Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1  24.0    0(repeat)                                    0 REP     92       2704     2940                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012155601 Xt7.1-XZT28311.3.5 - 30 ESTs
                                                                       .0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT28311.3.5  CAGGTGGAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAGGGGTTCGAGGGGCTCCTGTCACTCAGGGTCAGCCTCCTGGAGTCCATGGGGGAGGGGATCCCTGACACCCCCATATTCACAGATGTGGTCACCTTCCGTATGGCTCCTCTCATCATCACCCCAAACACATTGCAGCCCATCGACGTGTTTGTATGCAGCGTCAAGGACAACCTCTCTCCACATGCAATATACCCGTGGAAAGTTTATCAACGGAGAGGGAGAAAGAGAGAGAAATTTGAGGATGTGAACCGGGGAGACCGCTGGATGCAGGATGAGATTGAGTTCGGGTACATCCACGCCCCCCACAAGAGCTTCCCTGTGGTTCTGGACTCGCCGCGAGACCGGGGGCTGAAGGATTTCCCTGTCCGGAATCTGCTGGGCCCGGACTTCGGATACGTCACTAAACTCGCCGCCGCTGCCGAAGTGACCAGTCTGGACTCATTTGGGAACCTGGAAGTGAGCCCCCCAGTAACTGTGAGCGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCAACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACCCCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTTACGTTCTGTGCCTTTAATTTCCTGCTGAGTCTGCCCAGTTACCCCCTATATACCCCCAGCGGGTGGGTCCTGCCCCACAGTGTCCGGTGCCCCCAGGAACCTCCCCCTGGGTAAGTGAGTCCAATCTCCCCCCAGTGCTTACCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCTCCCCCTGGGTGGGTGAGTCCGGTCTCCCCCCGGTGCTTGCCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCATGACAGTTACACATAACTATAAACCCAGTGAGAATGAGGAATGAATGG
                                                  Xt7.1-CHK-1008266767        GAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAGGGGTTCGAGGGGCTCCTGTCACTCAGGGTCAGCCTCCTGGAGTCCATGGGGGAGGGGATCCCTGACACCCCCATATTCACAGATGTGGTCACCTTCCGTATGGCTCCTCTCATCATCACCCCAAACACATTGCAGCCCATCGACGTGTTTGTATGCAGCGTCAAGGACAAxxxxTCTCCACATGCAATATACCCGTGGAAAGTTTATCAACGGAGAGGGAGAAAGAGAGAGAAATxxxxxxATGTGAACCGGGGAGACCGCTGGATGCAGGATGAGATTGAGTTCGGGTACATCCACGCCCCCCACAAGAGCTTCCCTGTGGTTCTGGACTCGCCGCGAGACCGGGGGCTGAAGGATTTCCCTGTCCGGAATCTGCTGGGCCCGGACTTCGGATACGTCACTAAACTCGCCGCCGCTGCCGAAGTGACCAGTCTGGACTCATTTGGGAACCTGGAAGTGAGCCCCCCAGTAACTGTGAGCGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCAACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCxxxxCCCCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTTACGTTCTGTGCCTTTAATTTCCTGCTGAGTCTGCCCAGTTACCCCCTATATACCCCCAGCGGGTGGGTCCTGCCCCACAGTGTCCGGTGCCCCCAGGAACCTCCCCCTGGGTAAGTGAGTCCAATCTCCCCCCAGTGCTTACCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCTCCCCCTGGGTGGGTGAGTCCGGTCTCCCCCCGGTGCTTGCCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCATGACAGTTACACATAACTATAAACCCAGTGAGAATGAGGAATGAATGGGTATTG
                                                      consensus depths       3     3     5     5     5     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     8     7     8     7     8     7     8     6     8     6     8     6     8     6     8     5     7     5     7     4     7     4     7     4     7     4     7     4     7     4     7     3     7     4     7     4     6     4     6     3     5     3     5     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     7     6     7     6     8     6     8     6     8     6     8     5     8     5     7     6     8     6     8     6     8     6     8     7     9     7     9     7     9     7    10     7    10     7    12     6    12     6    12     6    12     6    12     6    13     6    13     6    13     5    13     5    12     5    12     5    12     5    12     4    12     3    13     4    13     9    14    12    14    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    14    15    15    15    15    15    14    14    12    12    12    12    12    12    12    12    12    12    11    11    11    11     2     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                                 Xt7.1-CAAK5395.5  CAGGTGGAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAGGGGTTCGAGGGGCTCCTGTCACTCAGGGTCA
