Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012155418 Xt7.1-EC2BAA1DH06.3.5 - 38 ESTs
                                                                       ...0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-EC2BAA1DH06.3.5    GCACAGGCCGTTGCTCTCAGAGCTGCGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAGGAGAGTGTCCAGGTGGCAAGGGTACAATATGTAACAAAGAAACCCGGATTAAAAGAAGTTCTTGTGCAGTTAGAGGAACATCTGGAATGCACGGGTAGAGCAAACTCTAATTCATATTATCTAGAAAAACAAACCGATGTGAGGTGAAAATAAGCTAGACAGGATCATCTGGGACTCGGATGTGTACTCCATGTTACATTCCCGAATCTTCTACGTATGGTGCTTTATTGACTGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAGAGTTGACTATTCTTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAAATAAGACCCAGCATAGCTGTTTGAATGCTGATCCGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCCAGTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTTTTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAAATCTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCTACTTTTGTTTCCCGTTGTGTCTGATAATTTAATAATTTGAAATAAAATGTACCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCGGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAACAAAACAAAAAAAAAAGCGTGAAATGGCATTTTTATTCTTGTAAGTGCATTTGTACAGTGTCAAGTAGCAAGGGAAAAAAGATATTTGCTACATGTGTTGAACAAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAAGAATTGTGTTTTTTTTTTTTTGTAAAGTGGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGTAAGAAAGCCTGCTATGTTTTCTTG
                                                  Xt7.1-CHK-1008266722          GCCGTTGCTCTCAGAGCTGCGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAxxAGAGTGTCCAGGTGGCAAGGGTACAATATGTAACAAAGAAACCCGGATTAAAAGAAGTTCTTGTGCAGTTAGAGGAACATCTGGAATGCACGGGTAGAGCAAACTCTAATTCATATTATCTAGAAAAACAAACCGATGTGAGGTGAAAATAAGCTAGACAGGATCATCTGGGACTCGGATGTGTACTCCATGTTACATTCCCGAATCTTCTACGTATGGTGCTTTATTGACTGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAGAGTTGACTATTCTTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAAATAAGACCCAGCATAGCTGTTTGAATGCTGATCCGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCCAGTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTTTTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAAATCTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCTACTTTTxxTTxCCGTTGTGTCTGxxxAxTTAATAATTTGAAATAAAATGTACCxTxAxxAAxxxxGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCGGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAACAAAACAAAAAAAAAAGCGTGAAATGGxxxTTTTATTCTTGTAAGTGCATTxxxxxxGTGTCAxxxxxxAAGGGAAAAAxxATATTTGCTACATGTGTTxxAxxAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAxxAxTxGTGTTTTTTTTTTTTTGTAAAGTGGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGTAAGAAAGCCTGCTATGTT
                                                      consensus depths         2     2     3     3     3     3     4     5     7     8     8    10     8    10     8    10     8    10     8    10     9    11     8    11    10    11    10    11    10    11    10    11    11    12    10    11    10    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    12    12    12    12    10    11    10    10     9     9     9     9     7     9     8     9     7     8     7     8     7     8     7     8     5     6     5     6     4     6     5     6     5     6     6     6     4     6     4     6     4     6     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     1     3     1     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     2     5     2     5     2     5     2     5     4     7     4     7     6     7     9     9     9     9     9     9    10    10    10    10     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     6     9     5     9     5     8     4     8     4     7     4     7     4     7     4     7     4     5     3     5     4     5     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     6     7     8     9     8     9     8     9     9     9     7     9     9     9    10    10    11    11    11    11    11    11     9    11    11    11     9    11    11    11    11    11    11    11    11    12    11    12    12    12    10    12    11    12    11    12     9    11    11    11     9    11    10    11     6    11     5    11     6    11     6    11     5    10     5    10     5     9     5     9     5     8     5     8     5     8     5     8     4     8     4     8     4     8     3     5     3     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     4     5     2     5     2     5     2     5     4     5     2     5     2     5     2     5     2     5     2     4     2     4
