Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012155650 Xt7.1-EC2BBA26AC09.3.5 - 15 ESTs
                                                                       ..-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                Xt7.1-EC2BBA26AC09.3.5                                                                                                                                                                                                                               ACCGGCTGGATCCAGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTGCATTTGAGGCCGATTTGCACCTGCCCCCCAAGCTGAGGAGACTGTATGGCCCTGTGGGGGGCAGTGGCAGGATACACCTCCAGGCTGTTGCTGATGCCAGATCGGGGGTACCTCGTTCAGAAAAGACTGATCGCATTTTACTTTTGGGGGGAGCAGGGGAAAATACCTGGGACAATCACAGTCTAAAGATCAGCCAGGCCCCACAGGTCAGCATCAGCCGCAGCAAGTCCTACAGGGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGTCCAGAGGGTCTCCTGCAACAGTCGCAGCAGCAGATCCAGACCAGTGCAACCACCGCATGTACCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCAAACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGAACTCATGCTGCACTCCTCAGATGCTGATGGCAAAGACGGAGAGGATAGTGTGTGTCTGTCTGCGGGCAGCGACTCTGAGGAGGGCATGCTAAAGCGCAAGCAGCGGAGGTACCGCACCACCTTTACCAGTTACCAACTGGAGGAGCTGGAGAGGGCCTTCCAGAAAACTCACTATCCTGATGTCTTCACCAGAGAGGAGCTAGCGATGCGCCTGGATCTGACAGAGGCCAGAGTGCAGGTTTGGTTCCAGAATCGCAGGGCGAAATGGAGAAAGAGGGAAAAGGCAGGAGCTCAGACACACGCTCCGGGTCTCCCTTTCCCCGGGCCCCTGTCAGCCAGTCACCCCTTGGGCCCCTACCTGGATGCCAGCCCCTTCCCTCCCCACCATCCTGCGTTGGACTCTGCTTGGACCGCTGCAGCCGCCGCAGCCGCCGCTGCCTTCCCCAGTCTGCCTCCCCCACCGCACGGCTCTGCAGCTCTGCCTCCCAGTGGCTCTCCGCTAGGGCTCAGCACCTTCCTGGGGGCAGCAGTGTTTCGGCACCCAGCCTTCATCAGCCCGGCCTTCGGCAGACTTTTCTCCACTATGGCTCCTTTAACCAGTGCTTCCACCGCTGCAGCTCTCCTTAGACAGCCCAGTCCTGCAGTGGAGAGCTCAGTGCAATCGAGTGGGCTCTCAGACCCAGTCACAGCTGCAGCTGACAGAAGGGCCTCCAGTATAGCAGCTCTCAGGCTAAAAGCTAAGGAGCACGCGGCTCAGCTCACACAGCTCAACATCATCCCTGGAAACAGCGCCGGGAAAGAGGTGTGCTGAGCCGAGGGAGCCCTACCAACACCCCTACCGAGACCAAATGGAATGGAAGCAAATCCAATATGGACCAGTGACTGTCGGACCCTGGGTGTCCTGCTCGAAGATTCAGATTATCCCTGTCAGTCCAGACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGCCCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAAGTGTTCCCCACTCAGAATAAAAAAAAAAATCTATATGTTTT
                                                  Xt7.1-CHK-1008266778                                                                                                                                                                                                                                     TGGATCCAGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTGCATTTGAGGCCGATTTGCACCTGCCCCCCAAGCTGAGGAGACTGTATGGCCCTGTGGGGGGCAGTGGCAGGATACACCTCCAGGCTGTTGCTGATGCCAGATCGGGGGTACCTCGTTCAGAAAAGACTGATCGCATTTTACTTTTGGGGGGAGCAGGGGAAAATACCTGGGACAATCACAGTCTAAAGATCAGCCAGGCCCCACAGGTCAGCATCAGCCGCAGCAAGTCCTACAGGGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGTCCAGAGGGTCTCCTGCAACAGTCGCAGCAGCAGATCCAGACCAGTGCAACCACCGCATGTACCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCAAACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGAACTCATGCTGCACTCCTCAGATGCTGATGGCAAAGACGGAGAGGATAGTGTGTGTCTGTCTGCGGGCAGCGACTCTGAGGAGGGCATGCTAAAGCGCAAGCAGCGGAGGTACCGCACCACCTTTACCAGTTACCAACTGGAGGAGCTGGAGAGGGCCTTCCAGAAAACTCACTATCCTGATGTCTTCACCAGAGAGGAGCTAGCGATGCGCCTGGATCTGACAGAGGCCAGAGTGCAGGTTTGGTTCCAGAATCGCAGGGCGAAATGGAGAAAGAGGGAAAAGGCAGGAGCTCAGACACACGCTCCGGGTCTCCCTTTCCCCGGGCCCCTGTCAGCCAGTCACCCCTTGGGCCCCTACCTGGATGCCAGCCCCTTCCCTCCCCACCATCCTGCGTTGGACTCTGCTTGGACCGCTGCAGCCGCCGCAGCCGCCGCTGCCTTCCCCAGTCTGCCTCCCCCACCGCACGGCTCTGCAGCTCTGCCTCCCAGTGGCTCTCCGCTAGGGCTCAGCACCTTCCTGGGGGCAGCAGTGTTTCGGCACCCAGCCTTCATCAGCCCGGCCTTCGGCAGACTTTTCTCCACTATGGCTCCTTTAACCAGTGCTTCCACCGCTGCAGCTCTCCTTAGACAGCCCAGTCCTGCAGTGGAGAGCTCAGTGCAATCGAGTGGGCTCTCAGACCCAGTCACAGCTGCAGCTGACAGAAGGGCCTCCAGTATAGCAGCTCTCAGGCTAAAAGCTAAGGAGCACGCGGCTCAGCTCACACAGCTCAACATCATCCCTGGAAACAGCGCCGGGAAAGAGGTGTGCTGAGCCGAGGGAGCCCTACCAACACCCCTACCGAGACCAAATGGAATGGAAGCAAATCCAATATGGACCAGTGACTGTCGGACCCTGGGTGTCCTGCTCGAAGATTCAGATTATCCCTGTCAGTCCAGACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAAGTGTTCCCCACTCAGAATAAAAAAAAAAATCTATA
                                                      consensus depths                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     3     2     3     3     3     3     3     3     3     2     2     2     2     2     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     3     5     3     6     4     6     4     6     4     7     4     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     3     4     3     3     2     2     2     2
  5   1   2      ests                                Xt7.1-CAAN10694.5 ACTGATGTGCTGGGATCCTCTCCCTCCCTCCCACTCACCCAGCCGGCAGCCGGCCACTAGCAGCCATGAGCTCTCACTACCCAGAGGAGACTTCTGAGAGGCCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGCATAGACAGCATCCTGGGCAGGAGGAGCCCCTGCAAGATGAGACTGCTGGGCGCCCAGAGCCTGCCCTCCCTGGCACACCGGCTGGATCCAGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTGCATTTGAGGCCGATTTGCACCTGCCCCCCAAGCTGAGGAGACTGTATGGCCCTGTGGGGGGCAGTGGCAGGATACACCTCCAGGCTGTTGCTGATGCCAGATCGGGGGTACCTCGTTCAGAAAAGACTGATCGCATTTTACTTTTGGGGGGAGCAGGGGAAAATACCTGGGACAATCACAGTCTAAAGATCAGCCAGGCCCCACAGGTCAGCATCAGCCGCAGCAAGTCCTACAGGGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGTCCAGAGGGTCTCCTGCAACAGTCGCAGCAGCAGATCCAGACCAGTGCAACCACCGCATGTACCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCAAACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGAACTCATGCTGCACTCCTCAGATGCTGATGGCAAAGACGGAGAGGATAGTGTGTGTCTGTCTGCGGGCAGCGACTCTGAGGAGGGCATGCTAAAGCGCAAGCAGCGGAGGTACCGCACCACCTTTACCAGTTACCAACTGGAGGAGCTGGAGAGGGCCTTCCAGAAAACTCACTATCCTGATGTCTTCACCAGAGAGGAGCTAGCGATGCGCCTGGATCTGACAGAGGCCAGAGTGCAGGTTTGGTTCCAGAATCGCAGGGCGAAATGGAGAAAGAGGGAAAAGGCAGGAGCTCAGACACACGCTCCGGGTCTCCCTTTCCCCGGGCCCCTGTCAGCCAGTCACCCCTTGGGCCCCTACCTGGATGCCAGCCCCTTCCCTCCCCACCATCCTGCGTTGGACTCTGCTTGGACCGCTGCAGCCGCCGCAGCCGCCGCTGCCTTCCCAGTCTGCCTCC
  5   1   2      ests                             Xt7.1-EC2BBA26AC09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCAACATCATCCCTGGAAACAGCGCCGGGAAAGAGGTGTGCTGAGCCGAGGGAGCCCTACCAACACCCCTACCGAGACCAAATGGAATGGAAGCAAATCCAATATGGACCAGTGACTGTCGGACCCTGGGTGTCCTGCTCGAAGATTCAGATTATCCCTGTCAGTCCAGACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAAGTGTTCCCCACTCAGAATAAAAAAAAAAATCTA
