Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK12616.3                           4 END     1           3       25                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012155688 Xt7.1-XZG3340.5.5 - 31 ESTs
                                                                       -640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-XZG3340.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGCCGGTCCAGTAGCACGTTAGGAAGCTTGTGAGGAGATTATAGTATGAAAGAGTGCGGCCGAAAAGCGTGATTTCCCCGCTGCTGCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTGAGCCACTACAAGTACCCAATCGTGGAGCAGTATCTGAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTAATTTGCCGGGTGGTGACGCTAATCATCGTATTCACGGCGTGTATCTACCTGGGCTATTATATCAGCCTCTTCTCTCTGACGGACGAGTTCACCTGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGCTGGTTCCCTTCAGGAAAACCGCCAATGTGCTCAAGGTGTATGAGGTGCTACCAACCTTCAGTGTCCAACAGGCTCCGTCCAAAACCTACGATGACCACAGCCTGTTCCTTCTGTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCGTTTAAATGCACGTCTGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATTGTGCCCTCTGATTTGATGCTGATTCTCCCCCCGTTTTACACCAGTGTATAAATGCTATAGTGTTTTGATCCAGCGCCCGTATGGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATCTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTGAAAGACAAGGTCCGCTCATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGACACACCCTGACACCTTTGGTACCGACTCATTGGGTTGGACTAAAATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCGGGTTTCCTAATCTTCCAGCTCTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAACAAAACCTGAAGCGTTATTTCATTTGTTTCATGGAGCTGGCGTATGCTTTCAGAGCTAAGGAATGCAGCTCTAATCTTTATCTCCTTATAGTGGATTTACGAGGATGTGTCTGACGCAGTAGGAGGTTTCCTGGCCGTGGGGAAGGGGTACACCCTTGGGAAAG
                                                  Xt7.1-CHK-1008267065                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGxCCAGTAGCACGTTAGGAAGCTTGTGAGGAGATTATAGTATGAAAGAGTGCGGCxGxxAAGCGTGATTTCCCCGCTGCxxCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTGAGCCACTACAAGTACCCAATCGTGGAGCAGTATCTGAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTAATTTGCCGGGTGGTGACGCTAATCATCGTATTCACGGCGTGTATCTACCTGGGCTATTATATCAGCCTCTTCTCTCTGACGGACGAGTTCACCTGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGCTGGTTCCCTTCAGGAAAACCGCCAATGTGCTCAAGGTGTATGAGGTGCTACCAACCTTCAGTGTCCAACAGGCTCCGTCCAAAACCTACGATGACCACAGCCTGTTCCTTCTGTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCGTTTAAATGCACGTCTGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATTGTGCCCTCTGATTTGATGCTGATTCTCCCCCCGTTTTACACCAGTGTATAAATGCTATAGTGTTTTGATCCAGCGCCCGTATGGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATCTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTGAAAGACAAGGTCCGCTCATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGACACACCCTGACACCTTTGGTACCGACTCATTGGGTTGGACTAAAATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCGGGTTTCCTAATCTTCCAGCTCTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAACAAAACCTGAAGCGTTATTTCATTTGTTTCATGGAGCTGGCGTATGCTTTCAGAGCTAAGGAATGCAGCTCTAATCTTTATCTCCTTATAGTGGATTTACGAGGATGTGTCTGACGCAGTAGGAGGTTTCCTGGCCGTGGGGAAGGGGTACACCCTTGGGAAAGGGCCAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      2     8     3    10     3    10     3    10     3    10     4    11     4    11     6    11     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     7     8     7     8     7     8     6     7     4     6     4     6     3     5     3     5     3     4     3     4     3     4     3     4     2     3     1     2     1     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8    10     8    10     9    10     6    10     6    10     6    10     6     9     6     9     5     9     5     9     5     9     5     9     5     8     5     8     5     8     5     8     5     8     4     8     4     7     4     7     4     7     5     8     4     7     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     3     3     3     3     3     4     3     4     3     4     3     4     2     3     2     3     2     3     3     3     4     4     4     4     4     4     4     4     4     4     5     6     5     6     5     6     5     6     5     6     3     6     3     6     3     6     3     5     3     5     4     6     4     7     5     8     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