  5   1   2      ests                                 Xt7.1-XZT21654.5    GCACAGGCCGTTGCTCTCAGAGCTGCGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGAT
  5   1   2      ests                              Xt7.1-EC2BAA1DH06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGCAGTTAGAGGAACATCTGGAATGCACGTGTACAGCAAACTCTAATGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAGAGTTGACTATTCTTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAAATAAGACCCAGCATAGCTGTTTGAATGCTGATCCGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCCAGTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTTTTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAAATCTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCCTCTTTTGTTTCCGGTTGTGTCTGCAAATTTAATAATTTGAAATAAAATGGTACCTTAATAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCGGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAACAAAACAAAAAAAAAGCCGTGAAATGGACTTTTTATTCTTGTAAGTGCATTGTTACAGTGTCACATAGCAAGGGAAAAAAGATATTTGCTACATGTGTTTGACAAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAGAAATTGTGTTTTTTTTTTTTTGTAAAGTGGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGTAAGAAAGCCTGCTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----T------
                                               BLH ATG     538     547    
                                               BLH MIN     538      49    
                                               BLH MPR     538      49    
                                               BLH OVR     538     750    
                                               CDS MIN     538      49    
                                               EST CLI      40      13    
                                               ORF LNG     538      20    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 8e-052     XP_709929.1 PREDICTED: similar to Pdgfa protein isoform 2 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 3e-053     NP_148983.1 platelet-derived growth factor alpha isoform 2 preproprotein [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 7e-055     NP_989637.1 platelet-derived growth factor alpha polypeptide [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 1e-055     NP_032834.1 platelet derived growth factor, alpha [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 5e-080     AAA49927.1 platelet-derived growth factor A chain long form precursor [Xenopus laevis]  =======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 5e-080     NP_001081304.1 platelet-derived growth factor A chain, long form [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 5e-085     CAL49315.1 platelet derived growth factor, alpha [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-EC2BAA1DH06.3.5                                                                                                                                                                                                              TAA------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAA---------------TAA------------------TAG------------------------------------------------TAG------------ATGTGA------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------ATG---------------------TAA------------------------TGA---------TGA------------------------------ATG---------------------------ATG---------------ATG---------------------------TGAATG------------------------------------------------TAA------------------------------------------------TAA---TAG---------TAA---------TAA------------------------------------------------TAG------ATG---------------------------------------------TAG------------------------------------------------------------TAA---------------------------------------------------------------------------ATG------------------------------------TGA------ATG------------------------------------------------TGA---------------------------------TAG---------------------TAG------------------------------------------ATG---TAG------------TGA------------TAG---------------------------------------------------ATG---------ATG------------------------------------TGA---------------------------------TGA---------