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Sc ---- 4e-009     NP_010177.1 Regulation of phosphate metabolism; Pho2p [Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Br ==== 1e-023     ABD62780.1 Rx homeobox protein [Branchiostoma lanceolatum] =========================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bb ---- 4e-028     ABK54280.1 Pax3/7 [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---= 3e-028     NP_509860.1 aristaless (XL742) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 5e-031     AAF89581.1 paired-box transcription factor [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 8e-036     BAE06312.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 3e-036     NP_788420.1 CG33152-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 7e-038     XP_001199761.1 PREDICTED: similar to homeobox [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 3e-055     XP_001235424.1 PREDICTED: similar to aristaless-related homeobox [Gallus gallus] -----------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 2e-119     XP_687171.1 PREDICTED: similar to Arx homeoprotein [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                               PROTEIN --- Hs ---- 3e-171     NP_620689.1 aristaless related homeobox [Homo sapiens] ----------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                               PROTEIN --- Mm ---- 3e-171     NP_031518.2 aristaless related homeobox gene [Mus musculus] -----------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN --- Xl ---- 0          AAS91656.1 aristaless-related homeobox 2 [Xenopus laevis] ----------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN --- ?? ---- 0          NP_001086450.1 aristaless-related homeobox 2 [Xenopus laevis] ------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                Xt7.1-EC2BBA26AC09.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------TAG---------------------ATG---------------TAA------------------------------------------ATG------------------ATG------------------TAA---------------------------------------------------------------TGAATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TAA---TAATAATAATAATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TAG------------------------ATG------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2      ests                                Xt7.1-CAAN10694.5 