Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012155439 Xt7.1-TGas091i06.3.5 - 30 ESTs
                                                                       ......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas091i06.3.5                                     GTGCCGAAAGCCGGAGGCGACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008267556                                           AAAGCCGGAGGCGACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTGCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAAAAAA
                                                      consensus depths                                          2     4     5     6     5     6     7     7     8     8     8     8     7     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     8     9     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11     8    11     8    11     8    11     8    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     8    11     6     9     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     7     5     7     4     6     3     5     5     7     5     7     4     7     4     7     4     7     6     9     6     8     6     8     6     8     6     8     6     8     5     8     5     8     5     8     5     8     5     8     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     8     5     8     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     5     5     5     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     9     7     9     7     9     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    11     7    12     7    12     7    12     7    14     8    15     8    14     8    13     8    13     8    13     8    13     8    13     8    13     8    13     8    13     8    13     8    13     8    13     8    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    12    13    12    13    11    13    11    13    11    13    11    12    11    12    11    12    11    12     9    12    10    12     9    12     9     9     9     9     8     9     6     7     3     4
  5   1   2       e>1                                 Xt7.1-CAAK5447.5                                     GTGCCGAAAGCCGGAGGCGACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCA
  5   1   2       e>1                               Xt7.1-TGas091i06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTGCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                                              PROTEIN --- Ce ---- 8e-074     NP_497777.1 UDP-N-acteylglucosamine pyrophosphorylase 1 (53.5 kD) (3E932) [Caenorhabditiselegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                             PROTEIN --- Sc ---- 8e-097     NP_010180.1 UDP-N-acetylglucosamine pyrophosphorylase; Qri1p [Saccharomyces cerevisiae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                    PROTEIN --- Dm ==== 2e-128     NP_723183.1 CG9535-PB [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PREDICTED - Sp ---= 2e-147     XP_779933.2 PREDICTED: hypothetical protein isoform 1 [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PROTEIN --- ?? ---= 2e-165     NP_001086968.1 UDP-N-acteylglucosamine pyrophosphorylase 1 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PROTEIN --- Hs ---- 2e-169     NP_003106.2 UDP-N-acteylglucosamine pyrophosphorylase 1; sperm associated antigen 2 [Homosapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                    PROTEIN --- Mm ---- 0          NP_001028465.1 UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PREDICTED = Dr ==== 0          NP_956588.1 hypothetical protein MGC56509 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                    PREDICTED - Gg ==== 0          XP_415568.2 PREDICTED: similar to UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                  PROTEIN --- Xl ---- 0          AAH82877.1 LOC494771 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                  PROTEIN --- Xt ---- 0          CAJ83512.1 UDP-N-acteylglucosamine pyrophosphorylase 1-like 1 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas091i06.3.5                                                                                                                                                   ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TGA---------------------------------TAA------------------------------------------------------------------------TAG------------------TGA---------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------ATG---------------ATG------TGA---------------------------------------------------------------------------------------------------------------------TAG---------------------------------------ATG
