Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1  56.0    0(repeat)                                    0 REP     76       1706     2146                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012155507 Xt7.1-CABI10224.3.5 - 25 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABI10224.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTCAGCGGCCAAAGAGTCTCCAGTTAACAGATGGGCGATTGACTCTCCACAGTGCTTCTCCAGTGCAAGGAGGGACACCCCTCAGCCCTTTGCCTATAACCCCCAGAACTCCGAGAACGCACAGCTTCCCTTCTCTCTCTTCTCATGCTGAAACAACGGCACAGATACTGGGGTCCCCTCCTCCGCCTCCCCCCAAATGCAGATCAAATGAGGGCAGCCAGCGCCTTTCAGTGGAGATTGCACCCCCCTTACCAAAACGTGAGGAAATGAAACCTCCGACCCCTCCTCCGAAGGTGAGAAAATCCAGTGTAATCCATGATCCTGGAGTCTGACAGCCCTTGTGGCCAGTGATGGAGAAACCCTCTGAGAAGACTTATTTGGTTATATGGTCCACCGGCCTGCTTTTTGCAAGTCATTCTGATGGGCAACCCATCCAAGGGAATATCCAGGCATAAGCTCTGGACTGGACGTGATTGTTTGCATTCCAAAGAACGTTCTGGGTCAAAGAACCAAGTCACTTCCAGTACCGGGTCTGTGGCACAAGAATGTAAGAAATACTGGCCTGTGGGGAGTGCATGTATGGAGCAGGTATTAATCCAACTACTACTACTCTGCCTCCAGTGGCTTGATTGCTTTTTCTGTCAATCCATGCAATATGGCTGCTCCAGGGTTCACTTCTTTACTGACTGTGGTTCGTGTTGTGTGCGCCCCTGAACAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTAACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCAGGAGCTTGAGTTAATGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAAGGAGACACATGCTGCATCAGTAACTTAAGCTTCTGTGTCCTTCCTAGATGGACGGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGGGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTATTCAGCAGCTCCCCAGTTTGGAATTTCGGGAGCTATCTGGTTGCTAAGGTCCATTTTAACCTAGCAACGAGGCTGTAGTTTCAAAGAGAAGCAGCAATATGAATAGAAGAGGGCCTATGTTGAAACATAAGTAACAAAAAGTAACAATAAAATTGTAGCCTCATGGAGCAATAGGTTTTTTTTTACTGCTGGGGTCGGTGACCCCCATTTCAAAGCTGGAATTCAAAAACTATAACAAAAAATTAAGACCAATTGAAAAGTTGCTAAGAATTGGCCATACTGTAGCATACTAAAAGTTAACCAGAAGGTGAACCCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008267575                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGGCCAAAGAGTCTCCAGTTAACAGATGGGCGATTGACTCTCCACAGTGCTTCTCCAGTGCAAGGAGGGACACCCCTCAGCCCTTTGCCTATAACCCCCAGAACTCCGAGAACGCACAGCTTCCCTTCTCTCTCTTCTCATGCTGAAACAACGGCACAGATACTGGGGTCCCCTCCTCCGCCTCCCCCCAAATGCAGATCAAATGAGGGCAGCCAGCGCCTTTCAGTGGAGATTGCACCCCCCTTACCAAAACGTGAGGAAATGAAACCTCCGACCCCTCCTCCGAAGGTGAGAAAATCCAGTGTAATCCATGATCCTGGAGTCTGACAGCCCTTGTGGCCAGTGATGGAGAAACCCTCTGAGAAGACTTATTTGGTTATATGGTCCACCGGCCTGCTTTTTGCAAGTCATTCTGATGGGCAACCCATCCAAGGGAATATCCAGGCATAAGCTCTGGACTGGACGTGATTGTTTGCATTCCAAAGAACGTTCTGGGTCAAAGAACCAAGTCACTTCCAGTACCGGGTCTGTGGCACAAGAATGTAAGAAATACTGGCCTGTGGGGAGTGCATGTATGGAGCAGGTATTAATCCAACTACTACTACTCTGCCTCCAGTGGCTTGATTGCTTTTTCTGTCAATCCATGCAATATGGCTGCTCCAGGGTTCACTTCTTTACTGACTGTGGTTCGTGTTGTGTGCGCCCCTGAACAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTGACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCAGGAGCTTGAGTTAATGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAAGGAGACACATGCTGCATCAGTAACTTAAGCTTCTGTGTCCTTCCTAGATGGACGGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGGGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTATTCAGCAGCTCCCCAGTTTGGAATTTCGGGAGCTATCTGGTTGCTAAGGTCCATTTTAACCTAGCAACGAGGCTGTAGTTTCAAAGAGAAGCAGCAATATGAATAGAAGAGGGCCTATGTTGAAACATAAGTAACAAAAAGTAACAATAAAATTGTAGCCTCATGGAGCAATAGGTTTTTTTTTACTGCTGGGGTCGGTGACCCCCATTTCAAAGCTGGAATTCAAAAACTATAACAAAAAATTAAGACCAATTGAAAAGTTGCTAAGAATTGGCCATACTGTAGCATACTAAAAGTTAACCAGAAGGTGAACCCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     7     7     7     7     7     7     7     7     5     7     7     7     7     7     7     7     7     7     6     6     6     