  5   1   2      ests                                 Xt7.1-XZT28311.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGATTGAGTTCGGGTACATCCACGCCCCCCACAAGAGCTTCCCTGTGGTTCTGGACTCGCCGCGAGACCGGGGGCTGAAGGATTTCCCTGTCCGGAATCTGCTGGGCCCGGACTTCGGATACGTCACTAAACTCGCCGCCGCTGCCGAAGTGACCAGTCTGGACTCATTTGGGAACCTGGAAGTGAGCCCCCCAGTAACTGTGAGCGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCAACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACACCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTTACGTTCTGTGCCTTTAATTTCCTGCTGAGTCTGCCCAGTTACCCCCTATATACCCCCAGCGGGTGGGTCCTGCCCCACAGTGTCCGGTGCCCCCAGGAACCTCCCCCTGGGTAAGTGAGTCCAATCTCCCCCCAGTGCTTACCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCTCCCCCTGGGTGGGTGAGTCCGGTCTCCCCCCGGTGCTTGCCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCATGACAGTTACACATAACTATAAACCCAGTGAGAATGAG
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACCTTGGCCCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTCTATATATTTTAGCCTATAAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                               BLH ATG      32     544  
                                               BLH MIN      32     203  
                                               BLH MPR       8     203  
                                               BLH OVR      32      43  
                                               EST CLI      -1      61  
                                                                                                        PROTEIN === Dr ==== 8e-170     NP_956406.1 Unknown (protein for MGC:66317) [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                        PREDICTED = Gg ==== 0          XP_425730.2 PREDICTED: similar to peptidylarginine deiminase [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                        PROTEIN === Hs ==== 0          NP_031391.1 peptidyl arginine deiminase, type II [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PROTEIN --- Mm ---- 0          NP_032838.1 peptidyl arginine deiminase, type II; PAD type II [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                  PREDICTED - Xl ==== 0          AAH46745.1 Similar to peptidyl arginine deiminase, type 2 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                  PROTEIN --- ?? ==== 0          NP_001080369.1 peptidyl arginine deiminase, type 2 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                        PROTEIN === Xt ==== 0          AAI35444.1 Unknown (protein for MGC:121340) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT28311.3.5                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------ATG---------TAA------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------TAATAA---------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------TGAATG