                                                                   ORF                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       e>1                                 Xt7.1-CAAK5447.5                                     GTGCCGAAAGCCGGAGGCGACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCA
                                                  Xt7.1-CHK-1008234726                                           AAAGCCGGAGGCGACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTG
  5   1   2       bld In54                            IMAGE:8944993.5p CGGAATGATAAACAACCGATTACCCCTGATTCGAATTCGTCCCAAGCCGGAGGCGACGGGCGGAGGAGTCCGGCCAGGGGCAACTGTTTCGGTTCTGGGATGAGCTGAGCCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGACTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCCGCGGTGGGGTTCGACGGTGCGGCCATCATGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGTTCTGTACCGGCTTCTGTCGATAAACCGCATCTGAGGAATTGGATGGGGAAG
  5   1   2       bld Tbd0      in                     NISC_nl08h09.y1                         AAAGTGCGGAAAGTGCCGAAAGCCGGAGGCGACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGNGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGG
  5   1   2       add Gas8      in                          st24c02.5p                            GTGCGGAAAGTGCCGAAAGCCGGANGCTACGGGNGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGANTCCGGCGGAGAAGGAGGCGCTGTTGNAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCANCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCANAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGNAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCATATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCTGGCCTCCCCAGCGCCAAAACCCTGTACCANATCCAGGCCGAGCGGATCCGCCGGNTGCANCAATTGGCCAGTGAGCGTNACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGANGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGNACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCNACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGNCTCCATATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATACCGCATCCTG
  5   1   2       bld In60                            IMAGE:8950354.5p                               GGTTTTTTATTTAAGGGAGTATTGAGAATAAGAATTCGTCCCGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGTAGGATATGGAAGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACACATCCTGGTCCAGATGGCCCGACCCGGTCTTTTATCGGCTCTCGTGTGAACCAAGGTGCCCAACTGTGCGCCAAGTATGAAAATGGTACCCTGCTCAAACCTATGTGGGTGTGTGTCCAATGTTATTGGGTCTCTACCATGAGTGGAATTTATGGTGAAATCCAAGC
  5   1   2       bld Gas8                                   st1j05.5p                                      TGCCGAAAGCCGGAGGCGACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAG
  5   1   2      seed Brn3      in                         CAAK5447.5p                                           AAAGCCGGAGGCGACGGGCGGAGGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGGTAG
  5   1   2       bld Te1       in                        CBWN14289.b1                                                                 GGAGTCCGGGCAGGGGCAGCTGTTTCGGTTCTGGGATGAGCTGAGTCCGGCGGAGAAGGAGGCGCTGTTGGAGCAGCTGGAAATGCTGGAGCCCCGGGAGTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGGAGGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGGACAACATCCTGGTCAAGATGGGCCGGACCCGGTCTTTATC
  5   1   2       bld Tail      in                         CBSW1130.b1                                                                                   GCTGTTTCGGTTCTGGGATGAGCTGAGCCCGGCGGAGAAGGAGGCGCTATTGGAGCAGCTGGAAATGCTGGAGCCCCAGGAGTTGGGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGAGCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGC
  5   1   2       bld In63                            IMAGE:8960842.5p                                                                                                                                                                 AGTTTTGAGGGAGCACTGCCAGCGGGCAAGGGAGGCCTATGTGCGGGAAAGCAGCGCCCCCCAGCGGCTGGATGATAGAATGCAACCTGTACCCCCAGAGTTCCTGGGGAGCGTCCGGCACAGCGGCACCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGTCTGACTGTGCGCCAAGGTAGTGGAGAAGGGGTACTCGGCCGAGCCAGTGGGGTGGTGTGCCGAGTGATGGGGTCTTACCAGTGTGGAATTATAGCGAATTCAGCCTCGAAACCGTCGAGAGCGCAATCCCACCGCGCCTTGACTCACCGCTGCACATCTGCACACTCCTCACGTGCCTCTAAGCTGTGATTGGTCTTTGGAGCGCCGCCTGAAATACCACGTAAC