6     5     6     6     6     5     6     6     6     5     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     3     6     3     6     3     5     3     5     2     4     2     4     2     4     2     4     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     6     4     6     4     6     4     6     4     6     4     7     4     7     4     8     4     7     4     7     4     7     4     7     4     7     5     8     5     8     5     8     5     8     5     8     5     9     5     9     9     9     9     9     9     9     9     9     8     8    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9     9     9     9     9     9     9     9     9     9    10    10    10    11    11    12    11    12    11    12    11    12    10    12    11    12     9    12     9    12     9    12     8    11     8    11     8    11     8    11     7    10     6    10     6    10     6    10     5     7     2     2
  5   1   2      ests                            Xt7.1-IMAGE:7023932.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTCAGCGGCCAAAGAGTCTCCAGTTAACAGATGGGCGATTGACTCTCCACAGTGCTTCTCCAGTGCAAGGAGGGACACCCCTCAGCCCTTTGCCTATAACCCCCAGAACTCCGAGAACGCACAGCTTCCCTTCTCTCTCTTCTCATGCTGAAACAACGGCACAGATACTGGGGTCCCCTCCTCCGCCTCCCCCCAAATGCAGATCAAATGAGGGCAGCCAGCGCCTTTCAGTGGAGATTGCACCCCCCTTACCAAAACGTGAGGAAATGAAACCTCCGACCCCTCCTCCGAAGGTGAGAAAATCCAGTGTAATCCATGATCCTGGAGTCTGACAGCCCTTGTGGCCAGTGATGGAGAAACCCTCTGAGAAGACTTATTTGGTTATATGGTCCACCGGCCTGCTTTTTGCAAGTCATTCTGATGGGCAACCCATCCAAGGGAATATCCAGGCATAAGCTCTGGACTGGACGTGATTGTTTGCATTCCAAAGAACGTTCTGGGTCAAAGAACCAAGTCACTTCCAGTACCGGGTCTGTGGCACAAGAATGTAAGAAATACTGGCCTGTGGGGAGTGCATGTATGGAGCAGGTATTAATCCAACTACTACTACTCTGCCTCCAGTGGCTTGATTGCTTTTTCTGTCAATCCATGCAATATGGCTGCTCCAGGGTTCACTTCTTTACTGACTGTGGTTCGTGTTGTGTGCGCCCCTGAACAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTAACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCAGGAGCTTGAGTTAATGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAAGGAGACACATGCTGCATCAGTAACTTAAGCTTCTGTGTCCTTCCTAGATGGACGGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGGGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTATTCAGCAGCTCCCCAGTTTGGAATTTCGGGAGCTATCTGGTTGCTAAGGTCCATTTTAACCTA
  5   1   2      ests                                Xt7.1-CABI10224.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAAAATTGTAGCCTCATGGAGCAATAGGTTTTTTTTTACTGCTGGGGTCGGTGACCCCCATTTCAAAGCTGGAATTCAAAAACTATAACAAAAAATTAAGACCAATTGAAAAGTTGCTAAGAATTGGCCATACTGTAGCATACTAAAAGTTAACCAGAAGGTGAACCCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAAAAAAAA
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                       ...PREDICTED - Dr ---- 1e-014     XP_700391.1 PREDICTED: similar to dedicator of cytokinesis 5, partial [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                                                       ...PROTEIN --- Hs ---- 1e-023     NP_079216.4 dedicator of cytokinesis 5 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-031     XP_417678.2 PREDICTED: similar to dedicator of cytokinesis 5 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABI10224.