Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas131d16.3.5                       27 END     1           4        3                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012155646 Xt7.1-TGas123h01.3.5 - 24 ESTs
                                                                       ........-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas123h01.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                   CGACATAGTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATAAAACAAGGCTCAATTACCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACTGTAGTTCTGGGATTAATTAGCCTAAAAAATGTAGCTGTTTCTTTTGCTGAAACTGTTAAAAGCTCAGCTCCAATATTTACCGTTATAATGTCCAGGCTCATATTGGGAGAGTACACTGGTATGATGGTGAACCTTTCCTTGCTACCAGTCATGGCTGGATTAGCTCTTTGCACAGCAACAGAACTCAGTTTCAACATAGTGGGCTTCTCAGCTGCGTTGTCAACCAACATAATGGACTGCTTGCAGAATGTCTTCTCAAAGAAACTTCTTAGTGGGGATAAATACAGATTTTCACCACCTGAGCTCCAGTTCTACACCAGCGCTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTTTACTTTTCAATACTGGATGATAATACAATATTTCCTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAATCATATTACTGTACATCTGTACTTTTTACACAACAGCTTAAAATCCTTGACAGTGATTTTTATTTTATCATTTATTTCAATTAGGCACATGTATCAATACAATTGATTTCATGTTTTTGTTTTTGTTTTTTTTTTTTGTATTTTTGACAGTGTTACAAAAGCCTTTATTACACTGCTTCTTCTCTAAGTACATGGTGTCCTCACAACATACCAGTACAAGTGATACTAAAAAAAAGGTCCATTTTTTTTCCTTTTTAAATAACATATCAGTATCACTTAAAACCTTACCGACAATTACTTTTCATTTAAAGCGGACCTGTCACCTTAAGAAATAATTTCAAATTGTTTTCTGTTGTGTTTGGCAAGCAAAATAAACTTTACTTACACTAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008267608                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATAAAACAAGGCTCAATTACCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACTGTAGTTCTGGGATTAATTAGCCTAAAAAATGTAGCTGTTTCTTTTGCTGAAACTGTTAAAAGCTCAGCTCCAATATTTACCGTTATAATGTCCAGGCTCATATTGGGAGAGTACACTGGTATGATGGTGAACCTTTCCTTGCTACCAGTCATGGCTGGATTAGCTCTTTGCACAGCAACAGAACTCAGTTTCAACATAGTGGGCTTCTCAGCTGCGTTGTCAACCAACATAATGGACTGCTTGCAGAATGTCTTCTCAAAGAAACTTCTTAGTGGGGATAAATACAGATTTTCACCACCTGAGCTCCAGTTCTACACCAGCGCTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTTTACTTTTCAATACTGGATGATAATACAATATTTCCTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAATCATATTACTGTACATCTGTACTTTTTACACAACAGCTTAAAATCCTTGACAGTGATTTTTATTTTATCATTTATTTCAATTAGGCACATGTATCAATACAATTGATTTCATGTTTTTGTTTTTGTTTTTTTTTTTTGTATTTTTGACAGTGTTACAAAAGCCTTTATTACACTGCTTCTTCTCTAAGTACATGGTGTCCTCACAACATACCAGTACAAGTGATACTAAAAAAAAGGTCCATTTTTTTTCCTTTTTAAATAACATATCAGTATCACTTAAAACCTTACCGACAATTACTTTTCATTTAAAGCGGACCTGTCACCTTAAGAAATAATTTCAAATTGTTTTCTGTTGTGTTTGGCAAGCAAAATAAACTTTACTTACACTAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                        2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     5     6     6     7     6     7     6     7     7     7     6     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     3     4     2     4     2     3     2     3     2     3     2     3     3     4     2     4     2     4     3     4     2     4     2     3     2     3     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     5     5     5     5     4     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     7     4     6     4     7     4     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     4     7     4     8     4     9     4     9     6     9     6     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                                Xt7.1-CABE13275.5                                                                                                                                                                                                                                                                                                                                                                                                                                   CGACATAGTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATA
  5   1   2      ests                               Xt7.1-TGas123h01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGTAGTTCTGGGATTAATTAGCCTAAAAAATGTAGCTGTTTCTTTTGCTGAAACTGTTAAAAGCTCAGCTCCAATATTTACCGTTATAATGTCCAGGCTCATATTGGGAGAGTACACTGGTATGATGGTGAACCTTTCCTTGCTACCAGTCATGGCTGGATTAGCTCTTTGCACAGCAACAGAACTCAGTTTCAACATAGTGGGCTTCTCAGCTGCGTTGTCAACCAACATAATGGACTGCTTGCAGAATGTCTTCTCAAAGAAACTTCTTAGTGGGGATAAATACAGATTTTCACCACCTGAGCTCCAGTTCTACACCAGCGCTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTTTACTTTTCAATACTGGATGATAATACAATATTTCCTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAATCATATTACTGTACATCTGTACTTTTTACACAACAGCTTAAAATCCTTGACAGTGATTTTTATTTTATCATTTATTTCAATTAGGCACATGTATCAATACAATTGATTTCATGTTTTTGTTTTTGTTTTTTTTTTTTGTATTTTTGACAGTGTTACAAAAGCCTTTATTACACTGCTTCTTCTCTAAGTACATGGTGTCCTCACAACATACCAGTACAAGTGATACTAAAAAAAAGGTCCATTTTTTTTCCTTTTTAAATAACATATCAGTATCACTTAAAACCTTACCGACAATTACTTTTCATTTAAAGCGGACCTGTCACCTTAAGAAATAATTTCAAATTGTTTTCTGTTGTGTTTGGCAAGCAAAATAAACTTTACTTACACTAAAAAAAAAAAAAAAA
                                               BLH ATG     368     190                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN     368      86                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR     362     718                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG     362      96                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sc ---- 4e-010     NP_012342.1 Hypothetical ORF; Yjl193wp [Saccharomyces cerevisiae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 6e-010     NP_505467.2 golgi GDP-fucose translocator; rescues human disease Leukocyte Adhesion Deficiency II (40.4 kD) (5K28) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 5e-026     AAH77379.1 MGC81612 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === ?? ==== 5e-026     NP_001086741.1 MGC81612 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Dr ---- 2e-029     XP_702624.1 PREDICTED: hypothetical protein XP_697532 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 8e-036     NP_608458.1 CG14621-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 8e-058     AAH88573.1 Hypothetical LOC496855 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 5e-107     XP_001199974.1 PREDICTED: similar to solute carrier family 35, member E2 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Hs ---- 8e-169     XP_001128065.1 PREDICTED: similar to solute carrier family 35, member E2 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 2e-170     NP_796160.1 RIKEN cDNA A530082C11 gene [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Gg ---- 3e-180     XP_417567.1 PREDICTED: similar to RIKEN cDNA A530082C11 gene [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas123h01.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                        TAG---------------------TGA---------------------TGA---------ATGTGA---------------------------------------------------------------------------------------------------------------------------------------ATGTAA---------------TGA------------------------------------------------TGA---------------------------------------------TAA---------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------ATG------------------------------------------------------------ATG---ATG---------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------ATGATG------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------ATGATG---ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