  5   1   2      ests                                 Xt7.1-CAAN4814.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGCCGGTCCAGTAGCACGTTAGGAAGCTTGTGAGGAGATTATAGTATGAAAGAGTGCGGCCGAAAAGCGTGATTTCCCCGCTGCTGCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTGAGCCACTACAAGTACCCAATCGTGGAGCAGTATCTGAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTAATTTGC
  5   1   2      ests                                  Xt7.1-XZG3340.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCACCTGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGCTGGTTCCCTTCAGGAAAACCGCTAATGTGCTCAAGGTTTATGAGGTGCTACCAACCTTCAGTGTCCAACAGGCTCCGTCCAAAACCTACGATGACCACAGCCTGTTCCTTCTGTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCATTTAAATGCACGTCTGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATTGTGCCCTCTGATTTGATGCTGATTCTCCCCCCGTTTTACACCAGTGTATAAATGCTATAGTGTTTTGATCCAGCGCCCGTATGGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATCTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTGAAAGACAAGGTCCGCTCATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGACACACCCTGACACCTTTGGTACCGACTCATTGGGTTGGACTAAAATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCGGGTTTCCTAATCTTCCAGCTCTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAACAAAACCTGAAGCGTTATTTCATTTGTTTCATGGAGCTGGCGTATGCTTTCAGAGCTAAGGAATGCAGCTCTAATCTTTATCTCCTTATAGTGGATTTACGAGGATGTGTCTGACGCAGTAGGAGGTTTCCTGGCCGTGGGGAAGGGGTACACCCTTGGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGAGTGCGGCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGGCCGAAAAGCGTGATTTCCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGTGGAATTGCCATTCTGTGCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------C--A
                                               BLH ATG     102     280                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN     102      67                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MPR     102      67                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR     102      16                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               EST CLI      -3      25                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG     102       5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - ?? ---- 2e-062     XP_691338.1 PREDICTED: similar to Pannexin 1 [Danio rerio] ------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 1e-132     XP_001235339.1 PREDICTED: similar to pannexin 1 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Dr ==== 1e-133     NP_957210.1 pannexin 1 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 7e-157     NP_062355.2 pannexin 1 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 2e-159     NP_056183.2 pannexin 1; MRS1 protein; innexin [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-XZG3340.