                                                                   ORF                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Tad5 FL                          XZT28311.FL-MGC       GGAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAGGGGTTCGAGGGGCTCCTGTCACTCAGGGTCAGCCTCCTGGAGTCCATGGGGGAGGGGATCCCTGACACCCCCATATTCACAGATGTGGTCACCTTCCGTATGGCTCCTCTCATCATCACCCCAAACACATTGCAGCCCATCGACGTGTTTGTATGCAGCGTCAAGGACAACCTCTTCTTCCTAAAGGCCATCAAGAGCCTCGTTGCCCAGGCCGACTACAACGTCAAGATCTGCTTTGAGGATGTGAACCGGGGAGACCGCTGGATGCAGGATGAGATTGAGTTCGGGTACATCCACGCCCCCCACAAGAGCTTCCCTGTGGTTCTGGACTCGCCGCGAGACCGGGGGCTGAAGGATTTCCCTGTCCGGAATCTGCTGGGCCCGGACTTCGGATACGTCACTAAACTCGCCGCCGCTGCCGAAGTGACCAGTCTGGACTCATTTGGGAACCTGGAAGTGAGCCCCCCAGTAACTGTGAATGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCCACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAACAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACACCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCAGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTTAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CAAK5395.5  CAGGTGGAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAGGGGTTCGAGGGGCTCCTGTCACTCAGGGTCA
                                                  Xt7.1-CHK-1008238078        GAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAGGGGTTCGAGGGGCTCCTGTCACTCAGGGTCAGCCTCC
  5   1   2   24  bld Brn3 5g                             CAAK11999.5p GCAGGTGGAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGGTAACGAAGTCTCCGCCTCCTGCTAACGCTCGTTATGGGGGAGGATCTAATTGTCGCTCCTGTCCCTTCCCCCAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCNGGGAATCTGGGGGTGTTTCACTACCACAGTAAGTGCCATTGGCT
  5   1   2       bld TbA  5g                        TTbA041i21.p1kSP6  CAGGTGGAAGAGCGGACGGAGAAGGGACCATGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACACAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCATGAGCTGC
  5   1   2   14 seed Brn3 5g3  in                         CAAK5395.5p .CAGGTGGAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAAGGGTTCGAGGGGCTCCTGTCACTCAGGGTCAGCCTCC
  5   1   2       bld Tad5 FL   in                         XZT28311.5p       GGAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGGACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCCGA
  5   1   2   10  bld Tail 5g3  in                         CBSW7693.b1 ......GGAAGAGCGGACGGAGAAGGGAACAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACTGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGTGCAGAGACCAACGATGGGAAGATTACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAATGGACAAGGGGCCATTCTCCTAGTGAACTGTGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCC
  5   1   2       bld Tbd0                               IMAGE:6976953                       CCGATTCTCGGTCTGTGCGCTGATCGCCGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATACCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACAGACCGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTAGCGCCAAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAGCGGGTCAGACGCTCCTATAAACAAGGCTGGAGTCTATTTCACAGGGGTTGAGATCTCATTGGACGTTCACACAGACCGCGATGGGGTCGTGGAGAAGAACAATCCCCACAAGGCCTCGAGGACGAGGGGCCCTAACAGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCTCTTGGAGGACGGGGGGGACCATATAATGATGAACAAAGAAGATCTGCTGGACATGTCCCCCAAGTGTCTCCGGGTTCTGGGGGCCCGAAAAAGCTCCCAACCCGGGGTATTACAAGGCTGCTCATATTGCTTCCGACCTCCAGATGCCGGTGGAAAATCTGGGGGGGTGGTTTACCACTACCCAACAAAACAAGGATGGTTAAAGGAACGACGGGGCCTGGGGGCACAATGCCTAAATAGCCTGGATTCCCTACCAAAAGGGCGCACCGACTAAACATCGGGTGGATGAGCTCAAAATGAAAGGACCGGTGCACCACTTTTTCTTTTTTGTGTCTCAAGAAGGGGTGTCTCCCTGTCGCGGATATTTTTATCACGCGGAGATATAGAGAGGGGGGAGTCTTTGTTCAGAAAGGGTAGGCCCTCACCAGCGGTTACAACCTATATAAAGGGGTCTCCACATGCAATATACCCGTGGAAAGTTTATCAACGGAGAGGGAGAAAGAGAGAGAAATCCACCCGGGGACGAACACTCCCCCCCATTCCTCTCTCCCAATAGTGGTGTGCGGATCACCCCATTTTGCGCTGAAAGAGAGCTAACACCACTTTTTAAGAGGATGAGCCTCCTGAAAATATTGATATATGGGGAATGTCGATCATTTTTGATGGTGATATATGCTCATGCGCCGACCAAATTCTTTGAAGACACGCAGCTTTCACTAGTTGGATAAACGCGGGCCACTTCTGCTAGAAAGACCTGCTGCGGGAGCCGCAGTTCCCTACAATATCAT