ACTGATGTGCTGGGATCCTCTCCCTCCCTCCCACTCACCCAGCCGGCAGCCGGCCACTAGCAGCCATGAGCTCTCACTACCCAGAGGAGACTTCTGAGAGGCCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGCATAGACAGCATCCTGGGCAGGAGGAGCCCCTGCAAGATGAGACTGCTGGGCGCCCAGAGCCTGCCCTCCCTGGCACACCGGCTGGATCCAGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTGCATTTGAGGCCGATTTGCACCTGCCCCCCAAGCTGAGGAGACTGTATGGCCCTGTGGGGGGCAGTGGCAGGATACACCTCCAGGCTGTTGCTGATGCCAGATCGGGGGTACCTCGTTCAGAAAAGACTGATCGCATTTTACTTTTGGGGGGAGCAGGGGAAAATACCTGGGACAATCACAGTCTAAAGATCAGCCAGGCCCCACAGGTCAGCATCAGCCGCAGCAAGTCCTACAGGGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGTCCAGAGGGTCTCCTGCAACAGTCGCAGCAGCAGATCCAGACCAGTGCAACCACCGCATGTACCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCAAACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGAACTCATGCTGCACTCCTCAGATGCTGATGGCAAAGACGGAGAGGATAGTGTGTGTCTGTCTGCGGGCAGCGACTCTGAGGAGGGCATGCTAAAGCGCAAGCAGCGGAGGTACCGCACCACCTTTACCAGTTACCAACTGGAGGAGCTGGAGAGGGCCTTCCAGAAAACTCACTATCCTGATGTCTTCACCAGAGAGGAGCTAGCGATGCGCCTGGATCTGACAGAGGCCAGAGTGCAGGTTTGGTTCCAGAATCGCAGGGCGAAATGGAGAAAGAGGGAAAAGGCAGGAGCTCAGACACACGCTCCGGGTCTCCCTTTCCCCGGGCCCCTGTCAGCCAGTCACCCCTTGGGCCCCTACCTGGATGCCAGCCCCTTCCCTCCCCACCATCCTGCGTTGGACTCTGCTTGGACCGCTGCAGCCGCCGCAGCCGCCGCTGCCTTCCCAGTCTGCCTCC
                                                  Xt7.1-CHK-1008244934       GTGCTGGGATCCTCTCCCTCCCTCCCACTCACCCAGCCGGCAGCCGGCCACTAGCAGCCATGAGCTCTCACTACCCAGAGGAGACTTCTGAGAGGCCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGCATAGACAGCATCCTGGGCAGGAGGAGCCCCTGCAAGATGAGACTGCTGGGCGCCCAGAGCCTGCCCTCCCTGGCACACCGGCTGGATCCAGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTGCATTTGAGGCCGATTTGCACCTGCCCCCCAAGCTGAGGAGACTGTATGGCCCTGTGGGGGGCAGTGGCAGGATACACCTCCAGGCTGTTGCTGATGCCAGATCGGGGGTACCTCGTTCAGAAAAGACTGATCGCATTTTACTTTTGGGGGGAGCAGGGGAAAATACCTGGGACAATCACAGTCTAAAGATCAGCCAGGCCCCACAGGTCAGCATCAGCCGCAGCAAGTCCTACAGGGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGTCCAGAGGGTCTCCTGCAACAGTCGCAGCAGCAGATCCAGACCAGTGCAACCACCGCATGTACCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCAAACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGAACTCATGCTGCACTCCTCAGATGCTGATGGCAAAGACGGAGAGGATAGTGTGTGTCTGTCTGCGGGCAGCGACTCTGAGGAGGGCATGCTAAAGCGCAAGCAGCGGAGGTACCGCACCACCTTTACCAGTTACCAACTGGAGGAGCTGGAGAGGGCCTTCCAGAAAACTCACTATCCTGATGTCTTCACCAGAGAGGAGCTAGCGATGCGCCTGGATCTGACAGAGGCCAGAGTGCAGGTTTGGTTCCAGAATCGCAGGGCGAAATGGAGAAAGAGGGAAAAGGCAGGAGCTCAGACACACGCTCCGGGTCTCCCTTTCCCCGGGCCCCTGTCAGCCAGTCACCCCTTGGGCCCCTACCTGGATGCCAGCCCCTTCCCTCCCCACCATCCTGCGTTGGACTCTGCTTGGACCGCTGCAGCCGCCGCAGCCGCCGCTGCCTTCCCAGTCT
  5   1   2       bld Brn2      in                        CAAJ16743.5p ACTGATGTGCTGGGATCCTCTCCCTCCCTCCCACTCACCCAGCCGGCAGCCGGCCACTAGCAGCCATGAGCTCTCACTACCCAGAGGAGACTTCTGAGAGGCCGGAATGTAAAAGTAAATCTCCCACCCTGCTCTCTTCCTACTGCATAGACAGCATCCTGGGCAGGAGGAGCCCCTGCAAGATGAGACTGCTGGGCGCCCAGAGCCTGCCCTCCCTGGCACACCGGCTGGATCCAGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTGCATTTGAGGCCGATTTGCACCTGCCCCCCAAGCTGAGGAGACTGTATGGCCCTGTGGGGGGCAGTGGCAGGATACACCTCCAGGCTGTTGCTGATGCCAGATCGGGGGTACCTCGTTCAGAAAAGACTGATCGCATTTTACTTTTGGGGGGAGCAGGGGAAAATACCTGGGACAATCACAGTCTAAAGATCAGCCAGGCCCCACAGGTCAGCATCAGCCGCAGCAAGTCCTACAGGGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGTCCAGAGGGTCTCCTGCAACAGTCGCAGCAGCAGATCCAGACCAGTGCAACCACCGCATGTACCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCANACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGGACTCATGCTGCA
  5   1   2      seed Brn4      in                        CAAL22105.5p                                                                                                                                                                                                                               ACCGGCTGGATCCAGACAAAACTTTGGAAGGGTCACCTAAGGGCAATGCTGCATTTGAGGCCGATTTGCACCTGCCCCCCAAGCTGAGGAGACTGTATGGCCCTGTGGGGGGCAGTGGCAGGATACACCTCCAGGCTGTTGCTGATGCCAGATCGGGGGTACCTCGTTCAGAAAAGACTGATCGCATTTTACTTTTGGGGGGAGCAGGGGAAAATACCTGGGACAATCACAGTCTAAAGATCAGCCAGGCCCCACAGGTCAGCATCAGCCGCAGCAAGTCCTACAGGGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGTCCAGAGGGTCTCCTGCAACAGTCGCAGCAGCAGATCCAGACCAGTGCAACCACCGCATGTACCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCAAACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGAACTCATGCTGCACTCCTCAGATGCTGATGGCAAAGACGGAGAGGATAGTGTGTGTCTGTCTGCGGGCAGCGACTCTGAGGAGGGCATGCTAAAGCGCAAGCAGCGGAGGTACCGCACCACCTTTACCAGTTACCAACTGGAGGAGCTGGAGAGGGCCTTCCAGAAAACTCACTATCCTGATGTCTT
  5   1   2       bld Te4       in                        CAAN10694.5p                                                                                                                                                                                                                                                                                                                                                                                            GGTACCTCGTTCAGAAAAGACTGATCGCATTTTACTTTTGGGGGGAGCAGGGGAAAATACCTGGGACAATCACAGTCTAAAGATCAGCCAGGCCCCACAGGTCAGCATCAGCCGCAGCAAGTCCTACAGGGAGAACAGCGCCCCCCTGCTGCGAGAGGAGCACAGTCCAGAGGGTCTCCTGCAACAGTCGCAGCAGCAGATCCAGACCAGTGCAACCACCGCATGTACCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCAAACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGAACTCATGCTGCACTCCTCAGATGCTGATGGCAAAGACGGAGAGGATAGTGTGTGTCTGTCTGCGGGCAGCGACTCTGAGGAGGGCATGCTAAAGCGCAAGCAGCGGAGGTACCGCACCACCTTTACCAGTTACCAACTGGAGGAGCTGGAGAGGGCCTTCCAGAAAACTCACTATCCTGATGTCTTCACCAGAGAGGAGCTAGCGATGCGCCTGGATCTGACAGAGGCCAGAGTGCAGGTTTGGTTCCAGAATCGCAGGGCGAAATGGAGAAAGAGGGAAAAGGCAGGAGCTCAGACACACGCTCCGGGTCTCCCTTTCCCGGGCCCCTGTCAGCCAGTCACCCCTTGGGCCCCTACCTGGATGCCAGGCCCCTTCCCTCCCCCACATCCTGCGNTGGACTCTGCTTGG
  5   1   2       bld Gas8      in                          st12f12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCCTTACAGGACAGACTCGGGGCCCTTTCCCAGAGTCCCAGGGATGAGGATGATGACGATGAGGAGGACGAGGACGAGGAAGAGGAGGAGGAAGAAGAAGACGAAGCAAACAAACAGCATAACCCCAATAACTCCAGCAACCCCAACAGGGCGCATCTACAAGAGCAGCAGCACCCACAGTTCCAGTCGCAGCAGTCGCAGCAGCAGCAGCCTCCCCCCGGGTGCGGCACTGACGCAGAGCTGTCCCCTAAGGAGGAACTCATGCTGCACTCCTCAGATGCTGATGGCAAAGACGGAGAGGATAGTGTGTGTCTGTCTGCGGGCAGCGACTCGGAGGAGGGCATGCTAAAGCGCAAGCAGCGGAGGTACCGCACCACCTTTACCAGTTACCAACTGGAGGAGCTGGAGAGGGCCTTCCAGAAAACTCACTATCCTGATGTCTTCACCAGAGAGGAGCTAGCGATGCGCCTGGATCTGACAGAGGCCAGAGTGCAGGTTTGGTTCCAGAATCGCAGGGCGAAATGGAGAAAGAGGGAAAAGGCAGGAGCTCAGACACACGCTCCGGGTCTCCCTTTCCCCGGGCCCCTGTCAGCCAGTCACCCCTTGGGCCCCTACCTGGATGCCAGCCCCTTCCCTCCCCACCATCCTGCGTTGGACTCTGCTTGGACCGCTGCAGCCGCCGCAGCCGCCGCTGCCTTCCCAGTCTGCCTCCCCC