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAG------------------------TGA---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------TGA---------------------------ATGATG---------------------------TAA------------------------------------------------------------------TAA------------------ATG------------TAG------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------TGA---TGA---------------------------------------------------------------------------------------------------------TGAATG---------------------------------------------TGA---------------------------------------TGA---------------------------------------------------ATG---------------------------------------------------------------------TAA---------------------------TAA---------------------------------------------------TAG------------------------TGA---------------------------------------------------------------------------------------TAGTAG---------------TGA------------------------------ATG---------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------TAA---------------TAA---TGA------------------TGA---------------------------------------------------------ATG---------------------------------------------TGA------------------------------------TGA---------------ATG---------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------TAA---ATG------TAA------------------------------ATG------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2      ests                                 Xt7.1-CAAN4814.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGCCGGTCCAGTAGCACGTTAGGAAGCTTGTGAGGAGATTATAGTATGAAAGAGTGCGGCCGAAAAGCGTGATTTCCCCGCTGCTGCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTGAGCCACTACAAGTACCCAATCGTGGAGCAGTATCTGAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTAATTTGC
                                                  Xt7.1-CHK-1008234178                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGxCCAGTAGCACGTTAGGAAGCTTGTGAGGAGATTATAGTATGAAAGAGTGCGGCxGxxAAGCGTGATTTCCCCGCTGCxxCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTGAGCCACTACAAGTACCCAATCGTGGAGCAGTATCTGAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTA
  3  -1   0       add Kid1      in                         CABA3159.3p cagatcttctcccgatatccccacctacgggtgggtgatatcgggtgaatttaggttaatgcgaACTAGAACGAATTAGAACGCCGGTAATAGGCGCAGTCTCGGTCCCTGATCCGAGTACACTTTTTAACTTGCCTGATCGATATCTGGcagatattggtcgggcaggcctgtcgtttgtgcccctacacgggccaataagctgctgaattggtctaagggacagatatcggcagctagaattggcccgtgtatggggacctttagtCTTTTCCCTTCCATCTACACAGAGGCACAAGGGAATCCCATACCCAGCATAGTGTAACAGCTTTGACTTTCTAGCTGTAAAAGGGTACTGCCCTTCCGTATGCCAGGCTGTCCCTGGGCACTAGCTACCCTAGAATATTCAGTGCTGTCCCTACCCAGTCTATATTTGTGCTTAAAGGCACCATGATCCCATTATTATTATAGTTGCCCTGTGCCATGCTTTCTGTAATGAACATAAGCTCATATTGCCTTAGGCAGTTGTTACAGAGCTTGGGCATTTAGAGGCAAACTAGCTACTTATTTAACACCCGCTGGTCAGTCAGTAAATCAGCATTGGTAAAGCGTCGGTAACGCCACTACATGTAACCCAGATGGTGCCGGTCCATAGCTGGGGGCTCATACACTGCAGCCCTTAGAACTCTGACATGTAATGTAATCTAATGTACACTTGGGGGCAGCGGAAGACTATTTGTCAGTTTTCCTGCATTGTTGCATCGACTCGATGCAGTCCTTGGTCCGATGGCCCATGTATCTGGCATTTTACTTCGATTGTTTGGCCCTAGGGCCGAGTA
  5  -1   2       bld Kid1      in                         CABA3159.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATATTGCTTAGGGCAGTTGTTACAGAGCTTGGGCATTTAGAGGCAAACTAGCTACTTATTTAACACNCGCTGGTCAGTCAGTAAATCAGCATTGGTAAAGCGTCGGTAACGCCACTACATGTAACCCAGATGGTGCCGGTCCATAGCTGGGGGCTCATACACTGCAGCCCTTAGAACTCTGACATGTAATGTAATCTAATGTACACTTGGGGGCAGCGGAAGACTATTTGTCAGTTTTCCTGCATTGTTGCATCGACTCGATGCAGTCCTTGGTCCGATGGCCCATGTATCTGgcattttacttcgattgtttggccctagggccgagtaatcaaatttgcctgatatcacACACTGTAGGTGGACGTATCGGGAGAAGATCAGATATTTGGCAAACGAGCCAATCGCAATCTTTAGTCTTATCCACCCAGTCTATTTAAAGGCAAAGTTGTTAAAGCAGAGGTTACGTTTTGTCTGTTATTATTTGTCAGTCTCTCACATACACATTGCAGGACCTCTATATATCAGGTTATTATTCACTTATCTCCTTCCAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGGTAAGAGGAGGGGCGTGGCTATGTTAAAGTGGTGGCCTACCTTCAGGTTA
  5   1   2       bld Egg       in                   TEgg054p22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTGTGTCTCGTCACTGCGCGCACCCGCTGGCCCCTCCTACCGAGGCGCGGGCACGCCGAGCCCAGTAGCACGTTAGGAAGCTTGTGAGGAGATTATAGTATGAAAGAGTGCGGCGGCCGAAAAGCGTGATTTCCCCGCTGCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATAACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCTTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGAC
  5   1   2       bld Gas  5g3  in                   TGas061b03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCCCGGGCGCCGGGGCGCGGGCACGCCGAGCCCAGTAGCACGTTAGGAAGCTTGTGGGGCTTATAGTATGAAAGAGTGCGGCGGCCGAAAAGCGTGATTTCCCCGCTGCCCCCCCCCCCCCAGCCATGGCTATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGGTCTTCTCTACCTGCCAAATTTA
  5   1   2       bld Gas8      in                          st61f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGCGCGGGCACGCCGAAGCCCAGTAGCACGTTAGGAAGCTTGTGGGGATTATAGTATGAAAGAGTGCGGCGGCCGAAAAGCGTGATTTCCCCGCTGCCCCCCCCCCCCCA
  5   1   2       bld Neu  5g                        TNeu030b07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGCACGCCGAGCCCAGTAGCACGTTAGGAAGCTTGTGGGGATTATAGTATGAAAGAGTGCGGCGGCCGAAAAGCGTGATTTCCCCGCTGCCCCCCCCCCCCCCAGCCATGGCTATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGT
  5   1   2       chi Egg  5x                        TEgg141d08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCACGCCGAGACCAGTAGCACGTTAGGAAGCTTGTGGGGATTATAGTATGAAAGAGTGCGGCGGCCGAAAAGCGTGATTTCCCCGCTGCCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCTCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTAATTTGCCGGGTGGTGACGCTAATCATCGTATTCACGGCGTGTATCTACCTGGCTATTATATCAGCCTCTTCTCTCTGACGGACGAGTTCACCTGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGC
  5   1   2   14 seed Te4  5g3  in                         CAAN4814.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CACGCCGAGCCCAGTAGCACGTTAGGAAGCTTGTGAGGAGATTATAGTATGAAAGAGTGCGGCGGCCGAAAAGCGTGATTTCCCCGCTGCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATAACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCTTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTGAGCCACTACAAGTACCCAATCGTGGAGCAGTATCTGAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTAATTTGCC
  5   1   2   34  bld Brn2 5x3  out                       CAAJ20111.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCCGAGCCCAGTAGCACGTTAGGAAGCTTGTGAGGAGATTATAGTATGAAAGAGTGCGGCGGCCGAAAAGCGTGATTTCCCCGCTGCCCCCCCCCCAGCCATGGCCATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATAACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCTTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGT
  5   1   2   10  bld Int1 PIPE in                        CAAP10836.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGTAGCACGTTAGGAAGCTTGTGGGGATTATAGTATGAAAGAGTGCGGCGGCCGAAAAGCGTGATTTCCCCGCTGCCCCCCCCCCCCCAGCCATGGCTATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTGAGCCACTACAAGTACCCAATCGTGGAGCAGTATCTGAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTAATTTG
  5   1   2       bld TbA  5g                        TTbA046o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCCGAAAGCGTGATTTCCCCGCTGTTCCCCCCCCCCCAGCCATGGCTATAGCTCATATTGCCACCGAGTACGTCTTCTCCGACTTCCTCCTCAAGGATCCCCCCGAGTCCAAGTACAAGGGGCTGCGGCTGGAGCTGGCGGTGGATAAGCTGGTGTCCTGCATTGCTGTGGGGCTGCCCTTGCTGCTCATATCGCTGGCCTTCGCTCAGGAGATTACTCTGGGTTCCCAGATAAGCTGTTTTGCCCCCACATCCTTCTCATGGCGCCAGGCTGCGTACGTCGACTCTTTCTGTTGGGCAGCAGTTCAGCAAAAACACCTCTCTCAGAGCGACTCTGGGAATGTCCCCCTGTGGCTGCATAAGTTCTTCCCGTATATCCTGCTCCTTGTCGCTGTTCTTCTCTACCTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTG
  3   1   2       bld Egg       in                    TEgg054p22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCCAAATTTATTCTGGCGCTTCACGGCTGCCCCCCACCNTTAGCTCCGACCTCAAGTTTGTAATGGAGGAACTTGACAAATGTTACAACCGGGACATCAAAGACATCAAGGCTGCCAATAATTTGAACAGTTCTGACAAGAGAGATGGACTCAACTCGCCTGTTGTCAGTGAGAACCTTCAACAGAGCCTGTGGGAAATCCCTCTGAGCCACTACAAGTACCCAATCGTGGAGCAGTATCTGAAGACAAAAAATAATTCCTATGGCCTAATCATCAAATACCTAATTTGCCGGGTGGTGACGCTAATCATCGTATTCACGGCGTGTATCTACCTGGGCTATTATATCAGCCTCTTCTCTCTGACGGACGAGTTCACCTGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGCTGGTTCCCTTCAGGAAAACCGCCAATGTGCTCAAGGTGTATGAGGTGCTACCAACCTTCAGTGTCCAACAGGCTCCGTCCAAAACCTACGATGACCACAGCCTGTTCCTTCTGTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCGTTTAAATGCACGTCTGAGGTGCCAAACAATACGGAACAGAATGAAGAAGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                  Xt7.1-XZG3340.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCACCTGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGCTGGTTCCCTTCAGGAAAACCGCTAATGTGCTCAAGGTTTATGAGGTGCTACCAACCTTCAGTGTCCAACAGGCTCCGTCCAAAACCTACGATGACCACAGCCTGTTCCTTCTGTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCATTTAAATGCACGTCTGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATTGTGCCCTCTGATTTGATGCTGATTCTCCCCCCGTTTTACACCAGTGTATAAATGCTATAGTGTTTTGATCCAGCGCCCGTATGGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATCTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTGAAAGACAAGGTCCGCTCATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGACACACCCTGACACCTTTGGTACCGACTCATTGGGTTGGACTAAAATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCGGGTTTCCTAATCTTCCAGCTCTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAACAAAACCTGAAGCGTTATTTCATTTGTTTCATGGAGCTGGCGTATGCTTTCAGAGCTAAGGAATGCAGCTCTAATCTTTATCTCCTTATAGTGGATTTACGAGGATGTGTCTGACGCAGTAGGAGGTTTCCTGGCCGTGGGGAAGGGGTACACCCTTGGGA
                                                  Xt7.1-CHK-1008230827                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGCTGGTTCCCTTCAGGAAAACCGCTAATGTGCTCAAGGTTTATGAGGTGCTACCAACCTTCAGTGTCCAACAGGCTCCGTCCAAAACCTACGATGACCACAGCCTGTTCCTTCTGTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCATTTAAATGCACGTCTGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATTGTGCCCTCTGATTTGATGCTGATTCTCCCCCCGTTTTACACCAGTGTATAAATGCTATAGTGTTTTGATCCAGCGCCCGTATGGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATCTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTGAAAGACAAGGTCCGCTCATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGACACACCCTGACACCTTTGGTACCGACTCATTGGGTTGGACTAAAATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCGGGTTTCCTAATCTTCCAGCTCTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAACAAAACCTGAAGCGTTATTTCATTTGTTTCATGGAGCTGGCGTATGCTTTCAGAGCTAAGGAATGCAGCTCTAATCTTTATCTCCTTATAGTGGATTTACGAGGATGTGTCTGACGCAGTAGGAGGTTTCCTGGCCGTGGGGAAGGGGTACACCCTTGGGAAAGGGC
  5   1   2       bld Gas7      in                          XZG3340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCTATCATCGTATTCCGGCGTGTATCTACCTGGGCTATTATATCAGCCTCTTCTCTCTGACGGACGAGTTCACCTGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGCTGGTTCCCTTCAGGAAAACCGCTAATGTGCTCAAGGTTTATGAGGTGCTACCAACCTTCAGTGTCCAACAGGCTCCGTCCAAAACCTACGATGACCACAGCCTGTTCCTTCTGTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCATTTAAATGCACGTCTGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCTGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTACAATTTGCTGTATTTTG
  5   1   2       bld Kid1      out                        CABA7791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCACCTGTAACATCCGCACGGGGATCCTGAGGAACGACACGGCGCTGCCTCCTTTAGTGCAATGCAAACTCATAGCCGTGGGGGTCTTCCGGCTTCTCAGCTACATCAACCTCATTATCTACGTGCTGATAATGCCGTTTATCATTTACGCCATGCTGGTTCCCTTCAGGAAAACCGCCAATGTGCTCAAGGTGTATGAGGTGCTACCAACCTTCAGTGTCCAACAGGCTCCGTCCAAAACCTACGATGACCACAGCCTGTTCCTTCTGTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCGTTTAAATGCACGTCTGAGGTGCCAAACAATACGGAGCAGAATGAAGTTGAACTTACAGGTAAATCCTAAACTTCTTAGTTTTACAAGCAACTTGCCCCTACAGACCAGGGCTTATTTACCAGCCTTGGTTAAAGGCCTAAACCTGAAAGTtcgaatgaccctttcacaatggtcgcctaagaccattgggaaatacatatttcatatggtcttaggaataattttatggttggggtcaccacaacatgaggaactgtattaaagggacagtaacaccaaaaaattaaagtgtataanagtaattactatataatgctgccctgtactggtacaactggtgtgttttccttagaaagactactatagtttatataataaAGTTTC
