Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012155407 Xt7.1-ANBT2171.5 - 22 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-ANBT2171.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCGGGCCTCGGGCTCCAAGGGCAGTCTCAGCAACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGAGAATACGCAAAGTAAACGTAAAGCACTGAAGTTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGCTCTTTAGATGACGTTATTCCAGAGGAGATCTTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGATACAAACGGAAACATCAAACTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCGGCTGCAGACCTTACATGGCACCAGAAAGAATAGACCCAAGTGCGTCCCGACAGGGATACGATGTCCGCTCCGACGTGTGGAGCCTCGGGATCACGCTATACGAGTTGGCCACAGGCCGCTTTCCCTACCCCAAGTGGAACAGTGTGTTTGATCAGCTGACACAGGTTGTGAAAGGGGACCCCCCGCAGCTCAGCAACTCGGAGGAGCGGGAGTTCTCCCCCAGCTTCATCAGTTTCGTTAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTCTGAAACACCCTTTCATCCTGATGTACGAGGAGCGCACGGTGGAGGTGGCGGGGTACGTGGGTAAGATCCTGGAGCAGATGCCGGCCTCCCCCAGCTCCCCCATGTACGTCGATTGATGCCGCCGTCACGCAAATGCCTAGCGACAAGGGCTGCGAGCGAAGCCAGACGCAGAGAGATCCCACCTCTCCCCCCATTGGCTGTCGGCGACCGGCCGCCTCCCTCCCTCGCGCCACGTGCAATAAGATCGGTGTTCGTTTCATTTCCCTTCCATCGTGTCTGTGTGCTACCGTCACATGTCAATCTTGCCCCTCCCCCTTTCCACTTAAAGGAACAGCTCACCCTGCCTGGGTCAGCGGGACGCGCACCCTATTCCTAACAGGGTTTTTTTTTGGGGGGGGGGGGGGGGTATATAAAAAAAAAAACAAAGCCTAGATGCTGCATGGATCAGTAAGAGAGACCTGGCGCCATCGTACCCCCCGTTACCCTGTCCCGCAGGGGGGCAAAGAATATGAATTATATAAATATATATATTTTTTATTATTTTTAAAAAATGGAAATAAAAAGTACTTTTTTTTTTTTTTTTTTCCATTTACTTTATTTTTTTGGTTTTGTCGGGGGGGCGGGGGATTCCTTCCAAAGTGCAATAGATCAAACCGATTTTCCGCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACCAAAAAAGCAAAAAAGCAAAAAAAAAATGGAAAACAGAAAA
                                                  Xt7.1-CHK-1008267269                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCGGGCTCCAAGGGCAGTCTCAGCAACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGAGAATACGCAAAGTAAACGTAAAGCACTGAAGTTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGCTCTTTAGATGACGTTATTCCAGAGGAGATCTTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGATACAAACGGAAACATCAAACTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCGGCTGCAGACCTTACATGGCACCAGAAAGAATAGACCCAAGTGCGTCCCGACAGGGATACGATGTCCGCTCCGACGTGTGGAGCCTCGGGATCACGCTATACGAGTTGGCCACAGGCCGCTTTCCCTACCCCAAGTGGAACAGTGTGTTTGATCAGCTGACACAGGTTGTGAAAGGGGACCCCCCGCAGCTCAGCAACTCGGAGGAGCGGGAGTTCTCCCCCAGCTTCATCAGTTTCGTTAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTCTGAAACACCCTTTCATCCTGATGTACGAGGAGCGCACGGTGGAGGTGGCGGGGTACGTGGGTAAGATCCTGGAGCAGATGCCGGCCTCCCCCAGCTCCCCCATGTACGTCGATTGATGCCGCCGTCACGCAAATGCCTAGCGACAAGGGCTGCGAGCGAAGCCAGACGCAGAGAGATCCCACCTCTCCCCCCATTGGCTGTCGGCGACCGGCCGCCTCCCTCCCTCGCGCCACGTGCAATAAGATCGGTGTTCGTTTCATTTCCCTTCCATCGTGTCTGTGTGCTACCGTCACATGTCAATCTTGCCCCTCCCCCTTTCCACTTAAAGGAACAGCTCACCCTGCCTGGGTCAGCGGGACGCGCACCCTATTCCTAACAGGGTTTTTTTTTGGGGGGGGGGGGGGGGTATATAAAAAAAAAAACAAAGCCTAGATGCTGCATGGATCAGTAAGAGAGACCTGGCGCCATCGTACCCCCCGTTACCCTGTCCCGCAGGGGGGCAAAGAATATGAATTATATAAATATATATATTTTTTATTATTTTTAAAAAATGGAAATAAAAAGTACTTTTTTTTTTTTTTTTTTCxxTTxxCTTTATTTTTTTGGTTTTGTCGGGGGGGCGGGGxxTxCxTxCCAAAGTGCAATAGATCAAAxCxxxTTTxCxCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACCAAAAAAGCAAAAAAGCAAAAAAAAAATGGAAAACAGAAAAAATGAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     