  5   1   2       bld In60                            IMAGE:8949501.5p                                                                                                                                                                                                                                                                                                 CCGGGGAGCTGGAGAGATGGGAGCGGGAAGGGTTCCATCAGATCGCACAGAACAAGGTGGCCGTCCTGCTCCTAGCTGGGGGCCAGGGGACCCGCCTGGGGGTGACGTACCCCAAAGGGATGTACAGCGTCGGCCTCCCCAGCGCCAAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCACGGCGCCCTGACCTTCACGCTGGCAACATCTGCACCACTTCTTCACCGTGCCCTTCCTCAGGCTGGTGATTGGGTCTTTGGGAGCCCGCCTGATACAACGTAGCCCATAAGAAGGTCCCTACTTGGAATATTGAGGGAACTTGGGTGAATAG
  5   1   2       bld In66                            IMAGE:8963975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCCTAAACCCTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGGCCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGATCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGATATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAGAAAGTCCCTTACGTGGATATGAGGGAACTTGGTGAACCACGAGCCCAACGGGATCAAATGGAAAAGTTTGTGTTCGACGTCTTTCCAGTTTGCAAGAACCTTTGTTGCTTTGAGTCTGAGGAGGAGGGAGTTCCTCCCCACTGAACGCTGGACCAGTCGATAGGACCCCTCCAACGGCGAGCCGGCCTGCCTTGGCACCTTACCGCTGGCAGGAGCTTGGACCCACTTTTGGAATGA
  5   1   2       bld Te5       out                        CAAO5851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTACCAGATCCAGGCCGAGCGGATCCGCCGGCTGCAGCAATTGGCCAGTGAGCGTCACGGCGAGACCTGCACCGTCCCATGGTACATCATGACGAGCGAGTTCACGCTGGGTCCCACGCGGAAGTTCTTCGAAGACCACGCCTACTTTGGGCTGGAGCGCTCGGACGTGGTCATGTTTGAGCAGAGGATGCTGCCGGCGGTGGGGTTCGACGGTGCGGCCATCTTGGAGGATAAAGCCAAGCTCGCCATGGCTCCAGATGGGAACGGGGGTCTGTACCGGGCTCTGTCCGATAACCGCATCCTGGAGGACATGGAGGGGAGGGGCATCCAGTACGTTCATGTCTATTGTGTGGACAACATCCTGGTCAAGATGGCCGACCCGGTCTTTATCGGCTTCTGTGTGAGCAAAGGTGCCGACTGTGGCGCCAAGGTAGTGGAGAAGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGA
  5   1   2       e>1                               Xt7.1-TGas091i06.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTGCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008231099                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTGCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                           st6k19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGTGAGTCGGGGGGGGGGGNTTCNG
  5   1   2       bld Gas8      in                          st54o20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGTACCCGGCCGAGCCAGTGGGGGTGGTGTGCCGAGTGGATGGGGTCTACCAAGTGGTGGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGTGAGTCGGGGGGGGGGG
  5   1   2       bld Int1                                CAAP10148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGAAACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCTGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATTTGCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCT
  5   1   2       bld Ovi1      in                        CABI10655.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAATATAGCGAAATCAGCCCCGAAACCGCCGAGAAGCGCAATCCCAACGGCGCCCTGACCTTCACCGCTGGCAACATCTGCAACCACTTCTTCACCGTGCCCTTCCTCAGGGCTGTGATTGGGTCTTTGGAGCCGCGCCTGAATTACCACGTAGCCATAAAGAAAGTCCCTTACGTGGATAATGAGGGAAACTTGGTGAAACCAACGAGCCCAAACGGGATCAAAATGGAGAAGTTTGTGTTCGACGTCTTCCAGTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATTTGCCCCCCCCCCCCCCCCCAATGTGCCCAGT
  5   1   2       bld Met5      in                         CACX1060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTACCCCACTATGGGGTTCCAGAGCCTGCGGAACTACACGTCACTCTCTGCTCTCTGATTGGCAGGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTGCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACTGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGT
  5   1   2       bld Tail      in                         CBSW2889.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTGCAAAGAACTTTGTTGCCTTTGAGGTCCTGAGGGAGGAGGAGTTCTCCCCACTGAAAAACGCCGACACTGCCGATAAGGACACCCCCACAACGGCGAGGCGGGCGCTGCTATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGTCTGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCACACAGACCAGACGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTGCCCCCCCCCCCCCCAT
  3   1   2      seed Gas                             TGas091i06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGGCAACATTACCGCTGGGCGAGGAGAGCTGGCACCCACTTTTTGGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTGCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACTGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACGGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st54o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACTTTTTGGATGAGACCGGCAGCCCGAAACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCTGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATTTGCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCTGTGCCCAGGAAACATGGCGGCACTGCCCGTG