  5   1   2       bld Gas1      in                       IMAGE:6990369                       CCGGGATCAAGATGCAGCAGAATCGCACGGTGCGTTTGGTCCGGGGGCAGAGACTGGAGGCTGTGTGTGTGTTGGGCACCACCGTATCCATCCCTGTGCTGGGGGGGGCGCCAGCTGAGTCCCAATGGTTCTCCCTGCACCACTCGCAGAACATCGAGGCCTCCGTGCTCCGCACCGACAGCGCCAAACAGAAAACTGTCAATGGGGAGAAGCTTTGGCCGCTGACGCCGGAGAGTTTGGTGGAAATAAAGATGTTGGCGCCGAGCGCAGAGACCAACGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCATACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCACAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAAGAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACCCGGGGAATCTGGGGGTGTTCACTACCACAATAAGATCTATAGCACTTGCTGGGAAGCAAAAGCTGTTCTAAAGCCCGCTAACGGGAACCAAGACTGCTTTCTTTGTAAGGCCCGCCTTCCCGGAAAGGGTTCAAGGGCTCTGCCTTAGGGTAACTCTGAATCATN
  5   1   2       bld Gas7      in                         XZG16858.5p                                                                                                                                                                                                                                                                                                            CGATGGGAAGATCACATTTGCATATTATGGCAACGGGTCAGACGCTCCTATAGACAAGGCTGGAGTCTATTTCACTGGGGTTGAGATCTCATTGGACGTTGACGCAGACCGCGATGGGGTCGTGGAGAAGAACAATCCGCACAAGGCCTCGTGGACGTGGGGCCCTAACGGACAAGGGGCCATTCTCCTAGTGAACTGCGACAAGGACAGCCTATTCGCTCGCTCGGTGGACGGGGGGGACAATATAATGATGAGCAAAGAAGATCTGCTGGACATGTCCCCCATGTGTCTCCGGGTTCGGGGGCCCGAGAAGCTCCCCACCGGGTATTACCTGCTGCTCTATGTCTCCGCCTCCGACGCGGGGAATCTGGGGGTGTTTCACTACCACAATAAGATCTATAGCCACGTGCTGGGCAAGCAGAAGCTGTTCTACAAGGCGCGCTACACGGGAACCAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAGGGGTTCGAGGGGCTCCTGTCACTCAGGGTCAGCCTCCTGGAGTCCATGGGGGAGGGGATCCCTGACACCCCCATATTCACAGATGTGGTCACCTTCCGTATGGCTCCTCTCATCATCACCCCAAACACATTGCAGCCCATCGACGTGTTTGTATGCAGCGTCAAGGACAACCTCTTCTTC
  5   1   2      ests                                 Xt7.1-XZT28311.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGATTGAGTTCGGGTACATCCACGCCCCCCACAAGAGCTTCCCTGTGGTTCTGGACTCGCCGCGAGACCGGGGGCTGAAGGATTTCCCTGTCCGGAATCTGCTGGGCCCGGACTTCGGATACGTCACTAAACTCGCCGCCGCTGCCGAAGTGACCAGTCTGGACTCATTTGGGAACCTGGAAGTGAGCCCCCCAGTAACTGTGAGCGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCAACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACACCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTTACGTTCTGTGCCTTTAATTTCCTGCTGAGTCTGCCCAGTTACCCCCTATATACCCCCAGCGGGTGGGTCCTGCCCCACAGTGTCCGGTGCCCCCAGGAACCTCCCCCTGGGTAAGTGAGTCCAATCTCCCCCCAGTGCTTACCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCTCCCCCTGGGTGGGTGAGTCCGGTCTCCCCCCGGTGCTTGCCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCATGACAGTTACACATAACTATAAACCCAGTGAGAATGAG
                                                  Xt7.1-CHK-1008229895                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGTTCGGGTACATCCACGCCCCCCACAAGAGCTTCCCTGTGGTTCTGGACTCGCCGCGAGACCGGGGGCTGAAGGATTTCCCTGTCCGGAATCTGCTGGGCCCGGACTTCGGATACGTCACTAAACTCGCCGCCGCTGCCGAAGTGACCAGTCTGGACTCATTTGGGAACCTGGAAGTGAGCCCCCCAGTAACTGTGAGCGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCAACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCxxxxCxCCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTTACGTTCTGTGCCTTTAATTTCCTGCTGAGTCTGCCCAGTTACCCCCTATATACCCCCAGCGGGTGGGTCCTGCCCCACAGTGTCCGGTGCCCCCAGGAACCTCCCCCTGGGTAAGTGAGTCCAATCTCCCCCCAGTGCTTACCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCTCCCCCTGGGTGGGTGAGTCCGGTCTCCCCCCGGTGCTTGCCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCATGACAGTTACACATAACTATAAACCCAGTGAGAATGAGGAATGA