3     2     4     3     5     3     5     3     5     3     6     3     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     5     7     6     7     6     7     3     3     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     5     9     4     9     5     9     6     9     5     9     5     9     6     9     5     9     5     9     6     9     6     9     5     9     6     9     5     9     6     9     6    10     6    10     4    10     7     9     5     8     4     7     4     7     3     6     3     7     3     7     3     7     3     7     3     7     4     7     4     7     5     8     4     8     4     8     6     8     3     8     7     8     4     8     3     8     4     8     4     8     4     9     5     9     6     9     6    10     6    10     7    10     6    10     7    10     7     9     7     9     6     9     6     9     6     9     7     9     7     9     7     9     6     8     6     7     6     7     4     4     3     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCGTCAACAGCATGCAGGGTAA
                                                                       ...PROTEIN --- Br ---- 5e-011     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bb ---- 7e-014     BAA84741.1 src-like A-1 [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Bf ---- 8e-025     AAM18889.1 unknown [Branchiostoma floridae] ---------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sc ---- 4e-063     NP_012407.1 Involved in osmoregulation, member of the HOG1 mitogen-activated protein kinase(MAPK) cascade; Pbs2p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 4e-086     NP_509682.1 MKK MAPK kinase homolog (mkk-4) [Caenorhabditis elegans] -----------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ---- 5e-096     AAH74665.1 Mitogen-activated protein kinase kinase 6 [Xenopus tropicalis] ------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - ?? ---- 2e-097     NP_001079947.1 hypothetical protein LOC379638 [Xenopus laevis] -----------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 8e-116     NP_477353.1 MAP kinase kinase 4 CG9738-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 4e-125     BAE06546.1 mitogen-activated protein kinase kinase [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 4e-127     XP_794490.2 PREDICTED: similar to SEK1 [Strongylocentrotus purpuratus] ------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 4e-151     NP_991299.1 MKK4 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Gg ==== 0          XP_415583.2 PREDICTED: similar to Mitogen-activated protein kinase