCGAGACCCTGGCAGACCTGCGCGGGGCCCCGTACCGACGCCTGGAGCCGGATGGGGAGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008295726                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATTCCCGGGTCGACCCACGCGTCCGCGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCCGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATCCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGATGGGCGTCTGCTCCATGTTCTCTCGGATTGGGGGAATCATTGCCCCCTTCATCCCGGCGCTGCGATTTGCCCACTGGGCTCTCCCATTCATCGTGTTCGGTGCTGCCGGTGTCTCCGCCGGGCTCCTGAGCCTCCTGCTCCCAGAAACCCTCAGTGCCCCCCTCCCCGAGACCCTGGCAGACCTGCGCGGGGCCCCGTACCGACGCCTGGAGCCGGATGGGGAGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTxxCxxxAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAAxxAAAAAA
  5   1   2       ext Met2      in                         CUNH1386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGGTCGGATTCCCGGGTCGACCCACGCGTCCGCGCACTGACCCCCATATTCTCGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCCGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATCCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATTTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCAGAGCTGTACCCCACCTGTGTCAGGAACC
  5   1   3        nb In63                            IMAGE:8960732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCCCGGCTGTTCCTGCTGACGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGCCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCTGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATCCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGGTTCCTGTAAACAGGGTTCGGGGCCTCCTCTCGGTGCTGACAGCCAGACTCTGTCTCTTCCTGGGGAAGCTGACATCAGCGCTGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGACCTGGGGATGGCGTTCTGCTCATGTTCTCTCGGATTGGGGATCATTGCCCTTCATCCAGGCCTTGCAATGCCCATGGCTCTCCATCATCGGTTCGGGCTGCCGGGGTG
  5   1   3        nb Gas7                                 XZG10366.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCGGTTTCTCGTAGGAGTCATGAATGGCGGCATGTCGCTCGTGGCCTTTGTCCTGCTCAATGAATGTATTGGTGCCTCCTACTGGGCAGCTGCGGGCTCGCTGGGTTCCCTCTGCTTTGCTGTGGGCATTGCCCAGTTTGCCCTGATTGGGTACTTTATCCGCTCATGGAGGCTGCTGGTCCTGCTGGTGAATGTGCAAGGAGCGGCCGTGCTGGCGCTTTCCCTCTGTATCCCAGAATCCCCCCGCTGGCTGCACGCTCAGGGGCGCCTCCGCGAGGCACAGGAATCCTTACTCTCTCTGGGGCGCAGGAACCGCAGGAAGGTCACTTCATTCACTCTCAGCCCGCGGCAGAAAGACTCCGCCCACAGCGCCAACATTCTCACCATATACAGCAACGCCATCCTGCGCCAGCGCACACTCATCATGATGTGGGTCTGGTTTGTGTGCAGCCTGGTGTATTATGGGCTCACACTCAGCTCTGGGGACCTGGGAGGGGACATCTACCTGAATCTGGCGCTGTCCGGCCTGGCCGAACTCCCTGCCTACCCCCTGTGTATGTACCTCATCAACCACAAAAGAGTTGGCCGCCGGGGGTCTCTGGCCGGGTTCCTGTGCGTCGGGGGAGGAGCCTGTCTGCTCATTATGTTGGTTCCTGGAAAAACAGGTTCGGGGCCCCTCTCGGTGCTGAACAGCCAGACCCTGTCTCTCCTGGGGAAGCTGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGATGGGCGTCTGCTCCATGTTCTCTCGGATTGNGGGAATCATTGCCCCCTTCATCCCGGCGCTGCGATTTGCCCACTGGGCTCTCCCATTCATCGTGTTCGGTGCTG
  5   1   4      seed Te5       in                         CAAO4194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAACATCAGCGCCGCCTTCAACATTGTCTATATATACAGCTCGGAGCTGTACCCCACCTGTGTCAGGAACCTGGGGATGGGCGTCTGCTCCATGTTCTCTCGGATTGGGGGAATCATTGCCCCCTTCATCCCGGCGCTGCGATTTGCCCACTGGGCTCTCCCATTCATCGTGTTCGGTGCTGCCGGTGTCTCCGCCGGGCTCCTGAGCCTCCTGCTCCCAGAAACCCTCAGTGCCCCCCTCCCCGAGACCCTGGCAGACCTGCGCGGGGCCCCGTACCGACGCCTGGAGCCGGATGGGGAGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGGCACAGAACACTTTGGGGGGTT
  3   1   4      seed Te5       in                         CAAO4194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACCGACGCCTGGAGCCGGATGGGGAGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCTGT
  3   1   3        nb Egg       in                    TEgg056o15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATNGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGTCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg       in                   TEgg056o15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGCGATGCTGCACCGGCCGCAGGCGGAGCTTGGGGCCTTCACCAATGGGAGCAGTGAGGAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTG
  3   1   2       ext Brn3      in                         CAAK1253.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCTGT
  5   1   2       ext Brn3      in                         CAAK1253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGATGAAGAGGAGGAGCTTGATGCAGTGAGGGAGTGCCAAGCTCTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCACCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAAGCGCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGGCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGCTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTGCAATAGACAAGTATTTGTGCTTTATATTGGGGGGGTTATAGGGCCAAGGGCACACGCAATATTAATGGGGGGCAGCTGCTCCTGCGGGCAGGGAAGGCTGCACAGTTACATCTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGCTCATCCGGGGCCCCCGAATATACTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATCTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTCTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTAATAATCTGTAAAAAAAAAAAAAAAA
  3   1   2       ext Met2      in                         CUNH1386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGATCTGACTCTCAGGAGTGGGGGTGCCATACAGGGTGCCCCCTTTGGGCAACTTGGGCACCCATCTGCAGCTGTGCAGGCACGTGGGCACTGGCGTTACTGGAACCCCATCCCATGGTGCCCTGGGGCAGGAGGCACACTTTGGGCAAGATCAGTGTCCCGGGGGGCTGTTACGAATGGAAAGGCCAAGAGCTGGAGACGGGGGGCGAGTGGGTGGAGTAGCTCCACCCACTGTTCAGCAGCCTTTATGTGAAGGGGGGGCAGAAGTCCAATAGACAAGTATTTGTGCTTTATATTGGGGGGTTATAGGGCCAAGGGCCCACGCAATATTAATGGGGGGCAGCTGTTCCTGCGGGCAGGGAAGGCTGCACAGTTACATTTGGGGGGGCACAGAACACTTTGGGGGTTCAGGTGCCTCATGTTCCAGCCCCATAGTTCATCCGGGGCCCCCGAATATATTAGAACGGAGTCACTTATAGGTCACTAGGCTGCCCTGGGGGCGGGGCTTGGCCGGGCACAGTCGGATCACATGGCGGTATTTCGGGCCCAGTTTGGGGCCGGCCCTTAGAGATGTCGCTCAGCTCAGGGAAATAATAGTGAATGGGAGTTGGGGGGTTTTTATTGTGGGGGGGTCAGAATAATAAAATGGCAGTTTGTATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)