Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 09 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI5394.5                           23 END     1           5        4                Unknown (protein for MGC:107799) [Xenopus tropicalis]
     2   2.0    0Xt7.1-THdA052d14.5                          9 END     1           5       12                RNA binding motif protein 19 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 99%

 1012155575 Xt7.1-CAAN7760.5.5 - 17 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAN7760.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGAATGAGTAGCTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAACAGCCCTGAAAGAACCCGAGTAAAGGAAAGCTCTGCCCCGCCTCCTGCGCGTTCCAAGCTGGATGAGCTCCTTGGTAGAGGGACTGCAGCCAAACTTCTGGAAAGACCACCCACTGGGGAGCGAAAAGAATTTAAACTTGATCCTAAATACCAGAAACAGCAAGAGAACCAGAACACACCAGACGATGCGGATATTAACTTTGGTTCGTACCAACCTACTGTCAACAGTCCTGAGGGGCGACCGTCTCGCAGGCCATCTGTCAGATTCTCTGCAGATGGCAGCGACAATTTCAAATCGGAAGGAAGGTCTCGCTCCAGCACCCCAGCAACTAGGAGTCCAGCCAGAGGAGAGAGGGGTGGGGCGGACTGGCTGGGCTTGAAAGACGATGACATTGATGTTCCTGATTTTACACCTTCATTACCTGTCAGGGACCCACCCCGGTCTGCAGGTGTTACACCAAGTTCAGCCGGACGTCCCACCTCTGGAAATAAAATTGCGGACAAGCCTATTAACCAAACGAGAAGTGGGCTCCAGGAAGCAGCCTCGGTAGCACAGGAGGATGATGGGTGGCTGACCTCTGCCCTTTCACAAAAAAAGGCACAAAAACAGGAAATGGAGGAAAAAAGCAAAAGCCAAGCCAGACAGGAAGATGTTACAGGGAGCAGCCCTGCAGTCTTCTCACAAACCAGCTCACAGGAGTCCGCTGTTAATAAAGGCACAAGAGAGACTGGTATGGTAGTTGCTGAGGTATCTGGGTCTCCCAAAAAAGTCTCTACGTTTGTGGCTCCCAAACAAGAAGAAACCATTCAGACAGCAGTTACCGGCCCGTCTCAAGAGCACGGCACAGCCAGAACTTTGCAGACGGTGGTCTCGCGGCCATTAGAGAGAAAAGCACGAGATGGGGATAGAGATCTTCACGGGGATCCCCTGCAGGCACAGAATCGAGTGATGGATCTAGAGGCACAGGTCAGGAAGCTCCAGCTAGAGAGGGACCAACAGAACCTGCTGCTGGAGACCCTGCGAGAAAGACATCAGGAGGATATGGAGCTGATAGAGAATGCACATCGGAGCCGCCTGAAACTAGTGGAAGACTCTGCCCGTCAAAGAGAGGAGCGACTGCGCCTTGAGAACCAGGAGTTGTCCGCCCAGTACCTATCTCGGTGCCAGAGCACGGAAACCGAGAAAGCCGAACTGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTTTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAGAGACTCAAGCGGCTAAAGGACCAAGAGATCGATGCAGTGACGAGTGCTTCCTCCCACACAAGATCCCTGAACACCGTTATTGAACAAATGGAGTCGTTCTCCCACAAGCTGAGTGACCTGTCCCACAGAGTAGAGAGCACTCAGCAGACGACTTCCCATGAGCTGGAGACAGGAGCACGCCAGAGAGAAGGGCAGCTCAGAGCACTGCAGGAGCAACTGAGCCGCCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAGGAGCGAGCAGAGAAAGAAGCAAACAGGGTCATTGTGGCAGAAACTCAGAGGGAGGGCGCCATCATAAATCTGGCCAAGGAGCAGGCAGAGTTAAAGATCAAGGCTAGTGAGCTGCTCAACAAAGAGGAGCAGCTGTTTTTGGCCAGAGAGGCCATGGAAAAGGAAAGACAAGACCTCCGCCTGGAAAAGGAAAGGGTTAATGCATCTGCTCTGCGGGTGCGACAGCGTGCGGAGGAAATAGAGAGCATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAATGTCATTTTCTATATGTAACTTCTAATTTATACCTTTTGCACCATTTTTATACCAGAGAAATAAACATGC
                                                  Xt7.1-CHK-1008267312                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTAGCTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAACAGCCCTGAAAGAACCCGAGTAAAGGAAAGCTCTGCCCCGCCTCCTGCGCGTTCCAAGCTGGATGAGCTCCTTGGTAGAGGGACTGCAGCCAAACTTCTGGAAAGACCACCCACTGGGGAGCGAAAAGAATTTAAACTTGATCCTAAATACCAGAAACAGCAAGAGAACCAGAACACACCAGACGATGCGGATATTAACTTTGGTTCGTACCAACCTACTGTCAACAGTCCTGAGGGGCGACCGTCTCGCAGGCCATCTGTCAGATTCTCTGCAGATGGCAGCGACAATTTCAAATCGGAAGGAAGGTCTCGCTCCAGCACCCCAGCAACTAGGAGTCCAGCCAGAGGAGAGAGGGGTGGGGCGGACTGGCTGGGCTTGAAAGACGATGACATTGATGTTCCTGATTTTACACCTTCATTACCTGTCAGGGACCCACCCCGGTCTGCAGGTGTTACACCAAGTTCAGCCGGACGTCCCACCTCTGGAAATAAAATTGCGGACAAGCCTATTAACCAAACGAGAAGTGGGCTCCAGGAAGCAGCCTCGGTAGCACAGGAGGATGATGGGTGGCTGACCTCTGCCCTTTCACAAAAAAAGGCACAAAAACAGGAAATGGAGGAAAAAAGCAAAAGCCAAGCCAGACAGGAAGATGTTACAGGGAGCAGCCCTGCAGTCTTCTCACAAACCAGCTCACAGGAGTCCGCTGTTAATAAAGGCACAAGAGAGACTGGTATGGTAGTTGCTGAGGTATCTGGGTCTCCCAAAAAAGTCTCTACGTTTGTGGCTCCCAAACAAGAAGAAACCATTCAGACAGCAGTTACCGGCCCGTCTCAAGAGCACGGCACAGCCAGAACTTTGCAGACGGTGGTCTCGCGGCCATTAGAGAGAAAAGCACGAGATGGGGATAGAGATCTTCACGGGGATCCCCTGCAGGCACAGAATCGAGTGATGGATCTAGAGGCACAGGTCAGGAAGCTCCAGCTAGAGAGGGACCAACAGAACCTGCTGCTGGAGACCCTGCGAGAAAGACATCAGGAGGATATGGAGCTGATAGAGAATGCACATCGGAGCCGCCTGAAACTAGTGGAAGACTCTGCCCGTCAAAGAGAGGAGCGACTGCGCCTTGAGAACCAGGAGTTGTCCGCCCAGTACCTATCTCGGTGCCAGAGCACGGAAACCGAGAAAGCCGAACTGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTTTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAGAGACTCAAGCGGCTAAAGGACCAAGAGATCGATGCAGTGACGAGTGCTTCCTCCCACACAAGATCCCTGAACACCGTTATTGAACAAATGGAGTCGTTCTCCCACAAGCTGAGTGACCTGTCCCACAGAGTAGAGAGCACTCAGCAGACGACTTCCCATGAGCTGGAGACAGGAGCACGCCAGAGAGAAGGGCAGCTCAGAGCACTGCAGGAGCAACTGAGCCGCCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAGGAGCGAGCAGAGAAAGAAGCAAACAGGGTCATTGTGGCAGAAACTCAGAGGGAGGGCGCCATCATAAATCTGGCCAAGGAGCAGGCAGAGTTAAAGATCAAGGCTAGTGAGCTGCTCAACAAAGAGGAGCAGCTGTTTTTGGCCAGAGAGGCCATGGAAAAGGAAAGACAAGACCTCCGCCTGGAAAAGGAAAGGGTTAATGCATCTGCTCTGCGGGTGCGACAGCGTGCGGAGGAAATAGAGAGCATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAATGTCGTTTTCTATATGTAACTTCTAATTTATACCTTTTGCACCATTTTTATACCAGAGAAATAAACATGCATTGAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     4     4     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     5     6     4     5     3     5     2     3     2     3     2     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     1     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     4     6     6     6     6     6     5     5     5     5     5     5
  5   1   2      ests                                 Xt7.1-CAAN7760.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGAATGAGTAGCTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAACAGCCCTGAAAGAACCCGAGTAAAGGAAAGCTCTGCCCCGCCTCCTGCGCGTTCCAAGCTGGATGAGCTCCTTGGTAGAGGGACTGCAGCCAAACTTCTGGAAAGACCACCCACTGGGGAGCGAAAAGAATTTAAACTTGATCCTAAATACCAGAAACAGCAAGAGAACCAGAACACACCAGACGATGCGGATATTAACTTTGGTTCGTACCAACCTACTGTCAACAGTCCTGAGGGGCGACCGTCTCGCAGGCCATCTGTCAGATTCTCTGCAGATGGCAGCGACAATTTCAAATCGGAAGGAAGGTCTCGCTCCAGCACCCCAGCAACTAGGAGTCCAGCCAGAGGAGAGAGGGGTGGGGCGGACTGGCTGGGCTTGAAAGACGATGACATTGATGTTCCTGATTTTACACCTTCATTACCTGTCAGGGACCCACCCCGGTCTGCAGGTGTTACACCAAGTTCAGCCGGACGTCCCACCTCTGGAAATAAAATTGCGGACAAGCCTATTAACCAAACGAGAAGTGGGCTCCAGGAAGCAGCCTCGGTAGCACAGGAGGATGATGGGTGGCTGACCTCTGCCCTTTCACAAAAAAAGGCACAAAAACAGGAAATGGAGGAAAAAAGCAAAAGCCAAGCCAGACAGGAAGATGTTACAGGGAGCAGCCCTGCAGTCTTCTCACAAACCAGCTCACAGGAGTCCGCTGTTAATAAAGGCACAAGAGAGACTGGTATGGTAGTTGCTGAGGTATCTGGGTCTCCCAAAAAAGTCTCTACGTTTGTGGCTCCCAAACAAGAAGAAACCATTCAGACAGCAGTTACCGGCCCGTCTCAAGAGCACGGCACAGCCAGAACTTTGCAGACGGTGGTCTCGCGGCCATTAGAGAGAAAAGCACGAGATGGGGATAGAGATCTTCACGGGGATCCCCTGCAGGCACAGAATCGAGTGATGGATCTAGAGGCACAGGTCAGGAAGCTCCAGCTAGAGAGGGACCAACAGAACCTGCTGCTGGAGACCCTGCGAGAAAGACATCAGGAGGATATGGAGCTGATAGAGAATGCACATCGGAGCCGCCTGAAACTAGTGGAAGACTCTGCCCGTCAAAGAGAGGAGCGACTGCGCCTTGAGAACCAGGAGTTGTCCGCCCAGTACCTATCTCGGTGCCAGAGCACGGAAACCGAGAAAGCCGAACTGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTTTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAGAGACTCAAGCGGCTAAAGGACCAAGAGATCGATGCAGTGACGAGTGCTTCCTCCCACACAAGATCCCTGAACACCGTTATTGAACAAATGGAGTCGTTCTCCCACAAGCTGAGTGACCTGTCCCACAGAGTAGAGAGCACTCAGCAGACGACTTCCCATGAGCTGGAGACAGGAGCACGCCAGAGAGAAGGGCAGCTCAGAGCACTGCAGGAGCAACTGAGCCGCCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAG
  5   1   2      ests                                 Xt7.1-CABK7614.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAGAGAAAGAAGCAAACAGGGTCATTGTGGCAGAAACTCAGAGGGAGGGCGCCATCATAAATCTGGCCAAGGAGCAGGCAGAGTTAAAGATCAAGGCTAGTGAGCTGCTCAACAAAGAGGAGCAGCTGTTTTTGGCCAGAGAGGCCATGGAAAAGGAAAGACAAGACCTCCGCCTGGAAAAGGAAAGGGTTAATGCATCTGCTCTGCGGGTGCGACAGCGTGCGGAGGAAATAGAGAGCATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAATGTCGTTTTCTATATGTAACTTCTAATTTATACCTTTTGCACCATTTTTATACCAGAGAAATAAACATGCATTGA
                                               BLH ATG     141     102                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     135     155                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     141     963                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       0       2                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     141     304                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Br ---- 5e-009     CAC13104.1 nuclear lamin [Branchiostoma lanceolatum] ---------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 2e-011     CAA11444.1 intermediate filament protein C1 [Branchiostoma floridae] -----------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 4e-013     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bb ---- 1e-014     BAC16746.1 myosin heavy chain [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 7e-020     NP_013021.1 involved in translocation of macromolecules between the nucleoplasm and the NPC;Mlp1p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-019     AAH67305.1 Myosin heavy chain [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 7e-021     AAA49915.1 nonmuscle myosin heavy chain b [Xenopus laevis]  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 2e-022     NP_504677.1 HoloCentric chromosome binding Protein HCP-1, myosin heavy chain (hcp-1)[Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Dr ---- 6e-023     XP_686066.1 PREDICTED: similar to Viral A-type inclusion protein repeat, putative [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ==== 3e-038     NP_648507.1 CG5964-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 3e-068     XP_781851.2 PREDICTED: similar to FBF1 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 0          NP_766159.2 RIKEN cDNA 1110033G01 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Hs ---- 0          XP_951284.2 PREDICTED: similar to Fas (TNFRSF6) binding factor 1 isoform 8 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Gg ==== 0          XP_001232690.1 PREDICTED: hypothetical protein [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAN7760.