kinase 4 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 0          NP_033183.1 mitogen activated protein kinase kinase 4; SAPK/Erk/kinase 1 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 0          NP_003001.1 mitogen-activated protein kinase kinase 4; dual specificity mitogen-activatedprotein kinase kinase 4; MAP kinase kinase 4; c-Jun N-terminal kinase kinase 1;JNK activating kinase 1; SAPK/ERK kinase 1; MAPK/ERK kinase 4; JNK-activatedkinase 1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 0          AAI26010.1 Unknown (protein for IMAGE:5047593) [Xenopus laevis] ----==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-ANBT2171.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------ATG---------TGA---------------------TAG---------------------------------------------------------------------------------------------------TAA---------------------------------------------------ATG---------------------------TAA------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------TGA------TAA------------------------------------TAA------------------------------------------------------------------------------------TAG---------------------------ATGTGA---------------------------------------------------------------------TAA------------------------------TAG------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       bld Egg                            TEgg093h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGTACCAGTGCGGGCCTCGGGCTCCAAGGGCAGTCTCAGCAACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGAGAATACGCAAAGTAAACGTAAAGCACTGAAGTTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAG
  5   1   2       bld Egg                            TEgg095n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCGGGCCTCGGGCTCCAAGGGCAGTCTCAGCAACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGAGAATACGCAAAGTAAACGTAAAGCACTGAAGTTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTC
  5   1   2       bld Gas6      in                         ANBT2171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGTAACAGCGGCAGCAGCGGTACCAGTGCGGGCCTCGGGCTCCAAGGGCAGTCTCAGCAACACAGCACCGTCAACAGCATGCAGGGTAAACGTAAAGCACTGAAGTTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTCGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGCTCTTTAGATGACGTTATTCCAGAGGAGATCTTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGATACAAACGGAAACATCAAACTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCCAGACCAGAGATGCCGGCTGCAGACCTTACA
  5   1   2       bld Gas6      in                         ANBT2164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGCGGTACCAGTGCGGGCCTCGGGCTCCAAGGGCAGTCTCAGCAACACAGCACCGTCAACAGCATGCAGGGTAAACGTAAAGCACTGAAGTTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGCTCTTTAGATGACGTTATTCCAGAGGAGATCTTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGATACAAACGGAAACATCANACTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCATTGCCAAGACCAGAGATGCCGGCTGCAGACCTTACATGGCACCAG
