Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT58755.5                           31 END     3          14        9                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012155639 Xt7.1-CABH5005.3.5 - 21 ESTs
                                                                       ...-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABH5005.3.5              GGCCAGTGCCTGGGGGTAGGAGGAGGTGAGCAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAGAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTCTGGATTTAACAACAACAGTTCAGCAGGAATTCTCTGTTGAAGAAGTGGAAAATACAGTTCTAACTGTTTCCAAAGAACTAAATGATATATGTGACAAGACAATCAGATTGGCTTCAGACCCACTTGCAAGTCATTGTGCCTGTTTGGAGGAAGTGCATATGACAAATATTAAACCCTGGTGAAAGGCCTGGGGAATGTATTATCAAATTCCACATAACAAATGGGGTTACAATGTCATTTACAAGGAAACTACAGCAGATCGTTCTGGAAAGGTTCATGCTGGTGATGAAGTGATTCAAGTTAATTATCATACAGTGGTTGGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCAAATAAATAGAAAAAAAATTGTTACAGTTCACTTCCTTGTTATATAAACACAGTACAGGTATATTGGGAAAAGGATTGATGTTTTACTTTCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTACATTAAATAAACCCAATAGGATTGTTTTGCTGTTGACATGGATTCATGTAGCTTAGTTTAGTTTGGATCAAGTACAAGGTAATGTTTTATTATTACAGATGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAACCTCAAAAAAAAAATTAAAAAAAACCCTTAAAACCTAAATAACCTAAACCTAAATTTTGCACCAAAATCTGGCAAGGGTTCATGTAGACATCAATTGAGTTGTATTCTCAAATTTTAAGCTATT
                                                  Xt7.1-CHK-1008267607                    TGCCTGGGGGTAGGAGGAGGTGAGCAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAGAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTCTGGATTTAACAACAACAGTTCAGCAGGAATTCTCTGTTGAAGAAGTGGAAAATACAGTTCTAACTGTTTCCAAAGAACTAAATGATATATGTGACAAGACAATCAGATTGGCTTCAGACCCACTTGCAAGTCATTGTGCCTGTTTGGAGGAAGTGCATATGACAAATATTAAACCCTGGTGAAAGGCCTGGGGAATGTATTATCAAATTCCACATAACAAATGGGGTTACAATGTCATTTACAAGGAxxCTxCAGCAGATCGTTCTGGAAAGGTTCATGCTGGTGATGAAGTGATTCAAGTTAATTATCATACAGTGGTTGGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCAAATAAATAGAAAAAAAATTGTTACAGTTCACTTCCTTGTTATATAAACACAGTACAGGTATATTGGGAAAAGGATTGATGTTTTACTTTCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTACATTAAATAAACCCAATAGGATTGTTTTGCTGTTGACATGGATTCATGTAGCTTAGTTTAGTTTGGATCAAGTACAAGGTAATGTTTTATTATTACAGATGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAACCTCAAAAAAAAAATTAAAAAAAACCCTTAAAACCTAAATAACCTAAACCTAAATTTTGCACCAAAATCTGGCAAGGGTTCATGTAGACATCAATTGAGTTGTATTCTCAAATTTTAAGCTATTTTTCAA
                                                      consensus depths                   2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     5     3     3     3     3     3     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     6     3     6     3     6     3     6     4     6     4     6     4     6     5     7     5     7     5     7     5     7     4     7     5     7     5     7     5     7     5     6     5     6     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     3     4     2     4     2     3     3     4     3     4     3     4     4     5     4     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     6     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                                 Xt7.1-CAAM6696.5              GGCCAGTGCCTGGGGGTAGGAGGAGGTGAGCAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAGAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTC