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAG---------------------------------------------TGA---------------------------------------ATG---------------------TAA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------TGATGA---------------------------------------------------------------------------------------------------ATGTAA------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  0   1   1           Te4  FLt3                        CAAN8905.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAGGGAAGCCGAATGAGTAGCTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAACAGCCCTGAAAGAACCCGAGTAAAGGAAAGCTCTGCCCCGCCTCCTGCGCGTTCCAAGCTGGATGAGCTCCTTGGTAGAGGGACTGCAGCCAAACTTCTGGAAAGACCACCCACTGGGGAGCGAAAAGAATTTAAACTTGATCCTAAATACCAGAAACAGCAAGAGAACCAGAACACACCAGACGATGCGGATATTAACTTTGGTTCGTACCAACCTACTGTCAACAGTCCTGAGGGGCGACCGTCTCGCAGGCCATCTGTCAGATTCTCTGCAGATGGCAGCGACAATTTCAAATCGGAAGGAAGGTCTCGCTCCAGCACCCCAGCAACTAGGAGTCCAGCCAGAGGAGAGAGGGGTGGGGCGGACTGGCTGGGCTTGAAAGACGATGACATTGATGTTCCTGATTTTACACCTTCATTACCTGTCAGGGACCCACCCCGGTCTGCAGGTGTTACACCAAGTTCAGCCGGACGTCCCACCTCTGGAAATAAAATTGCGGACAAGCCTATTAACCAAACGAGAAGTGGGCTCCAGGAAGCAGCCTCGGTAGCACAGGAGGATGATGGGTGGCTGACCTCTGCCCTTTCACAAAAAAAGGCACAAAAACAGGAAATGGAGGAAAAAAGCAAAAGCCAAGCCAGACAGGAAGATGTTACAGGGAGCAGCCCTGCAGTCTTCTCACAAACCAGCTCACAGCAGTCCGCTGTTAATAAAGGCACAAGAGAGACTGGTATGGTAGTTGCTGAGGTATCTGGGTCTCCCAAAAAAGTCTCTACGTTTGTGGCTCCCAAACAAGAAGAAACCATTCAGACAGCAGTTACCGGCCCGTCTCAAGAGCACGGCACAGCCAGAACTTTGCAGACGGTGGTCTCGCGGCCATTAGAGAGAAAAGCACGAGATGGGGATAGAGATCTTCACGGGGATCCCCTGCAGGCACAGAATCGAGTGATGGATCTAGAGGCACAGGTCAGGAAGCTCCAGCTAGAGAGGGACCAACAGAACCTGCTGCTGGAGACCCTGCGAGAAAGACATCAGGAGGATATGGAGCTGATAGAGAATGCACATCGGAGCCGCCTGAAACTAGTGGAAGACTCTGCCCGTCAAAGAGAGGAGCGACTGCGCCTTGAGAACCAGGAGTTGTCCGCCCAGTACCTATCTCGGTGCCAGAGCACGGAAACCGAGAAAGCCGAACTGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTCTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAGAGACTCAAGCGGCTAAAGGACCAAGAGATCGATGCAGTGACGAGTGCTTCCTCCCACACAAGATCCCTGAACACCGTTATTGAACAAATGGAGTCGTTCTCCCACAAGCTGAGTGACCTGTCCCACAGAGTAGAGAGCACTCAGCAGACGACTTCCCATGAGCTGGAGACAGGAGCACGCCAGAGAGAAGGGCAGCTCAGAGCACTGCAGGAGCAACTGAGCCGTCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAGGAGCAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CAAN7760.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGAATGAGTAGCTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAACAGCCCTGAAAGAACCCGAGTAAAGGAAAGCTCTGCCCCGCCTCCTGCGCGTTCCAAGCTGGATGAGCTCCTTGGTAGAGGGACTGCAGCCAAACTTCTGGAAAGACCACCCACTGGGGAGCGAAAAGAATTTAAACTTGATCCTAAATACCAGAAACAGCAAGAGAACCAGAACACACCAGACGATGCGGATATTAACTTTGGTTCGTACCAACCTACTGTCAACAGTCCTGAGGGGCGACCGTCTCGCAGGCCATCTGTCAGATTCTCTGCAGATGGCAGCGACAATTTCAAATCGGAAGGAAGGTCTCGCTCCAGCACCCCAGCAACTAGGAGTCCAGCCAGAGGAGAGAGGGGTGGGGCGGACTGGCTGGGCTTGAAAGACGATGACATTGATGTTCCTGATTTTACACCTTCATTACCTGTCAGGGACCCACCCCGGTCTGCAGGTGTTACACCAAGTTCAGCCGGACGTCCCACCTCTGGAAATAAAATTGCGGACAAGCCTATTAACCAAACGAGAAGTGGGCTCCAGGAAGCAGCCTCGGTAGCACAGGAGGATGATGGGTGGCTGACCTCTGCCCTTTCACAAAAAAAGGCACAAAAACAGGAAATGGAGGAAAAAAGCAAAAGCCAAGCCAGACAGGAAGATGTTACAGGGAGCAGCCCTGCAGTCTTCTCACAAACCAGCTCACAGGAGTCCGCTGTTAATAAAGGCACAAGAGAGACTGGTATGGTAGTTGCTGAGGTATCTGGGTCTCCCAAAAAAGTCTCTACGTTTGTGGCTCCCAAACAAGAAGAAACCATTCAGACAGCAGTTACCGGCCCGTCTCAAGAGCACGGCACAGCCAGAACTTTGCAGACGGTGGTCTCGCGGCCATTAGAGAGAAAAGCACGAGATGGGGATAGAGATCTTCACGGGGATCCCCTGCAGGCACAGAATCGAGTGATGGATCTAGAGGCACAGGTCAGGAAGCTCCAGCTAGAGAGGGACCAACAGAACCTGCTGCTGGAGACCCTGCGAGAAAGACATCAGGAGGATATGGAGCTGATAGAGAATGCACATCGGAGCCGCCTGAAACTAGTGGAAGACTCTGCCCGTCAAAGAGAGGAGCGACTGCGCCTTGAGAACCAGGAGTTGTCCGCCCAGTACCTATCTCGGTGCCAGAGCACGGAAACCGAGAAAGCCGAACTGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTTTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAGAGACTCAAGCGGCTAAAGGACCAAGAGATCGATGCAGTGACGAGTGCTTCCTCCCACACAAGATCCCTGAACACCGTTATTGAACAAATGGAGTCGTTCTCCCACAAGCTGAGTGACCTGTCCCACAGAGTAGAGAGCACTCAGCAGACGACTTCCCATGAGCTGGAGACAGGAGCACGCCAGAGAGAAGGGCAGCTCAGAGCACTGCAGGAGCAACTGAGCCGCCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAG
                                                  Xt7.1-CHK-1008235069                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTAGCTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAACAGCCCTGAAAGAACCCGAGTAAAGGAAAGCTCTGCCCCGCCTCCTGCGCGTTCCAAGCTGGATGAGCTCCTTGGTAGAGGGACTGCAGCCAAACTTCTGGAAAGACCACCCACTGGGGAGCGAAAAGAATTTAAACTTGATCCTAAATACCAGAAACAGCAAGAGAACCAGAACACACCAGACGATGCGGATATTAACTTTGGTTCGTACCAACCTACTGTCAACAGTCCTGAGGGGCGACCGTCTCGCAGGCCATCTGTCAGATTCTCTGCAGATGGCAGCGACAATTTCAAATCGGAAGGAAGGTCTCGCTCCAGCACCCCAGCAACTAGGAGTCCAGCCAGAGGAGAGAGGGGTGGGGCGGACTGGCTGGGCTTGAAAGACGATGACATTGATGTTCCTGATTTTACACCTTCATTACCTGTCAGGGACCCACCCCGGTCTGCAGGTGTTACACCAAGTTCAGCCGGACGTCCCACCTCTGGAAATAAAATTGCGGACAAGCCTATTAACCAAACGAGAAGTGGGCTCCAGGAAGCAGCCTCGGTAGCACAGGAGGATGATGGGTGGCTGACCTCTGCCCTTTCACAAAAAAAGGCACAAAAACAGGAAATGGAGGAAAAAAGCAAAAGCCAAGCCAGACAGGAAGATGTTACAGGGAGCAGCCCTGCAGTCTTCTCACAAACCAGCTCACAGGAGTCCGCTGTTAATAAAGGCACAAGAGAGACTGGTATGGTAGTTGCTGAGGTATCTGGGTCTCCCAAAAAAGTCTCTACGTTTGTGGCTCCCAAACAAGAAGAAACCATTCAGACAGCAGTTACCGGCCCGTCTCAAGAGCACGGCACAGCCAGAACTTTGCAGACGGTGGTCTCGCGGCCATTAGAGAGAAAAGCACGAGATGGGGATAGAGATCTTCACGGGGATCCCCTGCAGGCACAGAATCGAGTGATGGATCTAGAGGCACAGGTCAGGAAGCTCCAGCTAGAGAGGGACCAACAGAACCTGCTGCTGGAGACCCTGCGAGAAAGACATCAGGAGGATATGGAGCTGATAGAGAATGCACATCGGAGCCGCCTGAAACTAGTGGAAGACTCTGCCCGTCAAAGAGAGGAGCGACTGCGCCTTGAGAACCAGGAGTTGTCCGCCCAGTACCTATCTCGGTGCCAGAGCACGGAAACCGAGAAAGCCGAACTGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTTTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAGAGACTCAAGCGGCTAAAGGACCAAGAGATCGATGCAGTGACGAGTGCTTCCTCCCACACAAGATCCCTGAACACCGTTATTGAACAAATGGAGTCGTTCTCCCACAAGCTGAGTGACCTGTCCCACAGAGTAGAGAGCACTCAGCAGACGACTTCCCATGAGCTGGAGACAGGAGCACGCCAGAGAGAAGGGCAGCTCAGAGCACTGCAGGAGCAACTGAGCCGCCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAGGAGCGA
  5   1   2       bld Te4  FLt3 in                         CAAN8905.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGGGAAGCCGAATGAGTAGCTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGG
  5   1   2   24  bld Brn2 5g                             CAAJ14278.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAATGAGTAGCTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGTAAAGAAAAAAGGCATTCTATAGGCATTGGGTACCACACTAGAACTTCAGCTTCTAAAGTTTCCCTTTCTCCCCTCCTAGAAATAGAAGATAtacaggtatgggacccgttatccaaaaacccgtaatccagaaaactacagaaggcccatctcccatagactctattataatcaaataattaatatttttaaaaattttataataaaacagtacctgtacttgatatcaactaagataTAATTACCCCTTATTGNGGCAGAACAGCCCTATT
  5   1   2   14 seed Te4  5g3  in                         CAAN7760.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAAGATTGCGGGGAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAACAGCCCT
  5   1   2       bld HdA       in                   THdA045h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGCGGGGAGAGAGAAGTTCGGATCGNCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACNAAAAGATCANACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGAATATCTTCCAATTAGCCCGGCAAAAACCTCTCTG
  5   1   2   14  bld Te3  5g3  in                        CAAM15725.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAGAGAAGTTCGGATCGCTGCTTCAGTTCCTGAGTGGTGTCCCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCT
  5   1   2       bld Te3       in                        CAAM15364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTTGCTACAGGCGCTGCCCCCGTTTGTGTATGTGGGAGTCACACAGTAAGCAGTAACCCCTCACCCCAGGAATGGCATCAAGAAAAAAGAAAGGAATTTTAGATTCTATAGATGATGACCTTGGAGATCTTCTCAGAGATGACGAGCCGTCCCCGATCAGAGCACGCAAGGCGTCTCCCATAAATCCTGCTTTTCCAAGCAAACCCCATTCCCGTATTACTTCCAGCGCCCACAAAAGTTCTCCGCTCGATGACACCTTCTTCAGTCAGCTGGCTAAAGAGGCAGGAGAGGAGTCGGATGTCTCCGAGGCTGATCCCCAGGCTCTGCTTGATGCAATGAAGGACATGGATGAGTTAGACGCAGAAATATTCGGTGGGAGGAAGCTGAAATCTGCACCCGCAAAGGATTCTAGGATGAGCCGGAGTGCTGGCCTAGAGCTGAAACCACAGGAGAACCCAATAGAAAACAAGAGGGGACATTCTGCCCCAGAAAGTGAAAGGAAAATCACATCATCCCCAGCAGCGCGGCCCTATAAGAAGTTCTCACTTGAAGATCTTAATGATCCGCTTGCGGGGATTTTATCTGATGAAGATGATCTTGTTGACAAAAAGATCAAACCTCGGGGATCTACAGCTACTGAAAAACCCAAATCTGCTCCGGAATCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAAC
  3   1   2       bld HdA       in                    THdA045h21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGCCCCCACGAAGAGCGCGGATAATCTTCCAATTAGCCCGGCAAAACCCTCTCTGACCACCCTTAAAAAGGACGAGTTTAACTTTGGGGAGGAGACCGATGATCTTATGGATGCTCTTGGATTTGATAACAGCCCTGAAAGAACCCGAGTAAAGGAAAGCTCTGCCCCGCCTCCTGCGCGTTCCAAGCTGGATGAGCTCCTTGGTAGAGGGACTGCAGCCAAACTTCTGGAAAGACCACCCACTGGGGAGCGAAAAGAATTTAAACTTGATCCTAAATACCAGAAACAGCAAGAGAACCAGAACACACCAGACGATGCGGATATTAACTTTGGTTCGTACCAACCTACTGTCAACAGTCCTGAGGGGCGACCGTCTCGCAGGCCATCTGTCAGATTCTCTGCAGATGGCAGCGACAATTTCAAATCGGAAGGAAGGTCTCGCTCCAGCACCCCAGCAACTAGGAGTCCAGCCAGAGGAGAGAGGGGTGGGGCGGACTGGCTGGGCTTGAAAGACGATGACATTGATGTTCCTGATTTTACACCTTCATTACCTGTCAGGGACCCACCCCGGTCTGCAGGTGTTACACCAAGTTCAGCCGGACGTCCCACCTCTGGAAATAAAATTGCGGACAAGCCTATTAACCAAACGAGAAGTGGGCTCCAGGAAGCAGCCTCGGTAGCACAGGAGGATGATGGGTGGCTGACCTCTGCCCTTTCACAAAAAAA
  5   1   2      skin Spl1      in                         CABK7614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACGTCCCACCTCTGGAAATAAAATTGCGGACAAGCCTATTAACCAAACGAGAAGTGGGCTCCAGGAAGCAGCCTCGGTAGCACAGGAGGATGATGGGTGGCTGACCTCTGCCCTTTCACAAAAAAAGGCACAAAAACAGGAAATGGAGGAAAAAAGCAAAAGCCAAGCCAGACAGGAAGATGTTACAGGGAGCAGCCCTGCAGTCTTCTCACAAACCAGCTCACAGGAGTCCGCTGTTAATAAAGGCACAAGAGAGACTGGTATGGTAGTTGCTGAGGTATCTGGGTCTCCCAAAAAAGTCTCTACGTTTGTGGCTCCCAAACAAGAAGAAACCATTCAGACAGCAGTTACCGGCCCGTCTCAAGAGCACGGCACAGCCAGAACTTTGCAGACGGTGGTCTCGCGGCCATTAGAGAGAAAAGCACGAGATGGGGATAGAGATCTTCACGGGGATCCCCTGCAGGCACAGAATCGAGTGATGGATCTAGAGGCACAGGTCAGGAAGCTCCAGCTAGAGAGGGACCAACAGAACCTGCTGCTGGAGACCCTGCGAGAAAGACATCAGGAGGATATGGAGCTGATAGAGAATGCACATCGGAGCCGCCTGAAACTAGTGGAAGACTCTGCCCGTCAAAGAGAGGAGCGACTGCGCCTTGAGAACCAGGAGTTGTCCGCCCAGTACCTATCTCGGTGCCAGAGCACGGAAACCGAGAAAGCCGAACTGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTTTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAG
  3   1   2      skin Te4  FLt3 in                         CAAN8905.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCCCGTCAAAGAGAGGAGCGACTGCGCCTTGAGAACCAGGAGTTGTCCGCCCAGTACCTATCTCGGTGCCAGAGCACGGAAACCGAGAAAGCCGAACTGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTCTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAGAGACTCAAGCGGCTAAAGGACCAAGAGATCGATGCAGTGACGAGTGCTTCCTCCCACACAAGATCCCTGAACACCGTTATTGAACAAATGGAGTCGTTCTCCCACAAGCTGAGTGACCTGTCCCACAGAGTAGAGAGCACTCAGCAGACGACTTCCCATGAGCTGGAGACAGGAGCACGCCAGAGAGAAGGGCAGCTCAGAGCACTGCAGGAGCAACTGAGCCGTCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAGGAGC
  3   1   2       bld Te3       in                        CAAM15364.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCAGAGCACGGAAACCGAGAAAGCCGACTGGCTGGCGCAGTATCAGAAGAAACTGACTGAATTCCAGCAGGAGAAGGAGCTGGAACTGGAGAGAATTCGGGAACTGCAGAGGGTGTTTGTCCAGGAGATGTGCAGAGACCATGAGGAGCAGCTGCAGAGACTCAAGCGGCTAAAGGACCAAGAGATCGATGCAGTGACGAGTGCTTCCTCCCACACAAGATCCCTGAACACCGTTATTGAACAAATGGAGTCGTTCTCCCACAAGCTGAGTGACCTGTCCCACAGAGTAGAGAGCACTCAGCAGACAACTTCCCATGAGCTGGAGACAGGAGCACGCCAGAGAGAAGGGCAGCTCAGAGCACTGCAGGAGCAACTGAGCCGCCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAGGAGCGAGC
  5   1   2       bld Neu       in                   TNeu104m02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGCACTGCAGGAGCAACTGAGCCGCCAGCAGAAAGACATGGAGCAAGAACGAAACAGTCTCCGTATGGTGATAACCAACATGGAGACACGGTTAATTGAGCAAAGCCGTCTCCTAGAACAGGAACGATGGCGGGTCACCTCAGAACAAGCCAAGGTGGAGTCATTGCAGCGCTCACTGGAGGAGCAGAGGAGGGTCGTGACACAGCAAATGGCAATAGAAAGAGAGGAGCTGGAAAGGGCAAAGAGCGCTCTCCTGGAGGAACAGCAGTCTGTCATGTCTCGGTGCACAGAAGAGCGTCGAAAGCTGGCGGCAGAATGGTCCGATTTTCATACCCAGCAAAAACTGAGCAAGGAGCGAGCAGAGAAAGAAGCAAACAGGGTCATTGTGGCAGAAACTCAGAGGGAGGGCGCCATCATAAATCTGGCCAAGGAGCAGGCAGAGTTAAAGATCAAGGCTAGTGAGCTGCTC
  5   1   2      ests                                 Xt7.1-CABK7614.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAGAGAAAGAAGCAAACAGGGTCATTGTGGCAGAAACTCAGAGGGAGGGCGCCATCATAAATCTGGCCAAGGAGCAGGCAGAGTTAAAGATCAAGGCTAGTGAGCTGCTCAACAAAGAGGAGCAGCTGTTTTTGGCCAGAGAGGCCATGGAAAAGGAAAGACAAGACCTCCGCCTGGAAAAGGAAAGGGTTAATGCATCTGCTCTGCGGGTGCGACAGCGTGCGGAGGAAATAGAGAGCATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAATGTCGTTTTCTATATGTAACTTCTAATTTATACCTTTTGCACCATTTTTATACCAGAGAAATAAACATGCATTGA
                                                  Xt7.1-CHK-1008240476                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGAAGCAAACAGGGTCATTGTGGCAGAAACTCAGAGGGAGGGCGCCATCATAAATCTGGCCAAGGAGCAGGCAGAGTTAAAGATCAAGGCTAGTGAGCTGCTCAACAAAGAGGAGCAGCTGTTTTTGGCCAGAGAGGCCATGGAAAAGGAAAGACAAGACCTCCGCCTGGAAAAGGAAAGGGTTAATGCATCTGCTCTGCGGGTGCGACAGCGTGCGGAGGAAATAGAGAGCATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAATGTCATTTTCTATATGTAACTTCTAATTTATACCTTTTGCACCATTTTTATACCAGAGAAATAAACATGCATTGATTTGCA
  3   1   2      seed Spl1      in                         CABK7614.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAGCAGAGAAAGAAGCAAACAGGGTCATTGTGGCAGAAACTCAGAGGGAGGGCGCCATCATAAATCTGGCCAAGGAGCAGGCAGAGTTAAAGATCAAGGCTAGTGAGCTGCTCAACAAAGAGGAGCAGCTGTTTTTGGCCAGAGAGGCCATGGAAAAGGAAAGACAAGACCTCCGCCTGGAAAAGGAAAGGGTTAATGCATCTGCTCTGCGGGTGCGACAGCGTGCGGAGGAAATAGAGAGCATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAATGTCATTTTCTATATGTAACTTCTAATTTATACCTTTTGCACCATTTTTATACCAGAGAAATAAACATGCATTGATTTGC