  5   1   2       bld Lun1      in                         CABD7874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACACAGCACCGTCAACAGCATGCAGGGCCTTCAGATAAACCTCTGTGAGAATACGCAAAGTAAACGTAAAGCACTGAAGTTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGCTCTTTAGATGACGTTATTCCAGAGGAGATCTTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGATACAAACGGAAACATCAAACTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCNCAGACCAGAGATGCCGGCTGCAGACCTTACATGGCACC
  5   1   2      seed Mus1 PIPE in                        CABH11025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACACAGCACCGTCAACAGCATGCAGGGTAAACGTAAAGCACTGAAGTTGAATTTTGCCAACCCGGCCTTCAAATCGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGCTCTTTAGATGACGTTATTCCAGAGGAGATCTTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGATACAAACGGAAACATCAAACTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCGGCTGCAGACCTTACATGGCACCA
  5   1   2       bld Tad0      in                       IMAGE:6981818                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGACAGCAAAATTCACCCTGAACCCCACTATTCCAAGTACCCACATGATGCACAAACTGGACGCTATCAGAAATCTTGAGACGACGTACCCAAAACAGGATTTGCGGACATCTGGCGGGAAGGCGTTAAGCACAAATGAACAGGCAACAAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGCTCTTTAGATGACGTTATTCCAGAGGAGATCTTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGATACAAACGGAAACATCANACTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCGGCTGCAGACCTTACATGGCACCAGAAAGAATAGACCCAAGTGCGTCCCGACAGGGATACGATGTCCCGCTCCGACGTGTGGGAGCCCTCGGGATCACGCCTATACGAGTTTGGGCCACAGGCCCGCTTTCCCCTACCCCCAAGTGGAACAAGTGTGGTTTGATCCGCCTGGAACCCAAGGTTGGTGAAAAAGGGGGAT
  5   1   2       bld Neu                            TNeu036n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGTTAAGCCAAATGACGGCAACAAAAACCGGCTAGAGAGACTGAGGACGCACAGTATTGAATCATCTGGAAATTAAAGCTCTCTCCAGAACAACATTGGGACTTCACAGCAGAAGACTTAAAGGACCTGGGGGAGATTGGCCGCGGTGCTTACGGCTCTGTCAATAAAATGAGCCATACCCCTAGCGGGCAGATTATGGCTGTTAAGAGGATTCGCTCCACAGTGGATGAGAAAGAGCAGAAGCAGCTCCTCATGGATCTGGATGTGGTGATGAGGAGTAGCGACTGCCCGTACATAGTCCAGTTCTACGGAGCGCTATTCAGAGAGGGTGACTGCTGGATCTGCATGGAGCTCATGGCTACCTCGTTCGACAAGTTTTACAAATATGTATATAGCTCTTTAGATGACGTTATTCCAGAAGAGATCTTAGGCAAAATCACTTTAGCGACTGTGAAAGCCTTAAATCATTTAAAAGAAAACTTGAAAATCATTCACAGAGACATCAAACCTTCCAATATTCTCCTGGATACAAACGGAAACATCAAACTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGC
  5   1   2       bld Tad5      in                         XZT11251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTGTGACTTTGGCATTAGCGGGCAGCTGGTGGATTCCATTGCCAAGACCAGAGATGCCGGCTGCAGACCTTACATGGCACCAGAAAGAATAGACCCAAGTGCGTCCCGACAGGGATACGATGTCCGCTCCGACGTGTGGAGCCTCGGGATCACGCTATACGAGTTGGCCACAGGCCGCTTTCCCTACCCCAAGTGGAACAGTGTGTTTGATCAGCTGACACAGGTTGTGAAAGGGGACCCCCCGCAGCTCAGCAACTCGGAGGAGCGGGAGTTCTCCCCCAGCTTCATCAGTTTCGTTAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTCTGAAACACCCTTTCATCCTGATGTACGAGGAGCGCACGGTGGAGGTGGCGGGGTACGTGGGTAAGATCCTGGAGCAGATGCCGGCCTCCCCCAGCTCCCCCATGTACGTCGATTGATGCCGCCGTCACGCAAATGCCTAGCGACAAGGGCTGCGAGCGAAGCCAGACGCAGAGAGATCCCACCTCTCCCCCCATTGGCTGTCGGCGACCGGCCGCCTCCCTCCCTCGCGCCACGTGCAATAAGATCGGTGTTCGTTTCATTTCCCTTCCATCGTGTCTGTGTGCTACCGTCACATGTCAATCTTGCCCCTCCCCCTTTCCACTTAAAGGAACAGCTCACCCTGCCTGGGTCAGCGGGACGCGCACCCTATTCCTAACAGGGTTTTTTCTTGNGGGGGGGGGGGGGGGTATATAAAAAAA