------TAG------------------------------------------------------TAA---------------------------------------TAA------------------------------------------------------------TGA------------------------------------------------------TGA---TGA------------TGA------------------------------------------------TGATAA------------------------ATG------------------------ATG---TAA---------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------TAG---------------------ATG---------------------------------------------------------------------------------------------TAG------------------------------------TAGTAA---------------------ATG------------------------------TAA------------------TAA------------------------------------TAA------------TAATAA---------------------------TGA------------ATGTAG---------------------------------------------------------------------------------TGA---------ATG------------------------------------------TAG---------------------------------------------------TAAATG------------------TGA------TAA------------------------------------TGA------------------------------------------------------TAA------TGA---TGA------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1           Gas1 FS                     IMAGE:6989139.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                          GTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTAAATATCAAGTGATTTTGCTTTCACTTCCTGCTGTTCCAATTGTTTAGGTGTTTGGCCCAAACAATGAAAAACTGAGAAGTGGCCTTGCATGTGTAAAGGTTCCTTGTAGGGTTTCTGTACATTCAGCCTGTGAGCCAGTTGGTTAGATTACTGCACCAGTTGGACCGTGTATGGCCACCTGTAGCCATTAAGTACCCTGTTAGGAAAAACTTTTGCATTTTCCTTAGATGCTGAATGAGTGAAGCAGAGGTTTGGGCAGGTAGCAGCATTACATTGTTGCATAGAAGCCCACATTCTGAAATGTTTATTTAACATTAGATTCTATGTTTTGTCAGAGGTCTGTTATAATCATACATTTAGGGCTTTGACACACTTGGAGCCACTTCATTGCCCGCAGGAGAGAAGATTTTCGACTGGGCAATAAAGAACTGTTGTTTATTTGTTCATGTGATAAACTAGAACTCCACTTATCTTAGAAAACAACAGAAAAATGGTTTGCAATCTTGATATGTGTTCTCTGTTAATCTTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATAAAACAAGGCTCAATTACCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTAATTCTTCTAAACAAAACCTATGAAAGTCAAGTGTTCTTTGAGTTTACAATTTTATTATAAGTGTTACTTTTTATTCCTTATTATTCAATTCAGCTCCTCTTCTATACATATTTCAGTCTCTCATTCAAACACAAGATTGTAGCAACCAGATGGCTGCTAAAATTCCAAACTGGAGTGCTAAACAAAAAGCTAAATTACTGAAAAACCACGAAAAACCACAAGAAAATCGATATTGTCTAAGAATATAAATGTCTATGTCACACTGACAGTTAATTCAAAGGTATAAACATTGTCTCAGTCAGTTAGGAGCTGCATTTATGCTACTATGCACAGTATTAAAAAAAAAAAAAAA
  5   1   1           TbA  FL                     TTbA018g09.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATAAAACAAGGCTCAATTACCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACTGTAGTTCTGGGATTAATTAGCCTAAAAAATGTAGCTGTTTCTTTTGCTGAAACTGTTAAAAGCTCAGCTCCAATATTTACCGTTATAATGTCCAGGCTCATATTGGGAGAGTACACTGGTATGATGGTGAACCTTTCCTTGCTACCAGTCATGGCTGGATTAGCTCTTTGCACAGCAACAGAACTCAGTTTCAACATAGTGGGCTTCTCAGCTGCGTTGTCAACCAACATAATGGACTGCTTGCAGAATGTCTTCTCAAAGAAACTTCTTAGTGGGGATAAATACAGATTTTCACCACCTGAGCTCCAGTTCTACACCAGCGCTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTGGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCGATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTTTACTTTTCAATACTGGATGATAATACAATATTTCTTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACTCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                Xt7.1-CABE13275.5                                                                                                                                                                                                                                                                                                                                                                                                                                   CGACATAGTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATA
                                                  Xt7.1-CHK-1008239670                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATAAAACAG
  5   1   2   12  bld Gas7 5g3  in                         XZG33578.5p .............................................................................................................................................................................................................................................................................................................................................................................................................CCGTGAAACGTAACTTGAATGCGACATAGTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTAGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGNTGTCTGTACCAGCATAAAACAAGGCTCAATTTACCCTTCAA
  5   1   2   10 seed Ova1 5g3  in                        CABE13275.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................CGACATAGTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATAAAACAGGGCTCAATTACCCTTCAAATTTTCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACTGTAGTTCTGGGATTAATAGCCTAAAAAATGTAGCTGTTTCTTTTTGCTGAACTGTTAAAAGCTCAGCT
  5   1   2       bld Gas1 FS                            IMAGE:6989139                                                                                                                                                                                                                                                                                                                                                                                                                                          GTATCTTGCTACCGACTACAAGTGAGGTCATTCTATTTGGATTTTGTGATTGGTGACAATGTGAAGGGAAGGCGATGAGGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACAAGCATGCTAGGTAAATATCAAGTGATTTTGCTTTCACTTCCTGCTGTTCCATTGTTTANGTGTTTGGCCCAAACAATGAAAAACTGAGAAGTGGCCTTGCATGTGTAAAGGTCCNTTGTAGGNTTTCTGTACATTCAGCCTGTGAGCCAGTTTGGTAGATTACTGCACCAGTTGGACCGTGTATGGGCCACCTGTAACCATTAAGTACCCTGTTAGGAAAAACTTTTGCATTTTTCCTTAAATGCTGAATGAGTGAAAACAAAAGGTTTGGGCAGGTTAACACCATTAAATTTGTTGG
  5   1   2       bld Egg0 5g                              dad73b10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGGGGAAGGCGATGTTGTTAGGAATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCAGTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGGTGGAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGCGACAGCGTACCACATCAGAATGTACTCCAAATTACCCTTCCATAAACCACAATTTTTGATTTCGACCTGCGGGTCTTCAATTCTCCAGCCCTCCACTCCCTAATATCGTGCTTTTCCTTTACCTCCTGTACATTTTTTCCTTATAAAAATCTACTCTACCTC
  5   1   2       bld Gas  5g3  in                   TGas123h01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGGGCCCGTCCTTACCAAAGCTGCCATGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCGAGGGGCCTTTTCCCATAAGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGAGGGTCTTCAATTCTCGAGCCCTTATCTACCTATATTAGAGGTTTTTCTTTAACTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAAGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAG
  5   1   2       bld Gas  5g                        TGas039a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTCAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGTACAGTTAACCTGAAAACACATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTT
  5   1   2       bld TbA  FL   in                   TTbA018g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTAAAGAAAGAACCTGAGGATTCCAAATGCCTTTTATCTCCAGAAAAAGTCAAAGGCAAGGGGCCTTTTCCCATAGGCCCCTTATTTCAACATCGAGCTGAGAAGATTGTAATTACACGAAGTGACAGCGTACCAGATGAGAATGTACTGCAAATTACCATTACAGAAACAACAATTATTGAGTCAGACCTGGGGGTCTTCAATTCTCGAGCCCTTATCTACCTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATAA
  5   1   2      ests                               Xt7.1-TGas123h01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGTAGTTCTGGGATTAATTAGCCTAAAAAATGTAGCTGTTTCTTTTGCTGAAACTGTTAAAAGCTCAGCTCCAATATTTACCGTTATAATGTCCAGGCTCATATTGGGAGAGTACACTGGTATGATGGTGAACCTTTCCTTGCTACCAGTCATGGCTGGATTAGCTCTTTGCACAGCAACAGAACTCAGTTTCAACATAGTGGGCTTCTCAGCTGCGTTGTCAACCAACATAATGGACTGCTTGCAGAATGTCTTCTCAAAGAAACTTCTTAGTGGGGATAAATACAGATTTTCACCACCTGAGCTCCAGTTCTACACCAGCGCTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTTTACTTTTCAATACTGGATGATAATACAATATTTCCTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAATCATATTACTGTACATCTGTACTTTTTACACAACAGCTTAAAATCCTTGACAGTGATTTTTATTTTATCATTTATTTCAATTAGGCACATGTATCAATACAATTGATTTCATGTTTTTGTTTTTGTTTTTTTTTTTTGTATTTTTGACAGTGTTACAAAAGCCTTTATTACACTGCTTCTTCTCTAAGTACATGGTGTCCTCACAACATACCAGTACAAGTGATACTAAAAAAAAGGTCCATTTTTTTTCCTTTTTAAATAACATATCAGTATCACTTAAAACCTTACCGACAATTACTTTTCATTTAAAGCGGACCTGTCACCTTAAGAAATAATTTCAAATTGTTTTCTGTTGTGTTTGGCAAGCAAAATAAACTTTACTTACACTAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008231520                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTCTGGGATTAATTAGCCTAAAAAATGTAGCTGTTTCTTTTGCTGAAACTGTTAAAAGCTCAGCTCCAATATTTACCGTTATAATGTCCAGGCTCATATTGGGAGAGTACACTGGTATGATGGTGAACCTTTCCTTGCTACCAGTCATGGCTGGATTAGCTCTTTGCACAGCAACAGAACTCAGTTTCAACATAGTGGGCTTCTCAGCTGCGTTGTCAACCAACATAATGGACTGCTTGCAGAATGTCTTCTCAAAGAAACTTCTTAGTGGGGATAAATACAGATTTTCACCACCTGAGCTCCAGTTCTACACCAGCGCTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTTTACTTTTCAATACTGGATGATAATACAATATTTCCTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAATCATATTACTGTACATCTGTACTTTTTACACAACAGCTTAAAATCCTTGACAGTGATTTTTATTTTATCATTTATTTCAATTAGGCACATGTATCAATACAATTGATTTCATGTTTTTGTTTTTGTTTTTTTTTTTTGTATTTTTGACAGTGTTACAAAAGCCTTTATTACACTGCTTCTTCTCTAAGTACATGGTGTCCTCACAACATACCAGTACAAGTGATACTAAAAAAAAGGTCCATTTTTTTTCCTTTTTAAATAACATATCAGTATCACTTAAAACCTTACCGACAATTACTTTTCATTTAAAGCGGACCTGTCACCTTAAGAAATAATTTCAAATTGTTTTCTGTTGTGTTTGGCAAGCAAAATAAACTTTACTTACACTAAAAAAAAAA
  5   1   2       bld HdA       in                   THdA033a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCATATTGTGGTTTTTCTTTAGCTTCTGTACATTATTCCTTAATAAATATATACTTACATTACTTGAAGGAGAACCAAGCATGCTAGGTGCTGTCCAAATGCTGACTACAACTTTCATTGGCAGCATAAAGATGTTTATTCCCTGTTGTCTGTACCAGCATAAAACAAGGCTCAATTACCCTTCAAATTTCCTCATGATAATGCTGTTTGTGGGACTAATGAGGTTTGTGACTGTAGTTCTGGGATTAATTAGCCTAAAAAATGTAGCTGTTTCTTTTGCTGAAACTGTTAAAAGCTCAGCTCCAATATTTACCGTTATAATGTCCAGGCTCATATTGGGAGAGTACACTGGTATGATGGTGAACCTTTCCTTGCTACCAGTCATGGCTGGATTAGCTCTTTGCACAGCAACAGAACTCAGTTTCAACATAGTGGGCTTCTCAGCTGCGTTGTCAACCAACATAATGGACTGCTTGCAGAATGTCTTCTCAAAGAAACTTCTTAGTGGGGATAAATACAGATTTTCACCACCTGAGCTCCAGTTCTACACCAGCGCTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTTGGGGTCTGCTTTACAACAAGGCCAG
  3   1   2       bld Ova1 5g3  in                        CABE13275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGTAGTTCTGGGATTAATTAGCCTAAAAAATGTAGCTGTTTCTTTTGCTGAAACTGTTAAAAGCTCAGCTCCAATATTTACCGTTATAATGTCCAGGCTCATATTGGGAGAGTACACTGGTATGATGGTGAACCTTTCCTTGCTACCAGTCATGGCTGGATTAGCTCTTTGCACAGCAACAGAACTCAGTTTTAACATAGTGGGCTTCTCAGCTGCGTTGTCAACCAACATAATGGACTGCTTGCAGAATGTCTTCTCAAAGAAACTTCTTAGTGGGGATAAATACAGATTTTCACCACCTGAGCTCCAGTTCTACACCAGCGCTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAAT
  5   1   2       chi Egg                            TEgg127c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGGGCCCGGGGTGCGTCTGCAAAACTAGTCAGCTGGTGGGAGGATTGTCCTGTAAGGCCGGGTTGGCACTATACAAGCGTTCGTAAAGACACAGAGATGTAATCCATAAATTTCACCTGAGATTTGACTGAACATAAATCATTTTGTAAGGATGCTGAAGGGTCTTCTTGAAAGCTTTTCCATAATAACCTGACATTTTGCCACAGGCGGCACAGTTAACCTGAAAACAGATGCCATATTTTGGTCAGTCGAATGAAAATGCCATCTTCGGGATTTTTATGATGGATATGCCATTGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACA
  5  -1   2       bld Ova1      in                        CABE10594.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCGGTGCAGCAGTGATCATGTTAATACCAGCATGGATTTTTATGATGGATATGCCATGGATTGGAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTNTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCATTTATATTTG
  3   1   2       bld Ova1      in                        CABE10594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCATGGATTTTTATGATGGATATGCCATTGATTGAAAAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCCTTATACGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTTTACTTTTCAATACTGGATGATAATACAATATTTCCTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGC
  3   1   2       bld Gas7 5g3  in                         XZG33578.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGTGGAAAGTCATTTCATTACAACTGGGATATTATTGTTTTGCTTCTTATTGATGGAGTTCTGTTTCATCTACAAAGTATTACAGCATATGCCCTCATGGGAAAGATTTCTCCAGTAACTTTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGTAAGTAAACAAGACCAGAAATCCCATGAAAAGTAGTTAGGTTGCCAAGCTCATGGCCTCTCTTCACATACTGACATATATGGACCCAGATAAAATGACATCTGTACTTCAGAAGACAATCACAGTCACATTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGTGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTTTACTTTTCAATACTGGATGATAATACAATATTTCTTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAAAAAAAAGG
  3  -1   2       chi Ova1      out                        CABE7435.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCAGCGTTGCAAGCACTGTGAAGCATGCACTTTCTATATGGCTCAGTATTATTATTTTTGGGAATAAAATAACCAGCCTTTCAGCTGTCGGGACTGTACTAGTAATCATTGGGGTTCTGCTTTACAACAAGGCCAGGCAGCGCCAGAGAGAGATGATCCACATGTTGACTACAACAGGTACTGAAGAGATTGAACCAGttacaacttttgcgtattttctgtgactttttcgctcatttgcgcaactttttcataattcgcgtcaaaaagccaagtacgaaaatttcggatttattcaagcttcggtatcgtgactttccttgggccaagttggagctgcagagtgccattgagttctatgggaggcttccaaaatcatgcacacaaagatcaaagtcagcaaggttttcctgcattttccgatcattcaaatacggaaaaatcatacttttcggccattatacgaccagatAGGATTTTTACGTATTTTTAAATATTTTTTGTACTTATAAAAGCCCAGTACAGAAAAATCGTACTTTGATAAATCTGCCCCTTTAGTATTTATACCAAAGCAGTAACCTGCAATTTACAGCTAAGTACACACATGGATTAGTTTGGCCATGTCACTTGCTTAGTTTCAACCAAATAAGATCAGACTATGTTGTGATCACATCAGTTTCGCTTGCCAAGCTGAAAATCCAGTAAAACAGATGGCTCCCATCTTCATGTGGCCACATTGCAAAATATTTGACGTTTAGGACAACAAAAAAAGGTTTGTGTATGGGCAGCATAGGTTAATATTATTCTCTGTACTGATGACCAATATAAATAGGTTTGCTAT
  5   1   2       bld Neu                            TNeu139l24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTAAAGTAAACTTAATTCAAAAATACTCTTTGCACTGAGTAGTGCTTTATATGTCCATGATGTTTGAGTTATATGCTTAACAGCACTTCAATACCACTTAAATCTGCTATATGGATTCTGCTGACATTGAAGAAGAATTCTCTGACCAAACAAATATAAATGGAAGTGGAAGTGTGTACTTTTCAATACTGGATGAGAATACAATATTTCCTTTGAAAGAAAAATGTGAAATACAGAATTTGTAGATATTATGGTGTAACCCACGCATAAAATAAATAAAACAGGTTGTGCATTTTTGTGCAAAAAAAAGAATTATGGCGTAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACGTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGAGCTTTTATCTATCTCTATTATTTACTTTATTTGTAGTTTGTGTCTGCTACATGTCTGTGTTGTTATCCTATGTGATTTTTTTTAATACTTTTTTGGAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACT
  3   1   2       bld TbA  FL   in                    TTbA018g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTACTTTTCAATACTGGATGATAATACAATATTTCTTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACTCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAAAAAAAAGC
  3   1   2      seed Gas  5g3  in                    TGas123h01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTTTCAATACTGGATGATAATACAATATTTCCTTTGAAAGAAAAATGTTAAATACAGAATTTGTAGATATTATGGTATAACCCACGCATAAAATAAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACGTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTTAATACTTTTTTGGAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas139j24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGAATAAAACAGGTTGTACATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCAT
  5   1   2       bld Gas7                                 XZG59443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTTTTGTGCAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACCTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTAATACTTTTTTGGAAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTATCCCGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGATTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAAAATGATCATT
  3   1   2       bld TpA       out                  TTpA078f14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAAAAAAGAATTATGGCATAAAAGAAAAATTAGACCTGGGCCAGTTTCTTAGTAAAGGACGTACCACTACGTTTCAGTGCAAATTACAATGCAAAACCAGTGACTATACATGATCTTTTATCTATCTCTATTATTTACTTTAGTTTGTAGTTTGTGTCTGCTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTTAATACTTTTTTGGAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAGAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu110a05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTACATGTCTGTTTTGTTATCCTATGTTATTTTTTTTAATACTTTTTTTGGAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTTTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCTCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAATCATATTACTGTACATCTGTACTTTTTACACAACAGCTTAAAATCCTTGACAGTGATTTTTATTTTATCATTTATTTCAATTAGGCACATGTATCAATACAATTGATTTCATGTTAAAAAACAAACTCAAAAAAAGAAAAAAATGAAAAAAAAAAAANAAAAAA
  5   1   2       bld Neu       in                   TNeu110a05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCATGTCTGTTTTGTTATCCTATGTTATTTTTTTTAATACTTTTTTTGGAAAAAAAAATTCTACTGGGAGGATCTGCATTTTGCTATATTCAGCAGACATAGCACACAATCAAAGACTGTATTCTCAGCCATGGGTATTAGTAAACTAGCCTGGCCTACAGAAAAATGAAGACCATAAGAGGAAAAATCTATACTAAGTAACTGAAAAGGCTGGGTCATTAAGGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCTCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAA
  3   1   2       bld HdA       in                    THdA033a09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGCAAGGCTGTGTGACATTGCAGAACCACAGGCATAAACAGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAATCATATTACTGTACATCTGTACTTTTTACACAACAGCTTAAAATCCTTGACAGTGATTTTTATTTTATCATTTATTTCAATTAGGCACATGTATCAATACAATTGATTTCATGTTTTTGTTTTTGTTTTTTTTTTTTGTATTTTTGACAGTGTTACAAAAGCCTTTATTACACTGCTTCTTCTCTAAGTACATGGTGTCCTCACAACATACCAGTACAAGTGATACTAAAAAAAAGGTCCATTTTTTTTCCTTTTTAAATAACATATCAGTATCACTTAAAACCTTACCGACAATTACTTTTCAtttaaagcggacctgtcaccttaagaaataatttcaaattgttttctgttgtgtttggcaagcaaaataaactttacttacactAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TbA       ?                     TTbA029i08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTTGCCCATTAATAAGTGTGCCATGTCTGTGCATCACGGTTTTGAATTAGTCTTAATATGTAGGCAGATCACACTGACCACCCCATTTGTATTGCGGTAGCCGTCATTGACATTTTTTTGGACCATGTTGTTACTTTTAAAAACTGAGGTTGTTCCATGTCCCATTTGACTGTTCTGTTGATAGTATTTGTAGATAAGCATTAGTTTATAGGCTATACATTAAAGATCTTTAGGACTTACAACAAATTGGAAAGGTAAATGTATTTTTATTTTTTTAATTGAATACACTAAATAAGGCTTAATTCAAGGACACCGTGCAAACCAGAATGATCATTAAAAAAAAAAATCATATTACTGTACATCTGTACTTTTTACACAACAGCTTAAAATCCTTGACAGTGATTTTTATTTTATCATTTATTTCAATTAGGCACATGTATCAATACAATTGATTTCATGTTTTTGTTTTTGTTTTTTTTTTTTGTATTTTTGACAGTGTTACAAAAGCCTTTATTACACTGCTTCTTCTCTAAGTACATGGTGTCCTCACAACATACCAGTACAAGTGATACTAAAAAAAAGGTCCATTTTTTTTCCTTTTTAAATAACATATCAGTATCACTTAAAACCTTACCGACAATTACTTTTCAtttaaagcggacctgtcaccttaagaaataatttcaaattgttttctgttgtgtttggcaagcaaaataaactttacttacactAAAAAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)