  5   1   2      ests                                 Xt7.1-CABH5005.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGCAGATCGTTCTGGAAAGGTTCATGCTGGTGATGAAGTGATTCAAGTTAATTATCATACAGTGGTTGGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCAAATAAATAGAAAAAAAATTGTTACAGTTCACTTCCTTGTTATATAAACACAGTACAGGTATATTGGGAAAAGGATTGATGTTTTACTTTCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTACATTAAATAAACCCAATAGGATTGTTTTGCTGTTGACATGGATTCATGTAGCTTAGTTTAGTTTGGATCAAGTACAAGGTAATGTTTTATTATTACAGATGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAACCTCAAAAAAAAAATTAAAAAAAACCCTTAAAACCTAAATAACCTAAACCTAAATTTTGCACCAAAATCTGGCAAGGGTTCATGTAGACATCAATTGAGTTGTATTCTCAAATTTTAAGCTAT
                                               BLH ATG     311     320              
                                               BLH MIN     281     148              
                                               BLH MPR      17     148              
                                               BLH OVR     311     838              
                                               EST CLI       0      14              
                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 2e-017     NP_499274.3 Connector/eNhancer of KSR family member (cnk-1) [Caenorhabditis elegans] ----------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ==== 1e-030     NP_725671.1 connector enhancer of ksr CG6556-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ==== 9e-039     XP_800096.2 PREDICTED: similar to connector enhancer of KSR2A [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Dr ==== 2e-095     XP_697212.1 PREDICTED: similar to connector enhancer of kinase suppressor of Ras 2 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 3e-104     ABD34787.1 connector enhancer of KSR-like protein CNK1 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 2e-119     AAI36229.1 Unknown (protein for MGC:122779) [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 2e-119     NP_001093681.1 connector enhancer of kinase suppressor of Ras 2 [Xenopus (Silurana) tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = Mm ==== 0          NP_766134.1 hypothetical protein 6820402C05 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                     PREDICTED - Gg ---- 0          XP_419685.2 PREDICTED: similar to CNKSR family member 3 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 0          NP_775786.2 CNKSR family member 3 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABH5005.3.5                                        TGA---------------------------------TGA------------------------------------------------TAG---------------------------------------------------------TAA---------------TAG---------------TAA---------------------TGA---------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TGA------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------TAAATG---------------------TAG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------TAA------------------------------------------------ATG---TGA------------------------------------------TAG------------------------------------------------------------------TGA------------------TAA------------------------------------------------------------------ATG------------TAA---TAG------TAG---------------------------------------------TAG---------------------------TGA---------ATG---------------------------------------TGA---------------------TAG------