  3   1   2       bld Lun1      in                         CABD7874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCCATTGCCAAGACCAGAGATGCCGGCTGCAGACCTTACATGGCACCAGAAAGAATAGACCCAAGTGCGTCCCGACAGGGATACGATGTCCGCTCCGACGTGTGGAGCCTCGGGATCACGCTATACGAGTTGGCCACAGGCCGCTTTCCCTACCCCAAGTGGAACAGTGTGTTTGATCAGCTGACACAGGTTGTGAAAGGGGACCCCCCGCAGCTCAGCAACTCGGAGGAGCGGGAGTTCTCCCCCAGCTTCATCAGTTTCGTTAATCAGTGCCTTACCAAGGAGGAGTCAAAAAGACCAAAATACAAAGAACTTTTGAAACACCCTTTCATCCTGATGTACGAGGAGCCCACGGTGGAGGTGGCGGGGTACGTGGGTAAGATCCTGGAGCAGATGCCGGCCTCCCCCAGCTCCCCCATGTACGTCGATTGATGCCGCCGTCACGCAAATGCCTAGCGACAAGGGCTGCGAGCGAAGCCAGACGCAGAGAGATCCCACCTCTCCCCCCATTGGCTGTGGGGGACCGGCCGCCTCCCTCCCTCGCGCCACGTGCAATAAGATCGGTGTTCGTTTCATTTCCCTTCCATCGTGTCTGTGTGCTACCGTCACATGTCAATCTTGCCCCTCCCCCTTTCCTTTTAAAGGAACAGCTCACCCTGCCTGGGTCAGCGGGACGCGCACCCTATTCCTAACAGGGTTTTTTCTTGGGGGGGGGGGGGGTATT
  5   1   2       bld Gas8      in                          st43n08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGGAAATACCCTTCTTGTGTAGTAATAGGAATAGGGCAATCTATAACATACTCAAGGCTGTATGTGAAGCATTGCCCAGGTTGGTATTTAACCCTCTCTTTGGTGTCACTTACTGTTCTACTATCTCCCAGCAGCCCTTGTAGTACAGCAACTTCTGCCTCTGCTTTAACCAACTGGGTTTTTCTCCTGTACCCAATCATGTTAATCCTGTATATTTGTATCTTTCCAGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTCTGAAACACCCTTTCATCCTGATGTACGAGGAGCGCACGGTGGAGGTGGCGGGGTACGTGGGTAAGATCCTGGAGCAGATGCCGGCCTCCCCCAGCTCCCCCATGTACGTCGATTGATGCCGCCGTCACGCAAATGCCTAGCGACAAGGGCTGCGAGCGAAGCCAGACGCAGAGAGATCCCACCTCTCCCCCCATTGGCTGTCGGCGACCGGCCGCCTCCCTCCCTCGCGCCACGTGCAATAAGATCGGTGTTCGTTTCATTTCCCTTCCATCGTGTCTGTGTGCTACCGTCACATGTCAATCTTGCCCCTCCCCCTTTCCACTTAAAGGAACAGCTCACCCTGCCTGGGTCAGCGGGACGCGCACCCTATTCCTAACAGGGTTTTTTTCTTGGG
  5   1   2       bld Gas6      in                         ANBT2425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGATACGATGTCCGCTCCGACGTGTGGAGCCTCGGGATCACGCTATACGAGTTGGCCACAGGCCGCTTTCCCTACCCCAAGTGGAACAGTGTGTTTGATCAGCTGACACAGGTTGTGAAAGGGGACCCCCCGCAGCTCAGCAACTCGGAGGAGCGGGAGTTCTCCCCCAGCTTCATCAGTTTCGTTAATCAGTGCCTTACCAAGGACGAGTCAAAAAGACCAAAATACAAAGAACTTCTGAAACACCCTTTCATCCTGATGTACGAGGAGCGCACGGTGGAGGTGGCGGGGTACGTGGGTAAGATCCTGGAGCAGATGCCGGCCTCCCCCAGCTCCCCCATGTACGTCGATTGATGCCGCCGTCACGCAAATGCCTAGCGACAAGGGCTGCGAGCGAAGCCAGACGCAGAGAGATCCCACCTCTCCCCCCATTGGCTGTCGGCGACCGGCCGCCTCCCTCCCTCGCGCCACGTGCAATAAGATCGGTGTTCGTTTCATTTCCCTTCCATCGTGTCTGTGTGCTACCGTCACATGTCAATCTTGCCCCTCCCCCTTTCCACTTAAAGGAACAGCTCACCCTGCCTGGGTCAGCGGGACGCGCACCCTATTCCTAACAGGGTTTTTTCTTGGGGGGGGGGGGGGGGTATATAAAAAAAAAAACAAAGCCTAGATGCTGCATGGATCAGTA