------------TAG------------------------------------------------------------------------ATG---------------------------TAG---------------TAG------------TAG------TAA---------------------ATG---------------ATG---TAA---------------------------------------------TAG---------------------------------TAA---------TAG------------------TAA------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------TGATAA---------------TAA---------TAATAA---ATG---------TGA------------------------TAATAG---TAA---------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------TAA---------------------------ATG---ATG------------------------------------------------------------------------------TAA---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  5   1   1           HdA  FL                     THdA029c02.FL-Sanger                                                  CGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAGGAGTGTCAAGGTGGCAAAAGTAGAATATGTAAGAAAGAAACCCAAATTAAAAGAAGTTCTTGTGCAGTTAGAGGAACATCTGGAATGCACGTGTACAGCAAACTCTAATTCAGATTATCGAGAAGAAGAAACCGATGTGAGGTGAAAATAAGCTAGACAGGATCATCTGGGACTCGGATGTGTACTCCATGTTACATTCCCGAATCTTCTACGTATGGTGCTTTATTGACTGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAAAGTTGACTATTATTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAAATAAGACCCAGCATAGCTGTTTGAATGCTGATCTGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCCAGTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTTTTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAAATCTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCTACTTTTGTTTCCGTTGTGTCTGCATAATTTAATAATTTGAAATAAAATGTACCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCTGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FLt3                   TEgg039p14.FL-Sanger                                                    CAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAGGAGTGTCAAGGTGGCAAAAGTAGAATATGTAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-XZT21654.5    GCACAGGCCGTTGCTCTCAGAGCTGCGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGAT
                                                  Xt7.1-CHK-1008232004          GCCGTTGCTCTCAGAGCTGCGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCA
  5   1   2       bld AbdN 5g                            IMAGE:7021379 CTAGCACAGGCCGTTGCTCTCAGAGCTGCGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGGAAGTGTTGAAAGAAGCAGTTCCCTGCTATCTGGTAAAACAAGGAACTGTTTATATTACCAAGATACCCTCGNTAGACAAA
  5   1   2       bld Egg  5g                        TEgg125o22.p1kSP6    GCACAGGCCGTTGCTCTCAGAGCTGCGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCG
  5   1   2       bld HeRe      in                     EC2CAA43AH05.g1            GGTTGCTCTCAGAGCTGCGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAA
  5   1   2       bld Gas  5g3  in                  TGas089f12.p1kaSP6                             CGCTCAGTCCGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGA
  5   1   2       bld Gas1 5g   ?                      NISC_mq09d06.y1                                     CGACAGGAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTNGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGC
  5   1   2       bld Gas1 5g3  in                     NISC_mq08a02.y1                                            GAGTTTCGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAG
  5   1   2   12 seed Tad5 5g3  in                         XZT21654.5p .................................................CGCAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCC
  5   1   2       bld HdA  FL   in                   THdA029c02.p1kSP6                                                    CAGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCANCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTANGAAGAGGCGAGGATGCTTCTGGAGCCAACATAAAATCACAAACACGCGACTTTCGCCATTATAAGCTTGTGCC
  5   1   2       bld Egg  5g                        TEgg094g06.p1kSP6                                                     AGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGC
  5   1   2       bld Egg  FLt3 in                   TEgg039p14.p1kSP6                                                      AGCGTTCGGGATTGTTCGCATTGGCCGATCAGGTGCGACTGCGGAGCGCTCAGGCTACAGGCTGTTCCATCTGGTGCAAGGGGGGAGCAACCTTTGGAAAGTTCATTGATCCCCCCCTATTTAGCGCGGCCGTGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGAT
  5   1   2       bld TbA  5g3  in                   TTbA072l11.p1kSP6                                                                                                                      CAGTCTCGGTGCGGGGGGGAGCAACTCTTTGTAAAGCGCATTGATCCCGCCCTATTTAACCCGGCCGGGCTCTTTGCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAGAAAGAGGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCT
  3   1   2       bld Egg  FLt3 in                    TEgg039p14.q1kT7                                                                                                                                                                                                 GCCAGCTTTGTGCTAACGTTGGATTGAGAGGGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAGNGAGTGTCAAGGTGGCAAAAGTAGAATATGAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Te5  PIPE in                         CAAO2129.5p ..............................................................................................................................................................................................................................GGGAGGGGGTGCAGAAGGAGCTCCGGCAGACAGGTGATGGGCGTTTCAGTGGATACGTTGGGCTGATCTGAGCGCTAAACATGCACATTCTGCGCCTCATCCACTGCTGAAGGCGCCCAACCATCAGCCAGCGAAACCTGGGGGAAAGGGGGTCTATAGTGGATACACCTAAAACAAACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACACCACAGGAGTGTCAAGGTGGCAAAAGTAGAATATGTA
  5   1   2       bld TbA  5g3  in                   TTbA072m13.p1kSP6                                                                                                                                                                                                                                                                                                                                        GCTGAAGGCACCCAACCATCAACCGGCGAAACCTGTGGGAAAGGGGGTCTATAGTGCATACACCTAATACACACCTGCGCCTTATCTGCCGCTTTCCTGGGCTGTTGTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCCTACTGCAAAACGTTGCGTTGTCATTGAACATAAATCACAACATGACGCAATGAGGATCTGGGCTTGGAATCTGCTGCTAATCGTCAGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAACAGACATCCCCCAGGAGCTGATCGACAGGCTGGCTCACAGCGAAATCCGCATCATCAGCGACCTGCAGCGTCTCCTGGACATTGATTCCGTANGAGGAGGCGAGGATGCTTCTGGAGCCAA
  3   1   2       bld HeRe      in                     EC2CAA43AH05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCTGTTTTTTTGCCCCTAAGGGATGGTACTGACTCCCCCAGCTACAGGAGCGGGTCTGCGGCTCTTACTGCAAAACGTTGCATTGTCATTGAGCAGAAATCGCAGCAGGACGCAATGAGGATCTGGGCTTGGATTCTGCTGCTAAGCGTCTGCTGCTACCTGTCTCCTTCATTGGGCGAGGAAGCAGAGATCCCCCAGGAGCTGATCGAGAGGCTGGCTCACAGCGAAATCCGCAGCATCAGCGACCTACAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACACGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCAGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCGACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCAGCAGTGTCAAGTGCCAGCCATCAAGGATACAC
  5   1   2       bld Egg                            TEgg094m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCGACCTGCAGCGTCTCCTGGACATTGATTCCGTAGGAGGAGGCGAGGATGCTTCTGGAGCCAACATAAGATCACAAACGCGCGACTTTCGCCATAATAGGCTTGTGCCAGAGAAGCGTTCTGTTCCCAGTCGCGGAAAAAGAAGTGTTGAAGAAGCAGTTCCTGCTATCTGTAAAACAAGAGACTGTTATATACGAGATACCTCGTAGCAAAATTGATTCCACATCTGCCAATTTTCTAATCTGGCCTCCGTGTGTGGAGGTGAAACGATGTACGGGATGCTGCAACACCATACAGTGTCAAGTGCCAGCCATCAAGGATACACCACAAGAGTGTCCAGGTGGCAAGGGTACAATATGTAACAAAGAAACCCGGATTAAAAGAAGTTCTTGTGCAGTTAGAGGAACATCTGGAATGCACGGGTAGAGCAAACTCTAATTCATATTATCTAGAAAAACAAACCGATGTGAGGTGAAAATAAGCTAGACAGGATCATCTGGGACTCGGATGTGTACTCCATGTTACATTCCCGAATCTTCTACGTATGGTGCTTTATTGACTGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTA
  5   1   2      ests                              Xt7.1-EC2BAA1DH06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGCAGTTAGAGGAACATCTGGAATGCACGTGTACAGCAAACTCTAATGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAGAGTTGACTATTCTTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAAATAAGACCCAGCATAGCTGTTTGAATGCTGATCCGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCCAGTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTTTTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAAATCTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCCTCTTTTGTTTCCGGTTGTGTCTGCAAATTTAATAATTTGAAATAAAATGGTACCTTAATAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCGGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAACAAAACAAAAAAAAAGCCGTGAAATGGACTTTTTATTCTTGTAAGTGCATTGTTACAGTGTCACATAGCAAGGGAAAAAAGATATTTGCTACATGTGTTTGACAAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAGAAATTGTGTTTTTTTTTTTTTGTAAAGTGGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGTAAGAAAGCCTGCTA
                                                  Xt7.1-CHK-1008229983                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTAGAGGAACATCTGGAATGCACGTGTACAGCAAACTxxAxTGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAGAGTTGACTATTCTTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAAATAAGACCCAGCATAGCTGTTTGAATGCTGATCCGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCCAGTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTTTTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAAATCTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCxxCTTTTGxTTxCxGTTGTGTCTGCAxAxTTxATAATTTGAAATAAAATGxxxCxTTAATAAxxxxxGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCGGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAACAAAACAAAAAAAAAGCxxxxAAATGGACxTTTTxTTCTTGTAAGTGCATTGTxxxxxxGTCACAxxxxxAxGGxAAAAAGATATTTGCTACATGxxTTxxACAAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCxAxxxxAATTGTTTTTTTTTTTTTTTGTAAAGTGGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGTAAGAAAGCCTGCTATGTTTT
  3   1   2       bld Te5  PIPE in                         CAAO2129.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGAGTGTCAAGGTGGCAAAAGTAGAATATGTAAGAAAGAAACCCAAATTAAAAGAAGTTCTTGTGCAGTTAGAGGAACATCTGGAATGCACGTGTACAGCAAACTCTAATTCAGATTATCGAGAAGAAGAAACCGAAAGACAGGAAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTCGATTAAATAAT
  5   1   2       bld HeRe      in                      EC2CAA1DH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGAAGTTCTTGTGCAGTTAGAGGAACATCTGGAATGCACGTGTACAGCAAACTCTAATTCAGATTATCGAGAAGAAGAAACCGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAGAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGGTATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATA
  5   1   2       bld HeRe      in                      EC2BAA1DH06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGAAGTTCTTGTGCAGTTAGAGGAACATCTGGAATGCACGTGTACAGCAAACTCTAATTCAGATTATCGAGAAGAAGAAACCGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAGAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAGAGTTGACTATTCTTGAACAAACTAACAAATGGTTGATGTGCATGTTACAAAAGAGAAATA
  3  -1   2       bld Spl1      in                         CABK8975.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGATGTGTACTCCATGTTACATTCCCGAATCTTCTACGTATGGTGCTTTATTGACTGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTCGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAAACTCACAGTTTCCGGGAATACAAAAAGCTGTCAAATGATAAAGTTGACTATTATTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAAAA
  3   1   2       bld TbA  5g3  in                    TTbA072l11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTATTGACTGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTCGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCTGTCAAATGATAAAGTTGACTATTATGAACAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TbA  5g3  in                    TTbA072m13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTGACTGTTTCGTTTTTGTTCTCTTGTGCAGAAAGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTCGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACGGTTTCCGGGAATACAAAAAGCTGTCAAATGATAAAGTTGACTATTATGAACAAAAAAAAAAAAAAAAAAGC
  5   1   2       bld Gas7      in                         XZG36822.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACAGGAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTCGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAAAGTTGACTATTATTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAA
  3   1   2      seed HeRe      in                      EC2BAA1DH06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAAAAAAACTTGTTCAAACGACACTCTGTGAGAACAAAGGAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAGAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAGAGTTGACTATTCTTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAAATAAGACCCAGCATAGCTGTTTGAATGCTGATCCGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCC
  3   1   2       bld HeRe      in                      EC2CAA1DH06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGAGAACAAAGAAACAATGTACATTTCTTTAATGTGACATCAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAGAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTAGATTAAATAATATTTCTGTTATTTTGTAATTATTTGAAAAATTCCAACTCAACAGTTTCCGGGAATACAAAAAGCCGTCAAATGATAGAGTTGACTATTCTTGAACAAACTAACAAATGTTGATGTGCAATGTTACAAAAGAGAAATAAGACCCAGCATAGCTGTTTGAATGCTGATCCGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCCAGTGGGGA
  3   1   2       bld Gas1 5g3  in                     NISC_mq08a02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAGCAAGTATTGCAGCACTCTTACAGAGAAGAGACCGCTTCCCCTGTCAGAAAAACTGCAGCAACAAAACAAGATGGCGGATGGCTGAAAGAAGGATATCACATTAAAAAAGTACTGCAAACCATAGGGATTGAATAGAGGCCTGATGTCCAAGCAACGGTGCTTTATGTCAAGAGATGTGCCTGCTTTTGCTGTTTTCAAGATGGATGTTTATTGATAGAAACATGGCAAAGAAAAGCCAGGAATGTATCAAATGAATGTGTCGACGCAGAAGCTACAAAAACAATGCATCCTTGCTCAGTGGTGTTTAAAGTCTTCACAAAAACCTGGGAAGCCTTAAGTGGACTTTTTTTTTTAATTAAACATAGCGTAACTATTAAGCTTTGGGGTAAATAAAGTATAACAGCACCATCCTAGCACTAAGCAGCCATCTGCCTCTATAGTGGTCGATGACTGCTAGACATAGCCTAGTCCTATTGGGCAGAGGAAGAGCTCTCTAGTGTTGGATTTGTTTTAGGTGGATTCACTCTTGCTGGTTATGCAGGTATAAAATATTCGATTAAATAATATTTCTGTTAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2      skin Gas7      in                         XZG15754.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCCAGCATAGCTGTTTGAATGCTGATCTGTGAGCACCTATTGCAATCATTTTAGGTTTTGTTGTGTAGAATGTGATTAGAATTACTCTCTAGAGTAGTAATTCCCAAACTGTGGGGCTGGCCCCCAGTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTTTTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAAATCTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGA
  3   1   2      skin Tad5 5g3  in                         XZT21654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTGGGGCTGGCCCCCAGTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTTTTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAAATCTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCTACTTTTGTTTCCGTTGTGTCTGCATAATTTAATAATTTGAAATAAAATGTACCTT
  3   1   2       bld Tbd1      out                        CBXT3841.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGGGACATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTATTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAGGTTTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCCTACTTTTGTTTCCGTTGTGTCTGCATAATTTAATAATTTGAAATAAAAGGTACCTTAATAAATCAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas089f12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGGAGTAGTGCCGGGGGGCCTGAAGTAGAGATTATTAGGGTGAGATTTGGGCTCAAGAACATATTTGCTGCCTAGATATTCATGGAACTATGGCTAAAAGAATGATCTACCAAGGTTTTACCAAATCTGTAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTCTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCCTACTTTTGTTTCCGTTGTGTCTGCATAATTTAATAATTTGAAATAAAATGTACCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCTGGCAAGTTATTATGTTATCATACACAACCAACATTTTCACTAGCAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  FL   in                    THdA029c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAACCTTGTTATGAGATAATGGTTGGACTTCAAAGGAAAGTTTAAACTGAAAAAGCTACCAAGCACTGTTTTAGAGCATTAGAAGTTTTTTAGGTGAGAGATCTAACAGTTCAACAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGTTCGGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTTTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATTTACTTAAATTGTTCCCTAGCCACCTTTTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTTTGCTATGAATCTATAGTATTATTTTTTAGCAGGATGCAATTTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCTACTTTTGTTTCCGTTGTGTTTGCATAATTTAATAATTTGAAATAAAATGTACCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCGGGCAAGTTATTATTTTTTCATACACAACCAACATTTTCACTTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Spl1      in                         CABK8975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGATCTAACAGTTCACAAAAAAGTAAATATGATGTTTTCTGTATTAAAATGAGCAGACTCCATTGGTCCAGTAACCTGTAGAAACCAATCAGAAGTTAGCTTTTACTGGCCTAGCTCAGATAAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCCTACTTTTGTTTCCGTTGTGTCTGCATAATTTAATAATTTGAAATAAAATGTACCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCTGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAACAAAACAAAAAAAAAGCGTGAAATGGACATTTTTATTCTTGTAAGTGCATTGTACAGTGTCACAGTAGCAAGGGAAAAAGATATTTGCTACATGTGTTTGAACAAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAGAATTGTGTTTTTTTTTTTTTTGTAAAGTTGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGT
  3   1   2       add HdA       out                  THdA008g01.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGTTAGCTTTTACTGGCCTAGTTCAGATAAAATGACAAAAGCAAACTTTTGATGGGGGTTACTCCAAATATGGTTTAAACCTGGGGGCAATCAGATAATAAAGGGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGGGAATCTACTTAAATTGTTCCCTAGCCCCCTTTTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGGGTAGAGGTTTGCTATGAATCTATAGTATTTTTTTTTAGCGGGAGGCAATTTAATGAACTGTTTTCAAATTTAGGGAGGCAAAGGTATATATATTTAGGGGATTTCCCCCCCCCCCACTTTTGTTTCCGTTGGGTTTGCATAATTTAATAATTTGAAATAAAATGTCCCTTAATAAATCATGGGATATCCGGGAAACATCCCACTTGTGCCAGTTGCCTAAAAGGGCTAATTTTTTTTTTTTTTTATTTTTGGCAAGTTTTTTTTTTTTCATACCCAACCAACATTTTCCCATGGCAAAAAAAAAACAAAACAAAAAAAAAGGGGGAAATGGACATTTTTTTTTTTGTAAGTGCATTGTACAGTGTCCCCGTAGCAAGGGAAAAAGATATTTGCTACATGGGTTTGAACAAATCCTAAAATTTTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAGAATTGGGTTTTTTTTTTTTTTGTAAAGTTGAAGTTTGTATTTTTATTTAAAATAAAGGTTTTTTTTTAGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Gas5                                  XZF2764.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCTCAGATAAATGACAAAAGCAAACATCTGATGTGGGTTACTCCAAATATGGTCTAAACCTGGAGGCAATCAGATAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCCTACTTTTGTTTCCGTTGTGTCTGCATAATTTAATAATTTGAAATAAAATGTACCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTAAAAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                         XZG15754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATAAAATGCCAAAAGCAACCCTCTGAGGTGGGTTCCCCCAAATATGGTCTAACCCGGGGGGCAATCAGATAATAAAGGGGGGAAATCCGATAAGAAATGGGGGGCATTTTTTCCTTGCAAGGGGGAATCTCCTTAAATTGTTCCCTAGCCCCCTTCTCCCTTGTTTTAATGCCCAAGGGCAAATTTTTCCAAGGAACGGGTAGGGGTCTCCTATGAATCTATAGTTTTTTTTTCTGCCGGGAGGCAATTTAATGACCGGTTTTCAAATTTGGGGAGGCAAAGGTATATATATTTGGCGGATATCCCCCCCCCCCCTTTTGTTTCCGTGGGGTCGGCAAAATTTAATAATTTGAAATAAAATGTCCCTTAATAAATCAGGGGATATCCGGGAAACATCCCCCTTGTGCCAGTTGCCTAAAAGCGCAAATTTTTCTTTCTTTTTATTTCGGGCAAGTTATTTTTTTTTCATACCCACCCAACATTTTCCCTTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG36822.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAATAAAGAGGGGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTCTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCTACTTTTGTTTCCGTTGTGTCTGCATAATTTAATAATTTGAAATAAAATGTACCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCTGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAACAAAACAAAAAAAAAAGCGTGAAATGGACATTTTTATTCTTGTAAGTGCATTGTACAGTGTCACAGTAGCAAGGGAAAAAGATATTTGCTACATGTGTTTGAACAAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAGAATTGTGTTTTTTTTTTTTTTTGTAAAGTTGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGTAAGAAAGCCTGCTATGTTTTCTTGAACCAAAAAAAAAAAAAAATATATATAT
  5   1   2       bld Gas7      in                         XZG27781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAAATCAGATAAGAAATAGGGTGCATATTATACTTGCAAGAGTGAATCTACTTAAATTGTTCCCTAGCCACCTTCTCCCTTGTTTTAATGTCCAATGGCAAATATTTGCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTTTAGCAGGATGCAATCTAATGAACTGTATTCAAATATAGAGAAGCAAAGGTATATATATATAGCTGATATCACCCCCCCTACTTTTGTTTCCGTTGTGTCTGCATAATTTAATAATTTGAAATAAAATGTACCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCTGGCAAGTTATTATTTTATCATACACAACCAACATTTTCACATAGCAAAAAAAACAAAACAAAAAAAAAGCGTGAAATGGACATTTTTATTCTTGTAAGTGCATTGTACAGTGTCACAGTAGCAAGGGAAAAAGATATTTGCTACATGTGTTTGAACAAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAGAATTGTGTTTTTTTTTTTTTTGTAAAGTTGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGTAAGAAAGCCTGCTATGTTTTCTTGAACCAAAAAAAAAAAAATA
  3   1   2       add Gas7      in                         XZG27781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAGGAACGTGTAGAGGTCTGCTATGAATCTATAGTATTATTTTTTAGCAGGATGCAATCTAATGAACTGTTTTCAAATTTAGGGAAGCAAAGGTTTTTTTATTTAGCTGATTTCCCCCCCCCTACTTTTGTTTCCGTTGGGTCGGCATAATTTAATAATTTGAAATAAAATGTCCCTTAATAAATCATGGGATATCCGTGAAACATCACACTTGTGCCAGTTGCCTAATAGCGCTAATTTTTCTTTCTTTTTATTTCGGGCAAGTTATTTTTTTTTCATACCCAACCAACATTTTCCCTTGGCAAAAAAACCAAACCAAAAAAAAAGCGTGAAATGGCCATTTTTATTCTTGTAAGTGCATTGTACAGTGTCCCAGTAGCAAGGGAAAAAGATTTTTGCTCCATGGGTTTGAACAAATCCTAAAATTCTTTATTTTTGGTAAAAAAAAGTATGCTTATGTGTATTCAACAGAATTGGGTTTTTTTTTTTTTTGTAAAGTGGAAGTTTGTATTTTTATCTAAAATTAACATTTTTATATAAGTAAGAAAGCCTGCTATGTTTTCTTGACCCaaaaaaaaaaaaaatatatttttaaaaaaaaaaaaaaaaaaaataaaaaaaaaaaaaaaaaaaaT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)