------------------------TGA------------------------------------------------------------------------------------------TAA---TAG------------------------------------------------------------------TAA---------------------TAG---------ATG------------------TAG------------------------ATG------TAA---TAA---------------------------------------------------------------------------------------------------------TAG------------------------------------------ATG------------ATG------------------------------------------------------------------------TGA---------TAG------------------TGA------------------------TAA---------------------TAA---------------------------------------ATGTAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  0   1   1           Gas  FL                     TGas117a01.FL-Sanger                                                                                                                                                            AACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTCTGGATTTAACAACAACAGTTCAGCAGGAATTCTCTGTTGAAGAAGTGGAAAATACAGTTCTAACTGTTTCCAAAGAACTAAATGATATATGTGACAAGACAATCAGATTGGCTTCAGACCCACTTGCAAGTCATTGTGCCTGTTTGGAGGAAGTGCATATGACAAATATTAAACCTGGTGAAGGCCTGGGAATGTATATCAAATCCACATACAATGGGTTACATGTCATTACAGGAACTACTGAGAATTCTGCAGCAGATCGTTCTGGAAAGGTTCATGCTGGTGATGAAGTGATTCAAGTTAATTATCATACAGTGGTTGGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCAAATAAATAGAAAAAAAATTAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CAAM6696.5              GGCCAGTGCCTGGGGGTAGGAGGAGGTGAGCAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAGAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTC
                                                  Xt7.1-CHK-1008240528                    TGCCTGGGGGTAGGAGGAGGTGAGCAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAGAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTCTGGATT
  5   1   2      seed Gas7      in                         XZG47684.5p GGCGGCTGAAAGCGGCCAGTGCCTGGGGGTAGGAGGAGGTGAGCAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAGAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTNCACAA
  5   1   2       bld Egg  5g                        TEgg118c05.p1kSP6              GGCCAGTGCCTGGGGGTAGGAGGAGGTGAGCAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAAAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTC
  5   1   2   14  bld Te3  PIPE out                        CAAM6696.5p .................AGTGCCTGGGGGTAGGAGGAGGTGAGCAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAGAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACCAAGAATAAAAT
  5   1   2       bld Lun1      in                        CABD14548.5p                                            CAGGAGCGAGCTTTTCCTATCATGGGGGCAGGTGACTCTCCGTAAAGAACGGCCGCACTGTAAAGCGCTTAAAAGAAGAGGAATAGCGGCTGAACGCCACCCCAGGCCCAAAAACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTCTGGATTTACAACAACAGTTCAGCAGGAATTCTCTGTTGAAGAAGTGGAAAATACAGTTCTAACTNGTTCCAAAGAACTAAATGATATATGTGACAAGACAATCAGATTGGCTTCAGACCCACTTGCAAGTCATTGTGCCTGT
  5   1   2       bld Gas  FL   in                   TGas117a01.p1kSP6                                                                                                                                                            AACTCTGCGTAGCGGGATCGTGAATTATGGCTAATGTGTGAGCAGTCACTAGCCCTCAACTGCAAACTAACAACTCAGAAGAACCTTCTCATGACGCCGACTGGAAGAAGAAAAAGATCCATCAATTTATAATCGCGAAGGAGCAGAGAGAGCTGGATTTGTACTAATCATGGAGCCCGTAACGAAGTGGTCCCCTATCCAAGTTGTTGAGTGGATGAAAGGACTTGATGATTGCTTGCTGCAGTATGTTACTAATGTAGAGCGAGAGAAGATAAATGGTGAACAGCTACTTAAATTCACTCATCAGGATCTTCAGGAACTTGGAATTACGCAAATTCAACATCAAGAGCTTGTTCTTGAGGCAGTTGATCTTCTTTGTGCCTTGAATTATGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTA
  5   1   2       bld AbdN                               IMAGE:7023349                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTATAGAACAAGTTCGGTCTCCATTCCCGGGATGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTCTGGATTTAACAACAACAGTTCAGCAGGAATTCTCTGTTGTAGAAGTGGAAAATACAGTTCTAACTGTTTCCAAAGAACTAAATGATATATGTGACAAGACAATCAGATTGGCTTCAGACCCACTTGCAAGTCATTGTGCCTGTTTGGAGGAAGTGCATATGACAAATATTAAACCCTGGTGAAAGGCCTGGGGAATGTATTATCAAATTCCACATAACAAATGGGGTTACAATGTCATTTACAAGGAAACTAACTGGAAGAATTTCCTGCCAACCAAGAATTCGTTTCCTGGAAAAAGGGTTCCATTGCTTGGGGTGGAAATGAAAAGTTGGATTTCAAAAGTTTAAATTTTAATCCAATTACCAGGTGGGGGTTTGGGGCTTGGGGCCAAAATTTTAAAAAGGAAAATCTCTTTTGGTGTAAGCCCCCAGGGGGCCTTTGGAAAAGGGGGGAAAAAAAAATTTTCCACAGGGGGGTGGGGCCCAAGGTTTCCACACCCCAACCTTATAACCTTTTTCTCTGTGAAGAAAAAAAAAGAAAAGAGACACCCTTTTACCCCCCAAGGCCCAGACCTTTTTTGGGGAAATAATTTATTAAAACCCATCCCCCAAGGAGGCCGCGCCCTCTTTTTTTTATAACAAAAACAAACCNCCTCTCTGGAAAGAAAAATAGTGGGAAGAGGCGCTCCCTCTCCCAGACCCTTTTGTGGTGTAACCACAAGAACAACAAAAGAGTTTACAACTTCTCTACACCCCAAAAAAGAGGGCTTTTTAGTTGGCCAAGGGTTCTCTCTCCCCCAAGAAAAAAGCCACACCCTTTCCCAAATATATTTCTCTTCTTCCTCTTCAAAAAATAACAAAAAGAGAAAA
  5   1   2      ests                                 Xt7.1-CABH5005.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGCAGATCGTTCTGGAAAGGTTCATGCTGGTGATGAAGTGATTCAAGTTAATTATCATACAGTGGTTGGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCAAATAAATAGAAAAAAAATTGTTACAGTTCACTTCCTTGTTATATAAACACAGTACAGGTATATTGGGAAAAGGATTGATGTTTTACTTTCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTACATTAAATAAACCCAATAGGATTGTTTTGCTGTTGACATGGATTCATGTAGCTTAGTTTAGTTTGGATCAAGTACAAGGTAATGTTTTATTATTACAGATGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAACCTCAAAAAAAAAATTAAAAAAAACCCTTAAAACCTAAATAACCTAAACCTAAATTTTGCACCAAAATCTGGCAAGGGTTCATGTAGACATCAATTGAGTTGTATTCTCAAATTTTAAGCTAT
                                                  Xt7.1-CHK-1008232433                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATCGTTCTGGAAAGGTTCATGCTGGTGATGAAGTGATTCAAGTTAATTATCATACAGTGGTTGGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCAAATAAATAGAAAAAAAATTGTTACAGTTCACTTCCTTGTTATATAAACACAGTACAGGTATATTGGGAAAAGGATTGATGTTTTACTTTCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTACATTAAATAAACCCAATAGGATTGTTTTGCTGTTGACATGGATTCATGTAGCTTAGTTTAGTTTGGATCAAGTACAAGGTAATGTTTTATTATTACAGATGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAACCTCAAAAAAAAAATTAAAAAAAACCCTTAAAACCTAAATAACCTAAACCTAAATTTTGCACCAAAATCTGGCAAGGGTTCATGTAGACATCAATTGAGTTGTATTCTCAAATTTTAAGCTATTTTTCA
  3   1   2       bld Gas7      in                         XZG47684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCTGAATATGGGGTCTGGAAATGGACAGCATGAAAAATACTGTGCTAAAACTGAGATCATCATCTAACAATCTTCAGAATTATATTGGCAATCAGAAGAAAAGTGCATCTTATGATAGCAATACATCTCACAAGCCCCACAATGATTTTCTCACCTCTGCTGTAGAACTCATTGGCTCTGCAAAAGCTTTATTAACATGTCTTGAAAGAGCTCCATTTACAGAGATCACTGACTTATCTTCAACAAAGAATAAAATTATTCAGCTCTGTCTGGATTTAACAACAACAGTTCAGCAGGAATTCTCTGTTGAAGAAGTGGAAAATACAGTTCTAACTGTTTCCAAAGAACTAAATGATATATGTGACAAGACAATCAGATTGGCTTCAGACCCACTTGCAAGTCATTGTGCCTGTTTGGAGGAAGTGCATATGACAAATATTAAACCTGGTGAAGGCCTGGGAATGTATATCAAATCCACATACAATGGGTTACATGTCATTACAGGAACTACTGAGAATTCTGCAGCAGATCGTTCTGGAAAGGTTCATGCTGGTGATGAAGTGATTCAAGTTAATTATCATACAGTGGTTGGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAAAAAAAAAGGGCGGCCGCAAGGCCTGA