  3   1   2       bld Gas6      in                         ANBT2164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGGCTGCGAGCGAACCCCGACGCAGAGAGATCCCCCCTCTCCCCCCATTGGCTGTTGGGGACCGGCCGCCTCCCTCCCTCGCGCCAAGGGCAATAAGATCGGGGTTCGTTTCATTTCCCTTCCATCGGGTCGGGGGGCTACCGTCCCATGTCAATTTTGCCCCTCCCCCTTTCCTTTTAAAGGAACAGCTCCCCCCCCCTGGGTCAGCGGGACGCCCCCCCTTTTCCTAACAGGGTTTTTTTTTGGGGGGGGGGGGGGTATATAAAAAAAAAAACAAAGCCTAGATGCTGCATGGATCAGTAAGAGAGACCTGGCGCCATCGTACCCCCCGTTACCCTGTCCCGCAGGGGGGCAAAGAATATGAATTATATAAATATATATATTTTTTATTATTTTTAAAAAATGGAAATAAAAAGGACTTTTTTTTTTTTTTTTTTCATTTACTTTATTTTTTTTGGTTTTGTCGGGGGGGCGGGGATTCCTTCCCAAAGTGCAATAGATCAAACCGATTTTCCGCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACCAAAAAAGCAAAAAAGC
  3   1   2      skin Gas6      in                         ANBT2171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCCAGACCCAGAGAGATCCCCCCTCTCCCCCCCTTGGCTGTTGGGGACCGGCCCCCTCCCTCCCTCGCGCCACGGGCAAAAAAATCGGGGTTCGTTTCATTTCCCTTCCCTCGGGTTTGTGGGCTACCGTCCCATGTCAATTTTGCCCCTCCCCCTTTCCCCTTAAAGGAACAGCTCCCCCCCCCTGGGTCAGGGGGACGCCCCCCCTTTTCCTAACAGGGTTTTTTTTTGGGGGGGGGGGGGGGGTATATAAAAAAAAAAACAAAGCCTAGATGCTGCATGGATCCGTAAGAGAGACCTGGCGCCATCGTACCCCCCGTTACCCTGTCCCGCAGGGGGGCCAAGAATATGAATTATATAAATATATATATTTTTTATTATTTTTAAAAAATGGAAATAAAAAGTACTTTTTTTTTTTTTTTTTTTCATTTACTTTATTTTTTTTGGTTTTGTCGGGGGGGCGGGGATTCCTTCCCAAAGTGCAATAGATCAAACCGATTTTCCCCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACCAAAAAAGCAAAAAAGC
  3   1   2      shim Mus1 PIPE in                        CABH11025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGAGATCCCCCCTTTCCCCCCATTGGGTGTGGGGGACCGGCCGCCTCCTTCCCTGGGGCCAGGTGCAATAAAATCGGGGTTCGTTTCATTTCCCTTCCATGGGGTTTGGGGGCAACCGTCACATGTCAATTTTGCCCCTCCCCCTTTCCACTTAAAGGAACAGCTCCCCCTCCCTGGGTCAGCGGGACGCCCCCCCTTTTCCTAACAGGGTTTTTTTTTGGGGGGGGGGGGGGGGTATATAAAAAAAAAAACAAAGCCTAGATGCTGCATGGATCAGTAAGAGAGACCTGGGGCCATTGTACCCCCCGTTACCCTGTCCCGCAGGGGGGCAAAGAATATGAATTATATAAATATATATATTTTTTATTATTTTTAAAAAATGGAAATAAAAAGTACTTTTTTTTTTTTTTTTTTTCATTTACTTTATTTTTTTTGGTTTTGTCGGGGGGGCGGGGATTCCTTCCCAAAGTGCAATAGATCAAACCGATTTTCCGCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACC
  3   1   2       add Tad0      in                       IMAGE:6981818                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTCTCAGACTCAGGGGGGGGGGGAGACCCGGTAGGGTTTCAGTCCCCCGTGGAGCGGGGCGCGCGTTTTCTTTCAACCTTCCTGAAGGGAATTTTCCCTCCCCCGCATGGCTTGGTTACCCCTAACAGATAAAATTTTCATTTCCTTACAACTTAAGATTCGGTTGCACTTTCGCATCATGGCACCCCCCCCCAATAAGGTCCCTGTCAAGTATCCCGGGGGGCGGGTTTTCCATTCAAAAAGATCAAAGCCTCGTCCGGCCCGGGCCTATAAGAGGGACCCGGCTCCGTAGCCCCTCCCCTAAACCTGTCCCGCAGGGGGGCCAAGGGCCCCCAGAGGGTAAATATAGGGCGCCCCCCCTTTTTTAAAAAATGGAAATAAAAAGGACTTTTTTTTTTTTTTTTTTTATCAGCACCGATTCCATCTCTGGATTTTTCGGGGGGGCGGGGCATCCTTCCCACAGCGCAATAGATCAAACCCATTTTCCGCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACCAAAAAAGCAAAAAAGCAAAAAAAAAATGAAAACAGAAAAAATGATGTTGCATGACCCCCCCCCTCAAATCGAAGACC