  3   1   2       bld Neu       in                    TNeu104m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAGAGAAAGAAGCAAACAGGGTCATTGTGGCAGAAACTCAGAGGGAGGGCGCCATCATAAATCTGGCCAAGGAGCAGGCAGAGTTAAAGATCAAGGCTAGTGAGCTGCTCAACAAAGAGGAGCAGCTGTTTTTGGCCAGAGAGGCCATGGAAAAGGAAAGACAAGACCTCCGCCTGGAAAAGGAAAGGGTTAATGCATCTGCTCTGCGGGTGCGACAGCGTGCGGAGGAAATAGAGAGCATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATAAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAATGTCGTTTTCTATATGTAACTTCTAATTTATACCTTTTGCACCATTTTTATACCAGAGAAATAAACATGCATGATTGCTCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp FLsh out                    EC2BBA30DE01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGACCTCCGCCTGGAAAAGGAAAGGGTTAATGCATCTGCTCTGCGGGTGCGACAGCGTGCAGAGGAAATAGAGAGTATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCACGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAACAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTAATAGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAAAATCGTTTTCTATATGTAACTTCTAATTTATACC
  3   1   2       bld Te4       out                         CAAN580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGGGTGCGACAGCGTGCGGAGGAAATAGAGAGCATGAGCAAGTTGGCATCACAACGTTATGAGGAGGGAGAGAAAGCTCTAGAAGAGGCACGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTCTGCGACAACAGGAGGAACATATACATCAGGAACGTCTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTCTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCACAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTCTTGGAAACTCTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGCGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGTGAATGTCGTTTTCTATATGTAACTTCTAATTTATACCTTTTGCACCATTTTTATACCAGAGAAATAAACATGCATTGATTTGC
  3   1   2       bld Te3  5g3  in                        CAAM15725.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCACCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTTTGCGCCAACAGGAGGAACATATCCTTCAGGAACGTTTGAGTCTGGCACAGCAGAGACGCCAGTTAAACCAACTTCAGCAAGAGCTTCCCACTGCCAGTGTTTTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCACTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCAGGAAACCAGCAAACCCCAAGTAACAGAGTTCCATGCCAAATTGGCTCTGCTCAAGATGTCTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTTTTGGAAACTTTCAGGAAGCCCAACTTGCCCTGGTCACAAGCCGTATGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCACAAGGGGGGGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACACACTGGGAATGTCATTTTCTATAGGTAACTTCTAATTTATACCTTTTGCCCCATTTTTATACCAGAGAAATAAACATGCATTGATTTGCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaataaaaaaaaT
  3   1   2      skin Te4  5g3  in                         CAAN7760.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGAGAAAGCTCTAGAAGAGGCATGCAAGATAGAATCCGAGCCCCAGGGCCGTTTAAGGGCAATTCAGCAGAAACTGGAAATTTTGCGCCACCGGGGGGAACATATCCTTCAGGAACGTTTGAGTTTGGCACAGCAGAGACGCCAGTTAAACCAATTTCAGCAAGAGTTTCCCACTGCCAGTGTTTTATTCCCTGCCAGACCCCCAGAGCCCCCCCTGATGGCACAGAATGGGAAGTTCCCTGCAAAAGCTATTGGGATCCCAGCAGCGCTGCGGGAAACCAGCAAACCCCAAGTAACAGAGTTCCATGCCAAATTGGCTTTGCTCAAGATGTTTGCCCAGCAGGACAGGGACTTCCTGGAAGAAGAGCAGGCCTTTTTGGAAACTTTCAGGAAGCCCAACTTGCCCTGGTCCCAAGCCGTTTGATGAAAAGGCAAGCTGCAGGCAAATCAGAGTGCCCCAAGGGGGGGTAATCCCTCATGCACTTCCTTGTACAGCCAACAACCCCCTGGGAAGGTCGTTTTCTATAGGTAACTTTTAATTTATACCTTTTGCCCCATTTTTATCCCAGGGAAATAAACATGCATTGATTTGCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)