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------TGA------------------ATG---------------------------------------------------------------------------------------------------TAA---------------TGA------------------------------------------------------------------------ATGTAA------------------------ATG------------------------------------------------TGA------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------TGA---------------------------------TAA---TAA---------ATG---------TGA------------------------------------------------------------------TAG------ATGTAG------------------------------------------------------------------------------------------------TAG---------TAA------------ATG---------------------------------------------TAA---TGA------------------------------------------------------------TAA---------------------------------------------------------------ATGATG---ATG------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------ATG---------------------------------------------------------TAA---------------------------TAG------------TGA------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------TAG---------------------TAA------------------------------------------------------------------------------------------------------TAA------------------TGA---------------------------------------------------------------------------------------TAA------------------------------------------ATG---------TAA---------------------TAA------------------------------------------------------------ATG---------------------------------ATG------------ATGTAGTAA------------------ATG---------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------TAGTGA------------------------------------------ATG---------------------------------------------------------------TAA---------------TGA---------ATG---------ATG------------------------------------TAA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                     ]
  5   1   2      ests                            Xt7.1-IMAGE:7023932.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTCAGCGGCCAAAGAGTCTCCAGTTAACAGATGGGCGATTGACTCTCCACAGTGCTTCTCCAGTGCAAGGAGGGACACCCCTCAGCCCTTTGCCTATAACCCCCAGAACTCCGAGAACGCACAGCTTCCCTTCTCTCTCTTCTCATGCTGAAACAACGGCACAGATACTGGGGTCCCCTCCTCCGCCTCCCCCCAAATGCAGATCAAATGAGGGCAGCCAGCGCCTTTCAGTGGAGATTGCACCCCCCTTACCAAAACGTGAGGAAATGAAACCTCCGACCCCTCCTCCGAAGGTGAGAAAATCCAGTGTAATCCATGATCCTGGAGTCTGACAGCCCTTGTGGCCAGTGATGGAGAAACCCTCTGAGAAGACTTATTTGGTTATATGGTCCACCGGCCTGCTTTTTGCAAGTCATTCTGATGGGCAACCCATCCAAGGGAATATCCAGGCATAAGCTCTGGACTGGACGTGATTGTTTGCATTCCAAAGAACGTTCTGGGTCAAAGAACCAAGTCACTTCCAGTACCGGGTCTGTGGCACAAGAATGTAAGAAATACTGGCCTGTGGGGAGTGCATGTATGGAGCAGGTATTAATCCAACTACTACTACTCTGCCTCCAGTGGCTTGATTGCTTTTTCTGTCAATCCATGCAATATGGCTGCTCCAGGGTTCACTTCTTTACTGACTGTGGTTCGTGTTGTGTGCGCCCCTGAACAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTAACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCAGGAGCTTGAGTTAATGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAAGGAGACACATGCTGCATCAGTAACTTAAGCTTCTGTGTCCTTCCTAGATGGACGGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGGGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTATTCAGCAGCTCCCCAGTTTGGAATTTCGGGAGCTATCTGGTTGCTAAGGTCCATTTTAACCTA
                                                  Xt7.1-CHK-1008236595                