  5   1   2       bld Te5       in                         CAAO3053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATGAGCTGCAGTTCTTTGTCGAGGGCCTGCGCTTCCCGGACGAGGGGTTCGAGGGGCTCCTGTCACTCAGGGTCAGCCTCCTGGAGTCCATGGGGGAGGGGATCCCTGACACCCCCATATTCACAGATGTGGTCACCTTCCGTATGGCTCCTCTCATCATCACCCCAAACACATTGCAGCCCATCGACGTGTTTGTATGCAGCGTCAAGGACAACCTCTTCTTCCTAAAGGCCATCAAGAGCCTCGTTGCCCAGGCCGACTACAACGTCAAGATCTGCTTTGAGGATGTGAACCGGGGAGACCGCTGGATGCAGGATGAGATTGAGTTCGGGTACATCCACGCCCCCCACAAGAGCTTCCCTGTGGTTCTGGACTCGCCGCGAGACCGGGGGCTGAAGGATTTCCCTGTCCGGAATCTGCTGGGCCCGGACTTCGGATACGTCACTAAACTCGCCGCCGCTGCCGAAGTGACCAGTCTGGACTCATTTGGGAACCTGGAAGTGAGCCCCCCAGTAACTGTGAATGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCCACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGGAGGAAACCAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGA
  3  -1   2       bld Mus1      in                         CABH8764.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGATTGAGTTCGGGTACATCCACGCCCCCCACAAGAGCTTCCCTGTGGTTCTGGACTCGCCGCGAGACCGGGGGCTGAAGGATTTCCCTGTCCGGAATCTGCTGGGCCCGGACTTCGGATACGTCACTAAACTCGCCGCCGCTGCCGAAGTGACCAGTCTGGACTCATTTGGGAACCTGGAAGTGAGCCCCCCAGTAACTGTGAGCGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCAACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTCACGCTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCACTGATGAAGCCGTTCGAGTTGAACTGCACGTTTATCGAGGACTTACCTCGTACCAC
  5   1   2       bld Brn4      in                        CAAL20167.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGAAGTGAGCCCCCCAGTAACTGTGAGCGGGAAGGATTACCCCCTGGGGCGCATTCTGATTGGAAGCAGCTTCCCCACCTCCTCTGGGCGGCGGATGACCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCAACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCCGGACCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCAC
  5   1   2       bld Brn4                                 CAAL8900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAAAGCAGTACGAGACTTTCTCTATGCCCAGCGGGTACAGGCGCCAGTAGAGCTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCAACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCACGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAGGGGACTTGGCCCGAGACTCCTCC
  5   1   2       bld Te5                                 CAAO10276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTACAGTGATTGGCTGTATGTGGGTCACATTGATGAGTTCATGACCTTTGTACCCACGGCCGATAAGAAGGGATTCCGGCTTCTCTTGGCCAGTCCGGTCGCTTGTTTTCAGCTTTTCCGTCAGAAGAAGGACGAGGGGCACGGGGACGTAACGTTGTTTCAGGGGAAGGAAACCAAGAGATGGACAGTTGCCAAGATCATCTCCACTGATTCGCTGGTGAAGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACACCC
  5   1   2       bld Brn3      in                         CAAK2840.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGAACCTTTATGTCCAGCGATCCATAGACTGGAACAGGGACATCCTGAAACAGCAGCTCGGCCTCAGCGAAGACGACATCATTGATATCCCGGCGCTGTTCAAGTTGGAGAGCGGGGGCCGAGCGCTGGCATTCTTCCCCAATATGGTGAATATGTTGGTGCTGGGGAAGGAGCTGGGGATCCCCAAACCCTACGGGCCGGTGATTAAGGAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCACGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAACCAATGGGAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACACCCCCCCCCCCCC
  3   1   2       chi Gas1      in                       IMAGE:6990369                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGTTCTCTTCCTAGTGAGAGAACTGATGACAGTGTGCGGTGAAGCCTACGTTCATAAACCCTGCATTTGGTGAGTCCTATCATTATATCGGAGGCGCGATCCAAACATTCATTGATACACTCCTTGCGGAGCGAATGGAATTACACATGTGAATAAGAGATTGCACAGTTGCTGGAAATTTATTTAAGCGGATGCAGATACAGAAATAACGAGGGAATGCGGTAATTCATTTGTTTCAATCGGTTGTGAAGTGGCCAAACTGTTACTGGTTGTTGTGAGGTAGTTATAAAACACGGCAGAAAGTTTCATCCAAGGGGGGCTTATAGAGAGACATAAGGTATTCAAGAATCTTCACCCCAGGGTCGAAACTAGGAGTACTTTAAAGCACATTAAAATACATTTGATGAATTATTGGAAATTATGCCCCCCCCCCCCCCAGTTTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGAGTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCAGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTGTTTNN
  5   1   2      seed Tad5                                 XZT25842.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAGCTGCTGCCTGGAGGATCACATGGTGTCGCTGATGAAGCCGCTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACACCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCAGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGC
  5   1   2       bld Bone      in                       CBTC10971.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTGTCACTGATGAAGCCGTTCGAGTTGAACTGCACGTTTATCGAGGACTTTACCTCGTACCACAAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAGGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAACCAATGGGAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACACCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGATGAGTGCCCCACTTAGCTCCGCCCCTA
  5   1   2       bld Egg                            TEgg133h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGAAGTTGGGGGAGGTGCATTGCGGCACAAACGTGCGTCGGAAGCCGTTCCCGTTCCAGTGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATCTGGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGCTGGGCCTCATTCTCCTATACACCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCAGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCA
  3   1   2       bld Tad5 FL   in                         XZT28311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCCCGTTCCAGGGGTGGCGGATGGAGGAGCCGTAAGAGCCGGACCCAGCAGGGGACCTGTATTTGGGCCCAATGGCTCCAGTAGGCATGGGGGGGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATGGACCAGTTTGTGCCTTAAAGGGACCTGGGCCCGAGACTCCTCCTCCCCGGGGCCGCCTCTCTATATATTTTAGCCTATAATAATCAAGAGAGACAGGGGGNTGGNCCTCATTCTCNTATACACCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCAGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn3 5g3  in                         CAAK5395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGACCTGTTTTTGGGCCCAATGGTTCCAGTGGGCAGGGGGGCGCCCCCTATTGATAGGGTCCCCCAGTTTTTCCCATTCAGGGTTCGCCCATTTTGTCCCTTAAAGGGCCCTTGGCCCGAGATTCCTCCTCCCGGGGGCCGCCTCTTTAAATTTTTTGGCCTATAATATTCACCCAATGGGAAGAGAGCCAGGGGGTTGGCCCTCTTTTTTTTATAAACCCCCCCCCCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTT
  3   1   2       bld Bone      in                       CBTC10971.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGCACAATGGCTCCAGTAGGCATGGGGGCGCCCCCTACTGATAGGGTCACACAGTGTTTCCCAGTCAGGGATCGACCAGTTTGTCCCTTAAAGGGACCTTGGCCCGAGACTCCTCCTCCCCGGTGCCGCCTCTCTATATATTTTAGCCTATAATATTCACCCAATGGGAAGAGAGACAGGGGGTTGGGCCTCATTTTCTTATACACCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGATGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGT
  3   1   2       bld Brn3      in                         CAAK2840.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGAGGGCCGGGGGGCCCCCCCTATTAAAGGGGTCCCACAGTTTTTCCCATCCGGGGTTCGCCCATTTTTTCCCTAAAAGGGACCTGGGCCCGAGATTCCTCTTCCCGGGGGCCCCCTTTTTAAATTTTTTGCCCTTTAATATCCCCCCAATGGGAAGAGAACCAGGGGGTGGGGCCTTTTTTTTTTAAAAACCCCCCCCCCCCCCCCCCCCCCCAGTTTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTT
  3   1   2       add Brn4      in                        CAAL20167.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGGGGGGGGCCCCCTTTGGAAGGGGTCCCCCGGTTTTTCCCAACCGGGGGTGGCCCATTTTTTCCCTAAAAGGGCCCTTGGCCGGGGATTCCTCTCCCCGGGGGCGCCCCCTTTAAATTTTTTGGCCCAAAAAATCCCCCCAAGGGGAAGAAAACCGGGGGGGGGGCCCTTTTTTTTTTAAAAACCCCCCCCCCCCCCCCCCCCCCCAGTTTGTACAACTCCCTGCAACCCCTGGGGGCAAATCACTCCCGGGGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTTTGCTTCATAGGACTAATGGGCAGGAGGGGGGGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGGGTAACCTTTTTGGAGGGATATAGTGCAGGGGGAGTGCCCCACTTAGCTCCGCCCCTATTCCCAGGGGGCCTCAGTAACCAAGGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAAAAAAACTTCCATTGGGTTT
  3   1   2       bld Gas7      in                         XZG16858.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGGATGGACCAGTTTGTGCCTTAAAGGGACCTTGGCCCGGGACTCCTCCTCCCCGGGGCGGCCTCTCTATATATTTTAGCCTATAATATTCAACCAATGGGAAGAGAGCCAGGGGGGTGGGCCTCTTTTTCTTATACACCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCAGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTT
  3   1   2       bld Tail 5g3  in                         CBSW7693.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCGGGGGGTGGGCCCTTTTTTTTTTTTAAACCCCCCCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGCGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTAAAAAAAAAAAAAAA
  3   1   2       bld Te5       in                         CAAO3053.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTCTTATACACCCCCCCCCCCGCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCAGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTCTTTGTTTTCTGTAATAAAACTTCCATTGTGTT
  5  -1   2       bld Mus1      in                         CABH8764.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCCCCCCCCCCCCCCCCCCCCCCCAGTCTGTACAACTCCCTGCAACCCCTGAGGGCAAATCACTCACGGAGGAAGCCGGGCTCAGAACCAATAAGACAATAGGCTGTGATTCATGGCAACCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGATGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAAC
  3   1   2       bld Bone                                CBTC2343.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCGGGCTCAGANCCATAAAGACAATAGGCTGTGATTCATGGCACCCAATCAGATGTCTGCTTCATAGGACTAATGGGCAGGAGGTGGAGACAACTGCAGATTGGTTGCCATGGTTACTGCCCTGCTTCTGTAAGTGCCCAGTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGATGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGT
  5   1   2       bld Gas7      in                         XZG22291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTAATCCGTGTAACCTTATTGGAGGGATATAGTGCAGGACGAGTGCCCCACTTAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTTACGTTCTGTGCCTTTAATTTCCTGCTGAGTCTGCCCAGTTACCCCCTATATACCCCCAGCGGGTGGGTCCTGCCCCACAGTGTCCGGTGCCCCCAGGAACCTCCCCCTGGGTAAGTGAGTCCAATCTCCCCCCAGTGCTTACCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCTCCCCCTGGGTGGGTGAGTCCGGTCTCCCCCCGGTGCTTGCCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCATGACAGTTACACATAACTATAAACCCAGTGAGAATGAGGAATGAATGGATATTGGGGAGCTGTATCAGGAG
  3   1   2       chi Gas7      in                         XZG22291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCTCCGCCCCTATTCCCATGGTGCCTCAGTAACCAATGATTGTCATTTCCTTTACTAACTCGTTATTCCAGGAACAAGTTCTGTTTGTTTTCTGTAATAAAACTTCCATTGTGTTACGTTCTGTGCCTTTAATTTCCTGCTGAGTCTGCCCAGTTACCCCCTATATACCCCCAGCGGGTGGGTCCTGCCCCACAGTGTCCGGTGCCCCCAGGAACCTCCCCCTGGGTAAGTGAGTCCAATCTCCCCCCAGTGCTTACCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCTCCCCCTGGGTGGGTGAGTCCGGTCTCCCCCCGGTGCTTGCCCAGGTGCAGAGCTCTGGTTCTCTGTGCTTCCTGCTCCTGGGCTGCTCTCTTTCCCATGGTCAGGCAGGAACCATGACAGTTACACATAACTATAAACCCAGTGAGAATGAGGAATGAATGGGTATTGGGGAGTTGTATCAGGAGTCAGAACCAGCAGTGCAGGGAAGGGAAAGGGACAGACACAGTGACAGTTACACATAACTATAAACCCAGTAAGAATGAGGGATGAATGGATATTGGGGAGTTGTATCAGGAGTCAGAACCAGCAGTGCAGGGAAGGGAAAGGGACAGACACAGTGACAGTTACACATAACTATAAACCCAGTGAGAATGAGGAATGAATGGATATTGGGGAGTTGTATCAGGAGTCAGAACCAGCAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)