  5   1   2      ests                             Xt7.1-EC2BBA26AC09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCAACATCATCCCTGGAAACAGCGCCGGGAAAGAGGTGTGCTGAGCCGAGGGAGCCCTACCAACACCCCTACCGAGACCAAATGGAATGGAAGCAAATCCAATATGGACCAGTGACTGTCGGACCCTGGGTGTCCTGCTCGAAGATTCAGATTATCCCTGTCAGTCCAGACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAAGTGTTCCCCACTCAGAATAAAAAAAAAAATCTA
                                                  Xt7.1-CHK-1008235389                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCATCCCTGGAAACAGCGCCGGGAAAGAGGTGTGCTGAGCCGAGGGAGCCCTACCAACACCCCTACCGAGACCAAATGGAATGGAAGCAAATCCAATATGGACCAGTGACTGTCGGACCCTGGGTGTCCTGCTCGAAGATTCAGATTATCCCTGTCAGTCCAGACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCxxxCCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAAGTGTTCCCCACTCAGAATAAAAAAAAAAATCTATATGTT
  3   1   2       bld Brn4      in                        CAAL22105.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCAGCCAGTCACCCCTTGGGCCCCTACCTGGATGCCAGCCCCTTCCCTCCCCACCATCCTGCGTTGGACTCTGCTTGGACCGCTGCAGCCGCCGCAGCCGCCGCTGCCTTCCCCAGTCTGCCTCCCCCACCGCACGGCTCTGCAGCTCTGCCTCCCAGTGGCTCTCCGCTAGGGCTCAGCACCTTCCTGGGGGCAGCAGTGTTTCGGCACCCAGCCTTCATCAGCCCGGCCTTCGGCAGACTTTTCTCCACTATGGCTCCTTTAACCAGTGCTTCCACCGCTGCAGCTCTCCTTAGACAGCCCAGTCCTGCAGTGGAGAGCTCAGTGCAATCGAGTGGGCTCTCAGACCCAGTCACAGCTGCAGCTGACAGAAGGGCCTCCAGTATAGCAGCTCTCAGGCTAAAAGCTAAGGAGCACGCGGCTCAGCTCACACAGCTCAACATCATCCCTGGAAACAGCGCCGGGAAAGAGGTGTGCTGAGCCGAGGGAGCCCTACCAACACCCCTACCGAGACCAAATGGAATGGAAGCAAATCCAATATGGACCAGTGACTGTCGGACCCTGGGTGTCCTGCTCGAAGATTCAGATTATCCTTGTCAGTCCAGACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTC
  5   1   2       bld Brn4      in                        CAAL19307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACGCGGCTCAGCTCACACAGCTCAACATCATCCCTAAAACAGCGCCGGGAAAGAGGTGTGCTGAGCCGAGGGAGCCCTACCAACACCCCTACCGAGACCAAATGGAATGGAAGCAAATCCAATATGGACCAGTGACTGTCGGACCCTGGGTGTCCTGCTCGAAGATTCAGATTATCCTTGTCAGTCCAGACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTT
  5   1   2       bld BrSp      in                     EC2BBA26AC09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACACAGCTCAACATCATCCCTGGAAACAGCGCCGGGAAAGAGGTGTGCTGAGCCGAGGGAGCCCTACCAACACCCCTACCGAGACCAAATGGAATGGAAGCAAATCCAATATGGACCAGTGACTGTCGGACCCTGGGTGTCCTGCTCGAAGATTCAGATTATCCCTGTCAGTCCAGACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATT
  5   1   2       bld Brn4                                CAAL10854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACACTGGATGCCTTGCAGTAATAATGAGTGTAATGTTTATGCAGATATTGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAAAGTCAGTGCACTTAAAAAATCCGAGGATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACCAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGGGATTATTGCTCCTGGATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCT
  3   1   2       bld BrSp      in                     EC2BBA26AC09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTCAGCATAGCCTTGGCTTATAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGA
  5   1   2       bld Tad5      in                         XZT10938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCGGCTTAAGTCAGGAGTAAATCCCTTACAAATGTGCACACTGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGCTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAAC
  3   1   2       bld Brn2      in                        CAAJ16743.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCATATTTAACACAAAATATTCATTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGTTTAACCGCACTGCCAATCCTCAGACCCCCCCCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAAGTGTTCCCCACTCAGAAT
  3   1   2       bld Te4       in                        CAAN10694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTAAAAAAAAAAGCATCCTCCTTTTGGTTATGCATAGGGTCCTTATTCACATGGAACATTCCCTCAATGTTTAACCGCACTGCCAATCTTCAGACCCCCCCCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAAGTGTTCCCCACTCAGAATAAAAAAAAAAATCTATATGTTTTAAC
  3   1   2      seed Tad5      in                         XZT10938.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCTCAGACCCCCCCCCCAGTCTGGAATTGGATCTGCTATGGGTTACACACTGAATGAATGGACGCAGACATAAACCCAGGCGGAAAAGAGAGTCAGTGCACTTAAAAGATCCGAGTATCTTTTTCTTTCTCTTGATTTCTTTGTCCAACACGAACCAAGGTTGTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACAGACTGTTTGAGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGCTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAGAGTGTTCCCCACT
  3   1   2       bld Gas8      in                          st12f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAAAAGNTCCGGGNNTNTTTTTNTTGNNTTNTTTGTCCNACCCGNACCNAGGNTGNTTTTTTTTTTATACCAAACCAAAGGGAAACGAACTGTCAGATTAACNGACTGTTTGAGTCNCTAAACTGTGATTATTGCTCCTGTATATAACNTTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCNCTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCCCAAGGTTCCTAGCNGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACNGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCNCCATGTCACATGGAAAAAG
  3   1   2       bld Brn4      in                        CAAL19307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTCACTAAACTGTGATTATTGCTCCTGTATATAACATTGTTATTAAAAATAATAATAATAATAATTAAGGAAAAAGAGCTTTGTATATTGGAAATGTTATAAAAAGAATTGCACTCAGTGTAGTGTTGTAAAAGTTTGTCAACCTGTAGGGTTATATCTGTGTTGTAGATACCACAAGGTTCCTAGCAGAAATATTTATGTACAAGCCCTTTATTTAACTTATTAACTGTAGAGGTTTTCTCAGACCTTTAAATCGATGCTACCGTACTTGTGTAATGTTGTTGATTGTCGGCACTTTTCCCACCATGTCACATGGAAAAAGTGTTCCCCACTCAGAATAAAAAAAAAAATCTATATGTTTTAACAAATCGAGAGTCTGTTAAATGTATAGGAGCCATAGGAGAAGAGGCGAGTATGGAGGCAACACTTCAGTATGCATGGGAAATGGATAGAATATGAGTCTATCCTATTATTATTATTTAAGAGCATCTAAACTCCAAAAACTGTCCAGAAACCGATGCTTTTTATATATAATGTTCATGAACATGACGGGAGGAACAGGAGCTTCTCTGTCTGTAAAGATCCAGGATGAAGATCCATATTTCATTGGGTCTTTGACCATCAATCTAATGATAACTTTGCCAGTCATGAGCGGAAAAAGCTTGCCCAGTAAAGAACCTTCAGCAACCCAGATAACTGGGAGCATGTGCAGAACCACTGACACCAGGGAGAGGGCGGAGCAAGATCAGGATGATATGGAGCTACAACACCGAATCCTCAGTGGGAGTTTAGATCTCTTTTAATATTACCTTAATATGTTTAATAAAAAGAAATCAAACCCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)