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGGCCAAAGAGTCTCCAGTTAACAGATGGGCGATTGACTCTCCACAGTGCTTCTCCAGTGCAAGGAGGGACACCCCTCAGCCCTTTGCCTATAACCCCCAGAACTCCGAGAACGCACAGCTTCCCTTCTCTCTCTTCTCATGCTGAAACAACGGCACAGATACTGGGGTCCCCTCCTCCGCCTCCCCCCAAATGCAGATCAAATGAGGGCAGCCAGCGCCTTTCAGTGGAGATTGCACCCCCCTTACCAAAACGTGAGGAAATGAAACCTCCGACCCCTCCTCCGAAGGTGAGAAAATCCAGTGTAATCCATGATCCTGGAGTCTGACAGCCCTTGTGGCCAGTGATGGAGAAACCCTCTGAGAAGACTTATTTGGTTATATGGTCCACCGGCCTGCTTTTTGCAAGTCATTCTGATGGGCAACCCATCCAAGGGAATATCCAGGCATAAGCTCTGGACTGGACGTGATTGTTTGCATTCCAAAGAACGTTCTGGGTCAAAGAACCAAGTCACTTCCAGTACCGGGTCTGTGGCACAAGAATGTAAGAAATACTGGCCTGTGGGGAGTGCATGTATGGAGCAGGTATTAATCCAACTACTACTACTCTGCCTCCAGTGGCTTGATTGCTTTTTCTGTCAATCCATGCAATATGGCTGCTCCAGGGTTCACTTCTTTACTGACTGTGGTTCGTGTTGTGTGCGCCCCTGAACAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTGACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCAGGAGCTTGAGTTAATGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAAGGAGACACATGCTGCATCAGTAACTTAAGCTTCTGTGTCCTTCCTAGATGGACGGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGGGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTATTCAGCAGCTCCCCAGTTTGGAATTTCGGGAGCTATCTGGTTGCTAAGGTCCATTTT
  5   1   2      skin Te3                                  CAAM9689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATTGTCCTCTGTCTCCACTTCCTCCTCAGGAAGCAGCAGCTCCAGACCTGGATCCGAAGGGTCGATCCCAGAACCCGTTCCACACAGACGCGCCTCCCTCATTTCTCGGCATGAAGACATCAGCGATAGAGATGAGGTTGATAGTCGGGCGATGAAGTTTAAGCATTCACGAGAAGGTTCTGTTACCTCCCTGAGCCTGGTCAACAAGTGTCAGCGGCCAAAGAGTCTCCAGTTAACAGATGGGCGATTGACTCTCCACAGTGCTTCTCCAGTGCAAGGAGGGACACCCCTCAGCCCTTTGCCTATAACCCCCAGAACTCCGAGAACGCACAGCTTCCCTTCTCTCTCTTCTCATGCTGAAACAACGGCACAGATACTGGGGTCCCCTCCTCCGCCTCCCCCCAAATGCAGATCAAATGAGGGCAGCCAGCGCCTTTCAGTGGAGATTGCACCCCCCTTACCAAAACGTGAGGAAATGAAACCTCCGACCCCTCCTCCGAAGGTGAGAAAATCCAGTGTAATCCATGATCCTGGAGTCTGACAGCCCTTGTGGCCAGTGATGGAGAAACCCTCTGAGAAGACTTATTTGGTTATATGGTCCACCGGCCTGCTTTTTGCAAGTCATTCTGATGGGCAACCCATCCAAGGGAATATCCAGGCATAAGCTCTGGACTGGACGTGATTGTTTGCATTCCAAAGAACGTTCTGGGTCAAAGAACCAAGTCACTTCCAGTACCGGGTCTGTGGCACAAGAATGTAAGAAATACTGGCCTGTGGGGAGTGCATGTATGGAGCAGGTATTAATCCAACTACTACTACTCTGCCTCCAGTGGCTTGATTGCTTTTTCTGTCAATCCATGCCATAT
  5   1   2       bld Gas7      in                         XZG54567.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTCAGCGGCCAAAGAGTCTCCAGTTAACAGATGGGCGATTGACTCTCCACAGTGCTTCTCCAGTGCAAGGAGGGACACCCCTCAGCCCTTTGCCTATAACCCCCAGAACTCCGAGAACGCACAGCTTCCCTTCTCTCTCTTCTCATGCTGAAACAACGGCACAGATACTGGGGTCCCCTCCTCCGCCTCCCCCCAAATGCAGATCAAATGAGGGCAGCCAGCGCCTTTCAGTGGAGATTGCACCCCCCTTACCAAAACGTGAGGAAATGAAACCTCCGACCCCTCCTCCGAAGGTGAGAAAATCCAGTGTAATCCATGATCCTGGAGTCTGACAGCCCTTGTGGCCAGTGATGGAGAAACCCTCTGAGAAGACTTATTTGGTTATATGGTCCACCGGCCTGCTTTTTGCAAGTCATTCTGATGGGCAACCCATCCAAGGGAATATCCAGGCATAAGCTCTGGACTGGACGTGATTGTTTGCATTCCAAAGAACGTTCTGGGTCAAAGAACCAAGTCACTTCCAGTACCGGGTCTGTGGCACAAGAATGTAAGAAATACTGGCCTGTGGGGAGTGCATGTATGGAGCAGGTATTAATCCAACTACTACTACTCTGCCTCCAGTGGCTTGATTGCTTTTTCTGTCAATCCATGCAATATGGCTGCTCCAGGGTTCACTTCTTTACTGACTGTGGTTCGTGTTGTGTGCGCCCCTGAACAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGG
  3   1   2       bld Gas7      in                         XZG54567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTGGAGATTGCACCCCCCTTACCAAAACGTGAGGAAATGAAACCTCCGACCCCTCCTCCGAAGGTGAGAAAATCCAGTGTAATCCATGATCCTGGAGTCTGACAGCCCTTGTGGCCAGTGATGGAGAAACCCTCTGAGAAGACTTATTTGGTTATATGGTCCACCGGCCTGCTTTTTGCAAGTCATTCTGATGGGCAACCCATCCAAGGGAATATCCAGGCATAAGCTCTGGACTGGACGTGATTGTTTGCATTCCAAAGAACGTTCTGGGTCAAAGAACCAAGTCACTTCCAGTACCGGGTCTGTGGCACAAGAATGTAAGAAATACTGGCCTGTGGGGAGTGCATGTATGGAGCAGGTATTAATCCAACTACTACTACTCTGCCTCCAGTGGCTTGATTGCTTTTTCTGTCAATCCATGCAATATGGCTGCTCCAGGGTTCACTTCTTTACTGACTGTGGTTCGTGTTGTGTGCGCCCCTGAACAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAAT
  5   1   2       bld TpA       in                   TTpA043f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATATGGCTGCTCCAGGGGTTCACTTCTTTACTGACTGTGGTTCGTGTTGTGTGCGCCCCTGAACAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTGACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCAGGAGCTTGAGTTAATGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGAATTGAGCAGAGAGGGCATCAGGAGACACATGCTGCATCAGTAACTTAAGCTT