  3   1   2      seed Gas6      in                         ANBT2425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCCCTCTCCCCCCATTGGCTGTGGGGGACCGGCCGCCTCCCTCCCTCGGGCCACGTGCAATAAAATCGGTGTTCGTTTCATTTCCCTTCCATCGGGTCGGGGGGCTACCGTCCCATGTCAATTTTGCCCCTCCCCCTTTCCCCTTAAAGGAACAGCTCCCCCCCCCTGGGTCAGCGGGACGCCCCCCCTTTTCCTAACAGGGTTTTTTTTTGGGGGGGGGGGGGGGGTATTTAAAAAAAAAAACAAAGCCTAGATGCTGCATGGATCAGTAAGAGAGACCTGGCGCCATCGTACCCCCCGTTACCCTGTCCCGCAGGGGGGCAAAGAATATGAATTATATAAATATATATATTTTTTATTATTTTTAAAAAATGGAAATAAAAAGTACTTTTTTTTTTTTTTTTTTTCATTTACTTTATTTTTTTTTGGTTTTGTCGGGGGGGCGGGGATTCCTTCCCAAAGTGCAATAGATCAAACCGATTCTCCGCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACCAAAAAAGCAAAAAAGC
  5   1   2       bld Egg0      in                         dad67a10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACACCGTGTATACCACNTCCGCTCNTGGAGCCCAAAAAACCCATTCCCGGGGGGTATATAAAATTAAAACAAAGCCTAGATGCTGCATGCATCAGTAAGAGAGACCTGGCGCCATCGTACCACCCGTTACCCTGTCCCGCAGGGGGGCAAAGAATATGAATTATATAAATATATATATTTTTTATTATTTTTAAAAAATGGAAATAAAAAGTACTTTTTTTTTTTTTTTTTTTCATTTACTTTATTTTTTTTGGTTTTGTCGGGGGGGCGGGGATTCCTTCACAAAGTGCAATAGATCAAACCGATTCTCCGCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATAT
  3   1   2       add Tad5      in                         XZT11251.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGAGACCTGGGGCCTTTGTTCCCCCCGTTTCCCTGTCCCCCAGGGGGGCCAAGGATTGGAAATATATAAAAATATTTTTTTTTTTTTTTTTTTTAAAAATGGAAATAAAAAGGACCTTTTTTTTTTTTTTTTTTCATTTACCTTATTTTTTTTGGTTTTTTCGGGGGGGGGGGGGTTCCTTCCCAAAATCCAAAAGATCAAACCGTTTTTCCCCCCGGGGGTCATGGGGGGGGTCCTTTTTTGGACCCTTTTTTTGGGTGGGCCCCCCCCCCCTCTGGCTTTTTTGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTTTTCTAGTTATTTTACGTTCTCGGGAGGGGTTGGAAATTTTTTTTTTTTAATTTGTAAGGAATCGTTAAAAATAGTGAGATATCTCTTTTCCAAAAAAGCAAAAAAGCAAAAAAAAAATGGAAAACCGAAAAAATGATGT
  3   1   2       bld Egg0      in                         dad67a10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTTTTATTATTTTTAAAAAATGGAAATAAAAAGTACTTTTTTTTTTTTTTTTTTTCATTTACTTTATTTTTTTTGGTTTTGTCGGGGGGGCGGGGATTCCTTCACAAAGTGCAATAGATCAAACCGATTCTCCGCCAGGCGGTCATGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCTCTGGCATTCTGGCAGAGAACGGGTTAATGGTTGGAAAAACGATCTGTTCTGCTATTCTAGTTATTTTATGTTCTCGAGAGTGGTTGGAATTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACCAAAAAAGCAAAAAAGCAAAAAAAAAATGGAAAACAGAAAAAATGATGTTGCATTGATGAAATCTAACATTAAAATATTCAGAGATGGAATCTTGCTGATAAAAAAA
  3  -1   2       add Gas8      in                          st43n08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACCGAATTCTCCGCCAGGGCGGTCATGGTGACGGATCCTGTTCTGGACGCTTTTTATTGGTCGCCCCCCCCCCCNCTGGNATTNTGGNAAAAAANGGGTTAANGGTTGGAAAAAC
  3   1   2       add Gas8                                  st87o22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCNTTTTNGGNNNNTTTTTTTNGGNNNCCCCCCCCCCCTTTGGCNTTTTGGCNGNGAACGGGTTAATGGNTGGAAAAACGATCTGTTTTGCTATTCTAGNTATTTTATGTTCNCGNGNGNGGNTGGAANTTTTTTTTTTTTAATTTGTAAGGAATCGTTAAATATAGTGAGATATCTCTTTACCAAAAAAGCAAAAAAGCAAAAAAAAAATGGAAAACAGAAAAAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)