  3   1   2       bld Met5      in                         CACX1060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATGAGACCGGCAGCCCGATACGTGACAGCCACAGTATTTCAGGTGAGGGCGACCCTCCAGCTGTGTGTGAGATTTCCCCTTTGGTGTCTTATTTCGGAGAGGGGTTAGAATCGTACATGAAAGACAAGGACGTCTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTCTGACCCGCACAGACCAGGCGGTACTGCGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATCTCCGCTCTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATCTGCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACTGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCC
  3   1   2       bld Gas8      in                          st24c02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTGGTGTCTTATTTNGGAGAGGGGTTAGAATCGTACANGAAAGACAAGGACGTNTCATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTGTGACCCGCACAGACCAGGCGGTACTGCGGATCNCTGATAAACAACCTCATGCCAGNCCGTGCCTTACAATTTCCGCTCTTATGAAAGNCAGGGNTGTCCAACTGGGGGCCCNTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATTTGCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGNTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCCTGTACATGGGCTGCTGAATAACGATAGGANTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGNTGNTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATNCCACAAGCTGTAGCGNCCTGTGTCCCAGGAAACANGGCGGCACTGCCCGT
  3   1   2       bld Brn3      in                         CAAK5447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCGTTTCCCTTCGTTCTGGAGAGCAGCGATGCCGGGCCGGTACCAGTTTGACCCGCACAGACCAGGGGGTATTGGGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATTTCCGTTTTTATGAAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGGGGCCCCAAGTGACCTACTTGGATTTGCCCCCCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCTGTGCCCAGGAAACATGGCGGCATTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCC
  3   1   2       bld Ovi1      in                        CABI10655.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGCCGGTACCCGTTTGGCCCGCACAGGCCAGGGGGTACTGGGGATCCGGATAAACAACCTCCTGCCAGACCGTGCCTTACAATTTTCGCTTTTATGAAAGGCAGGGCTGTCCAAATGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATTTGCCCCCCCCCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAGCCTCTCGCCCTATATGAG
  3   1   2       bld Tbd0      in                     NISC_nl08h09.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGGCAGGGCTGTCCAACTGGGGGCCCCTAGGTGGGACGTGGCCCCAAGTGACCTACTTGGATTTGCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCTGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tail      in                         CBSW1130.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGGGGGCCCCTAGGGGGGAGGGGGCCCCAAGTGACCTATTTGGTTTTGCCCCCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTTTTTTTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTATTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCATCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTTTGGGGTTCCCGGAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                           st6k19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNGNTTTTNCCCCCCCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGT
  3   1   2       bld Tail      in                         CBSW2889.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGTTTTGCCCCCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTATTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCATCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAAAAAA
  5  -1   2       bld Tail      out                        CBSW5304.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGCCCCCCCCCCAATGTGCCCAGTTGGACAGCACCGCTGTGAGGAGCACAGTGTGCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCAACTGCAGGGCTGCACCGGGCCAGCGAATATAAAGAAGAATATGTGTGCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCATTAGCCTCGGGCTGCATCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCGGCCCGTGCCCAGGAAACATGGCGGCACTGCCCGTTGTACTTACTGTATTGCAATAAACAACTCTGGGGTTCCCAAAAAAAAAAA
  3   1   2       bld Te1       in                        CBWN14289.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCACCTTCTCTCTCTTGTAGCCAAAGATTAAAGCAACTCAGCACTTTTACTTTTTATTGGGCACCTGCAGGGCTGCCCCGGGCCAGCGAATATAAAGAAGAAAATGTGTGCCCCCCCTGTACATGGGCTGCTGAATAACGATAGGACTGGAGGGCCCTGCTCACCACAAGAGCTTGCCACAAGCCTCGGGCTGCTTCAGGGAAACAATATGGCAGCTCCTGGCCCAAAGGTGTCGACAAAGTGGCTGTTTTTAGTCATTTTTTTTAGTATATAAATCTTTCAAAACACTTTCAATGCCACAAGCTGTAGCAGCCTGTGCCCAGGAAACATGGCGGCACTCCCCGTTGTACTTACTGTATTGCAATAAACAAATATGGGGTTCCCAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)