  5   1   2      seed Ovi1      in                        CABI10224.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTCATCTGGGTATCCATGTCGGTCTCATATTCAGCATCTCGATTGATACCAGTTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTAACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCAGGAGCTTGAGTTAATGATGCAGATGGCTTCTACGGATGATTTTTCGCTCANGTCTATTGCTCATTGTGGC
  5   1   2       bld AbdN                               IMAGE:7023932                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCTGACCCAGAAGCGCAGAAAGATGGAAGCCATTCCTTTGCTGCTGATCACATTCCTTTTCGAATGAAAGTATTTGGTGCCTTGGTTTCTGCTTTGTGCAAAGATAGTCCCCCTCTCACCTGGTTATGGAGACGGGGCAGAGGGAGGACCTGTTTTATTTTGGTTTTGATTGAGATTTGTGCGTTCTAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTAACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCGGGAGCTTGAGTTAATGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAAGGAGACACATGCTGCATCAGTAACTTAAGCTTCTGTGTCCTTCCTAGATGGACAGGACAGCAGGGGGCGCTCCTGTTACACGT
  5   1   2       bld Egg       in                   TEgg052a23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGATATCTGTAAATAGAGTGGTTCCCAATACTGAAGGTACATGAAGAATTGTATATTACTTTGTATTATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTAACAGGAGTGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCGGGAGCTTGAGTTGGTGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAAGGAGACACATGCTGCATCGGTGACTTAAGCTTCTGTGTCCTTCCTAG
  5   1   2       bld Ovi1      in                         CABI9414.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTTATTCACTAATTGTAACATTGCTCCATGGTACTGCCCTGAGCAGATATCCGCAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTGGCGGGAGTGTCTCCTGCTGTCCGGTTGGCTGGCCAGAGCTTCGGGAGCTTGAGTTGGTGATGCAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAGGGAGACACATGCTGCATCAGTAACTTAAGCTTCTGTGTCCTTCCTAGATGGACGGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGGGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTAttcagcagctccccagtttggaatttcgggagctatctggttgctaaggtccattttaacctagca
  5   1   2       bld Brn2      in                        CAAJ24086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGCCCCATTTGATACACCCCTATCTATCTGTCTGTCTATCTATCTATCTACATAGATATATATGTAGATAAATATATATACTCTCACAACACACTCCATTTTAGATGCTGCTATTTACAAGGCCAGCAATGTAGATAATATAAGAAGGTCCAGATTATATCCATAGATCCTTTCATAATATAACAGATACATGAAGCTAAATTTAAACTGGCCCAGTGGGGTGGCACTTTCTTATTTCTAACCATGAAATGGGCCAATTCTTGATTTGAGTTTTCATAATGCTAGCAGTTTTACACTATTAATATCCTAAATTTGTGACAGGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAGCTTCAGGAGCTTGAGTTGATGATACAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAGGGAGACACATGCTGCATCAGTAACTTGAGCTTCTGTGTCCTTCCTAGATGGGCAGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGNGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTATTCAGCAGCTCCCCAGTTTTGGAATTTCGGGGAGCTATC
  5   1   2       bld Tad5      in                         XZT17429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAATGTCTCCTGCTGTCCGGTTGGCTGGCCAGAACTTCAGGAGCTTGAGTTAATGATACAGATGGCTTCTACGGATGATTTTTCGCTCAGGTCTATTGCTCATTGTGGCAGGAGAGTCGGATTTGAGCAGAGAGGCATCAAGGAGACACATGCTGCATCAGTAACTTAAGCTTCTGTGTCCTTCCTAGATGGACGGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGGGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTAttcagcagctccccagtttggaatttcgggagctatctggttgctaaggtccattttaacctagcaacgaggctgtagtttcaaagagaagcagcaatatgaatagaagagggcctatgttgaaacataagtaacaaaaagtaacaataaaattgtagcctcatggagcaataggtttttttttactgctggggtcggtgacccccatttcaaagctggaattcaaaaactataacaaaaaattaagaccaattgaaaagttgctaagaattggccatactgtagcatactaaaagttaaccagaaggtgaaccCCCTTTTTAAGCATGGTATAGTTTCCCC