  5   1   2       bld Ski1      in                         CABJ9778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     cgaggtttcgtgcgatattatcggtgcgtgtatggccagctttagaAGGTATGTTGTTACTTTTGATCATATCCTGTACTTGGTGAGTAGGTATGTGTTTCCTGAGCATTACCTAAACTACTGTTACCTAAAACCTTCAATCTATATAATAATTTACCTCTAAAGCTATGAAAGTAAATTCACTAATAACTAAAGGCGGCTTTAATGATGTCCTTCCATCGTTTAAATTATGTCCTTCCATCTCATTAGTCTGCAGCAGATCGTTCTGGAAAGGTTCATGCTGGTGATGAAGTGATTCAAGTTAATTATCATACAGTGGTTGGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCT
  5   1   2       bld Gas8      in                          st40i14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCTGGCAATTAAAGAATCTTGTAGCCAGGCTGAGGGATAATTCAGGTGCAGTCACACTACTTCTGAAAAAGAGACCTACCAGCAGCTTGAATTTTACTCCAGCGCCTTTAAAAAACCTGAGATGGAGGCCTCAGCTTGTACAGACAAGTCACTCACCAACAGCTATGCAGTCTCCAGAAAGCACTTCAAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAG
  5   1   2       bld Te4       in                         CAAN6022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATTCTTCTCTAAAAAAAGAAAAGCCGGCAATTCTTGATCTTTACATACCACCACCACCAAGTGTTCCGTATTTTCCACGTACTGAGGTTGGCAGCAGTGGAAGTAACAGATGTGTATATCCTATTCCTGGGTCAGAAGGTTCTGAGTCCCCAAACTCTTTTTTGGACCATGAAAGCCGCAGAAGATGGTTTACTATTGCCAACTCTGACCAGCTTTTCTCTTCTCCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGGACACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAAATCTAGCCAGTGGGACTGAATATGCATATC
  3   1   2       bld Lun1      in                        CABD14548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGC
  3   1   2       bld Te4       in                         CAAN6022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATTAGAAGTGAAGGTGCAGCCTGCAAAACTCAGAGACAAAACACCTTCATATGTAAACCACGTCCCTTGTCAATGCCTGCTGAACCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCAAAAAAAAAAA
  5   1   2       bld Te5                                  CAAO7707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAGCTGGATGGTACCACCTGAAACATACTCCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCTAATAAATAGAAAAAAAATTGTTACAGTTCACTTCCTTGTTATATAAACACAGTACAGGTATATTGNGAAAAGGATTGATGTTTTACTTTCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTT
  3   1   2       bld Gas  FL   in                    TGas117a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGACACAGACTGGCAGGAAAGAAAGGTGAAGGGGTCTTTCCAGGTATTTCAGTAATGAACAAATAACACCTATCACTGAAGAAAATATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAACACCAAGGAACTCATGCAAATAAATAGAAAAAAAATAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Mus1      in                         CABH5005.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTATTCTTGCAGTAACTTAACAAAGCCGGCCAGCAGAAGGCTGGTAAGAGGAGCAGACTATGTACGAGCTAGTCCAAGTCTTTTAAACATGGACCTGCACAATAGTTCCACAATGCCTTACCAGGAAGATGTTGAAAAAAAGCACAATGCCTCTTCATCTTCAAAGAATTCTTCCACAGAGCCATCATTTCTGGTCAGCTGGTTTACAAAACTGAAACTCTTGCCTCGCTAAATGTGTTCAGATTGTTACACCACTTAGTGCCTTTATACCCTAAATTACAGTATTAGGTGCAAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCACCTCTTGGACAACACTTGCACACACTACAAGTTGAGCAAGCCATGTTCAAATCAAAAACTTTGTTTATTTTCTCTGAATTCTAGCCAGTGGGACTGAATATGCATATCAGATATTGAATACTCTGTCCGCCAACGCGTGCATACATATTTCTCTGTCAAATAAAACCACAAGAAGCAAACGCACTCAGTATTACAGAAAATAACTTATGGAATGTTCTGACCAGATGCATCCGGCAAAGACCAAGGAACTCATGCAAATAAATAGAAAAAAAATTGTTACAGTTCACTTCCTTGTTATATAAACACAGTACAGGTATATTGGGAAAAGGATTGATGTTTTACTTTCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGG
  3   1   2      seed Mus1      in                         CABH5005.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGCAAATAAATAGAAAAAAAATTGTTACAGTTCACTTCCCTTGTTATATAAACACAGTACAGGTATATTGGGAAAAGGATTGATGTTTTACTTTCCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTacattaaataaacccaataggattgttttgctgttgacatggattcatgtagcttagtttagtttggatcaagtacaaggtaatgttttattattacagaTGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAAC
  3   1   2       bld Ski1      in                         CABJ9778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTATATAAACACAGTACAGGTATATTGGGAAAAGATTTGATGTTTTACTTTCCTGTGTAATTTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTacattaaataaacccaataggattgttttgctgttgacatggattcatgtagcttagtttagtttggatcaagtacaaggtaatgttttattattacagaTGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAACCTC
  5   1   2       bld Neu       out                  TNeu059i23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGGATTGATGTTTTACTTTCCTGTTGTAATTCTCATTGAAATATTCAAATGCGGTTGTATACTGTAGCTTCTTGCAGAGACAGGCTTTCTTCTTGATGTATGTGTTTTGCTAACATTAGCCAAATTAGTCCCACTGCAGTAACCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACC
  3   1   2       bld Gas8      in                          st40i14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAATCACAACCATTATGTTTAGTTTGCTTGTAGTGCAGTATACTGATTATAGCTGATGACTGATTGGCTGCTATGGGTTATTGCACTGGGTCAAATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTACATTAAATAAACCCAATAGGATTGTTTTGCTGTTGACATGGATTCATGTAGCTTAGTTTAGTTTGGATCAAGTACAAGGTAATGTTTTATTATTACAGATGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATGAAAAAAAACT
  5   1   2       bld Gas7                                 XZG10453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTATTAGGTGCAAACTCATCTATGTGGAGACATGCTACATACGGTTTTCTTCATTTGGCTAATGCTAGTAATTGAGCCCTGTGTGTTGAGAAGATTTAGTTCAATGGGCAGTACAGAAACAGATTCAGATGATGTTTACAGGCAGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTacattaaataaacccaataggattgttttgctgttgacatggattcatgtagcttagtttagtttggatcaagtacaaggtaatgttttattattacagaTGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAACCTCAAAAAAAAAATTAAAAAAAACCCTTAAAACCTAAATAACCTAAACCTAAATTTTGCACCANAATCTGGCAAGGGTTCATGTAGACATCAATTGAGTTGTATTCTCAAATTTTAAGCTATTTTTCAAT
  5   1   2       bld Liv1      out                       CAAR13323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGAATGTCACCAGTGGCTTTCTCTTGCAACTCTTTCAGACCACGCCTGCAGCTTATTGGCCTGTGTATGTAGCTTACTAAAAATAGGCCAACAATCGGACAAGTTTGAAAATTACCTCCGGCAAGGATCACATCTGCACATTCGTGCAGTCCTAACAGGCCCCAGTATATGATCGCTAGATTGGGTCCATGTTTACTTATGTGACATCTTAGCCAAAGGAGCAGATCTGGCAGTGTATGGGCGATTAAGACTAAATAAAGCAGCAGCAGGAACAACCGTTTCTCATAGTCTGGATAATATCCATTacattaaataaacccaataggattgttttgctgttgacatggattcatgtagcttagtttagtttggatcaagtacaaggtaatgttttattattacagaTGAAAGGTAAATACATGTTTCCCTTGTACTTAAACAAACACATACTTCACGCTAAGGGGCAGCCTTTCAATTTGCATTTATACTGCAATTGAAAAAAAACTTAGTGGCAAAAATTGCAAATTTGAGTTTCAAAACCTCAAAAAAAAAATTAAAAAAAACCCTTAAAACCTAAATAACCTAAACCTAAATTTTGCACCAAAATCTGGCAAGGGTTCATGTAGACATCAATTGAGTTGTATTCTCAAATTTTAAGCTATTTTTCAATTTAAGTTTTCAAGATTTTACTGCTTTCTAGTTGTTTTTTCACATTTGTAAGTGAATGAGTTTTTGAGTTTCAATGTTTTTTTTTTTTTTTTAGCAATGCAGTAATATAGATATATCCAAAGTACATTTCATAACCTCTGTCTGCTGCCTGCATAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)