  5   1   2      ests                                Xt7.1-CABI10224.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAAAATTGTAGCCTCATGGAGCAATAGGTTTTTTTTTACTGCTGGGGTCGGTGACCCCCATTTCAAAGCTGGAATTCAAAAACTATAACAAAAAATTAAGACCAATTGAAAAGTTGCTAAGAATTGGCCATACTGTAGCATACTAAAAGTTAACCAGAAGGTGAACCCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008232783                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTGTAGCCTCATGGAGCAATAGGTTTTTTTTTACTGCTGGGGTCGGTGACCCCCATTTCAAAGCTGGAATTCAAAAACTATAACAAAAAATTAAGACCAATTGAAAAGTTGCTAAGAATTGGCCATACTGTAGCATACTAAAAGTTAACCAGAAGGTGAACCCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1      in                         CABI9414.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTTCTGTGTCCTTCCTAGATGGACGGGACAGCAGGGGGCGCTCCTGTTACACGTTATATAAGCAGTGTGAAGCTGCTAATATGAAAGGGGGAGGGGTAATTTTCAATAGTGCTCAGAAAGAGCACCCTGCAATTTTACATTAAAGGATTGTTCACCTTAAATTTTTAATATAGAGAGTGCTATTTTGAAACAATTTGCAATTGGTCTTCATTTTTTATTTGCCGTTTTTGATTTATTTAGCTTTTTAttcagcagctccccagtttggaatttcgggagctatctggttgctaaggtccattttaacctagcaacgaggctgtagtttcaaagagaagcagcaatatgaatagaagagggcctatgttgaaacataagtaacaaaaagtaacaataaaattgtagcctcatggagcaataggtttttttttactgctggggtcggtgacccccatttcaaagctggaattcaaaaactataacaaaaaattaagaccaattgaaaagttgctaagaattggccatactgtagcatactaaaagttaaccagaaggtgaaccCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAAAAAAAA
  5   1   2       bld Te1       in                        CBWN12047.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTTATTTAGCTTTTTATTCAGCAGCTTCCCAGTTTGGAATTTCGGGAGCTATCTGGTTGCTAAGGTCCATTTTAACCTAGCAACGAGGCTGTAGTTTCAAAGAGAAGCAGCAATATGAATAGAAGAGGGCCTATGTTGAAACATAAGTAACAAAAAGTAACAATAAAATTGTAGCCTCATGGAGCAATAGGTTTTTTTTTACTGCTGGGGTCGGTGACCCCCATTTCAAAGCTGGAATTCAAAAACTATAACAAAAAATTAAGACCAATTGAAAAGTTGCTAAGAATTGGCCATACTGTAGCATACTAAAAGTTAACCAGAAGGTGAACCCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGGGGGGGTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGCGCTTCCCCCTCAGCTGCTTTGTGG
  5   1   2       bld HeRe      in                     EC2CAA19BE11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ggaatttcgggagctatctggttgctagggtccattttaacctagcaacgaggctgtagtttcaaagagaagcagcaatatgaatagaagagggcctatgttgaaacataagtaacaaaaagtaacaataacaataaaattgtagcctcacggagcaataggtttttttttactggtggggtcggtgacccccatttcaaagctggaattcaaaaactataacaaaaaattaagaccaattgaaaagttgctaagaattggccatactgtagcatactaaaagttaaccagaaggtgaaccCCCTTTTTAAGCATAGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACGGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGGTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCT
  3   1   2       bld TpA       in                    TTpA043f13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAAAATTaagaccaattgaaaagttgctaagaattggccatactgtagcatactaaaagttaaccagaaggtgaaccCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTTGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGGGGGTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Ovi1      in                        CABI10224.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTAAGACCAATTGAAAAAGTTGCTAAGAATTGGCCATACTGTAGCATACTAAAAGTTAACCAGAAGGTGAACCCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGGAAAAA
  3   1   2       bld Te1       in                        CBWN12047.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAGGTGAACCCCCTTTTTAAGCATGGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACAGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGACGGGTGTGTCTTATTTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA19BE11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATAGTATAGTTCCCCTTTAATATGTCGCACAAAAGTCACGGGCAGCCGATAGCAACAAATGTATGCGGTGCCATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGGTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGCGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGTGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGCCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTG
  3   1   2       bld Tad5      in                         XZT17429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTAATTTTGTGTTTGTGTTTGGTTTTAAAGGGACAGCGGCACATTATTTAAAATCATCCGAATTTCATCTGCCGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTG
  3   1   2       bld Brn2      in                        CAAJ24086.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATTTCATCTGCCGGGGGGGGGGGGGGGGGGGTTTGCTATGGGTTACAAGACCTTGGAGCCTTTCATTATATCCATGGTTTCTTCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGACGGGTGTGTCTTATTTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTG
  3   1   2       bld HeRe      in                     EC2CAA25AH03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGTGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGCGCATGGTAAGTCAGGCCTAAAACTGTAAAGTTT
  5   1   2       bld HeRe      in                     EC2CAA25AH03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAGCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGTGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGCGCATGGTAAATCAGGCCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTAGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas                            TGas010e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATGTAGTAATGTGTCAGTGTGTACAAAATGTATTTATTAATCTATAAATGCCACATTTGATATCATAGTAAGTTCTGTATTGTGGTACCTGTGCCTGTAAATAGCCATGTCACAGCATTAACCCAAAGGCATTCAGCCTCCCCCAGGCCAAGTCTGCCCTGCCCGCACGTGGCACACATTACAGCTTGGAGGAGTGGGGATGCAGCCACAAACATAGCAGGGCGCTTCCCCCTCAGCTGCTTTGTGCCTTTATCTTTGTTTTATTTTGGAATAGGTGCCTCTTGTTCATTTTCTGAGGATTTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTTTTATTTTTTTTAGCATTTTCCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATTCTTTTGTTATGGTTACTTCTNGCTGCCCCCCCTGGTGGGCTTTGGGGCAAAAAAAGCTAATACACAGTGAAAAAAAAA
  3   1   2       bld Gas7      ?                          XZG42109.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTATGCAATTTATTTATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGAAAAAAAAAAAAAAAGG
  5   1   2       bld Tad5                                 XZT16359.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTGCTAGTGAGCAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGACGGGTGTGTCTTATTTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCCTGGTGGGCTCTGGGGCAAAATAAAGCTAATACACAGTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaCGC
  3   1   2       bld Egg       in                    TEgg052a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAAAAGAGAAATCCTGTTATTCGCCGAGTCCTTTATCCTATGGAAGGATGGGTGTGTCTTATTTTTTTAGCATTCTCCGTGCATGGTAAATCAGGTCTAAAACTGTAAAGTTTTGTACAGAAATGACAGATATATATGATCATTTGTATGGTACTCTGCTGCCCCNCTGGTGGGCTTCTGGGGCAAAATAAAGCNNTAATACACAGTGAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)