  3   1   2       bld Gas7      in                          XZG3340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCCTGGAGGAGAACGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCATTTAAATGCACGTTTGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCTGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAG
  5   1   2       bld Egg       in                   TEgg054c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGGCGTCAGTGAGCTGAAATCCTACAAGTTCCTCAAGGTGCTGGAGAATATTAAAAACACCGGGGAGAACTTCGACACCATACAGTACTTAACTTCTTTAGGAACGGTGAAGACGGACACAGTGGATGGGAAACTGGCGTTTAAATGCACGTCTGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAACGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATACGGAAGAGTGGAATTGCCATTCTGTGCAGTTTGCCCCCATCTTTCTCACGGAGACTCGTTGCTGCCACATTGCTGTGAAATGTGTTTCCCCCTACGGTGAACCTGTTATTTCAGTGTGGGGCGCGGGGCGACCAGATTGCCATAATTGCCTCTCTTACTGACAAGTCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGCGGGATCCGGCTGCTGGGAGTTGTTGGCTGGA
  5   1   2       bld Gas                            TGas072f04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGGTGCCAAACAATACGGAACAGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAACGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGCTGCTGGGAGTTGTTGGCTGGATTCAGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCT
  3   1   2       bld HeRe      in                     EC2CAA15DB09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTATGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCGGGGGTTATGGTTTTATAGTAAATACGGAAGAGTGGAATTGCCATTCTGTGCAGTTTGCCCCCCATCTTTCTCTCGGAGACTCGCTGCTGCCACATTGCTGTGAAACGTGTTTCCCCTACGGTGAACTTGTTATTTCAGTGTGGGGCGCGAGGCGGCCAGATTGCCATAATGGTCTCTCTTACAGTCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGCCTGTGTGTGCGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCAGGACCTCCCTAGTGTAAAGTCATTATGTATTACAATATTTTTTAGGACTTATTTTTACAATTTGCTGCATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGTTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATCGTGCCCTCTGGTTTGATGCTGGTCCCCCTGTTTAC
  5   1   2       bld HeRe      in                     EC2CAA15DB09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAATGAAGTTGAACTTACAGTTCAGCCCTCGAGTGACAATGCGAAAATGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTATGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCGGGGGTTATGGTTTTATAGTAAATACGGAAGAGTGGAATTGCCATTCTGTGCAGTTTGCCCCCCATCTTTCTCT
  3  -1   2      skin Kid1      in                          CABA642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACAATGCGAAAACGGAGGAAAAGAAAGTTCGGCAGCGGCTGCTGGATTCATCCTGCTGAGTGCCGGCTGTGTGGGGAATTGGCAAAATGATGGGGAATCAGAAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATTGTGCCCTCTGATTTGATGCTGATTCTCCCCCCGTTTTACACCAGTGTATAAATGCTATAGTGTTTTGATCCAGCGCCCGTATGGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATCTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTGAAAGACAAGGTCCGCTCATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGAC
  5   1   2       bld Gas                            TGas134m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAATCGGCTCTACCCATAAGGCAGAGGTCCCATTGTGAAAGTGACTGTAGGAATCCTCACTCAGGGGTTATGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTC
  5   1   2      skin HdA       in                   THdA003o08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGAATCCCCGGGGTTTTATAGTAAATAAAGCCTGCAGCTGCTGTTCATGGATACTGCACCTTAGCGTCGGGGGGTCCTGTGTGTGGGATCCAGGCTGCTGGGAGTTGTTGGCTGGATTCAGGGATGCAGGGAATCCACCCGGACCTCCCTAGTGTAAAGTCATTATGTATTGCAACCTTTTTTAGGACTTATTTTTACAATTTGCTGTATTTTGTTGGCAAGGGCTGTACAGTTTCTTATTTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATTGTGCCCTCTGATTTGATGCTGATTCTCCCCCCGTTTTACACCAGTGTATAAATGCTATAGTGTTTTGATCCAGCGCCCGTATGGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATCTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTG
  3   1   2       bld Gas0                                 dad29g11.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTATGTGTAAAGTTATTTAAGTGCTCATCGACCGCCATATCCCTGTTATTTTGCTGTTATTTTGCTGTTATTTTCTTGTTTTAAACTGTTTACAGAATTGTGCCCTCTGATTTGATGCTGATTCTCCCCCCGTTTTACACCAGTGTATAAATGCTATAGTGTTTTGATCCAGCGCCCGTATGGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATCTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTGAAAGACAAGGTCCGCTCATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGACACACCCTGACACCTTTGGTACCGACTCATTGGGTTGGACTAAAATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTACATCAAAAAAGACACACGTAAGGTTNTNNNNNGNGGTTTTTTAANNNNCCNGCAAAAGTAGCCAGAATAAGTACCACTGATTAGCNNNNNNNNAGAGA
  3   1   2       bld HdA       in                    THdA003o08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGCCGGCGTCACCTGACCGTATCAGCGCCGCATTTGCCCATGTGTGAATGAGGCTCACTCTGCTATCAAACTGGAATTTGATTGTGAGGGAACATTGATGGGGCCCCACAGGTTTGGGGCAGTGGGTCTGTGACTGCTGAAAGACAAGGTCCGCTCATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGACACACCCTGACACCTTTGGTACCGACTCATTGGGTTGGACTAAAATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGCTGAAAGGTACATGATAAAAAGACCACACCGTAAGGTTCTAAAAAAAAAAAAAAAA
  3   1   2      seed Int1 PIPE in                        CAAP10836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGGCTGCCCAAACTGCACGGTTCATTCTGGATTTATGGACATTGATTCATACAGACACACCCTGACACCTTGGTACCGACTCATGGGGTTGACTAAAATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCGGGTTTCCTAATCTTCCAGCTCTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTTTTTTCCTCTCGCC
  5  -1   2       bld Gas       out                  TGas135m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGGTACTAAAGCCGCTCAGCCGCCCATGAATGTGCCTAAAGCGCTAATTTATCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTTTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCGGGTTTCCTAATTTTCCAGCTTTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTTACCATAAAGCTGTTCCAATGGGAGTGGGTTCCGCACAGTCATTGGGTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTTTGTGTATAGACACATGTAGTTCCTAAAGCCCCTTTTTGTAATAGGCCCCTTTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTT
  3   1   2       bld Gas8      in                          st61f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCACAAGTTCGGCCTGGGACAACGGACTGCTTTGGTTCTTAGTGTGAATGGACCCAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCGGGTTTCCTAATCTTCCAGCTCTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCT
  3   1   2       bld Te4  5g3  in                         CAAN4814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGACAACGAACTGCTTTGGTCTTAGTGTGAATGGGCCCATAAAGGTTACGATGATTTTTACATGATAAAAAGACACACGTAAGGTTCTACTCATTGGTCAGGTTTCCTAATCTTCCAGCTCTTTGGTCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCATGTAGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGACAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGGCAGGTAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCGTAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCCGCCAATGAGCTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTTCTAATCCTTAGTTAGCATTGCAGTATCTCTAGTGCTATAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAAC
  3   1   2       bld Egg       in                    TEgg054c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCAGCTCTTTGGCCAAACTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAACAAAACCTGAAGCGTTATTTCATTTGTTTCATGGAGCTGGCGTATGCTTTCAGAGCTAAGGAATGCAGCTCTAATCTTTATCTCCTTATAGTGGATTTACGAGGATGTGTCTGACGCAGTAGGAGGTTTCCTGGCCGTGGGGAAGGGGTACACCCTTGGGAAAGGGCCAGGCCTATTtctatatatcttccagtttctcattcacaccactgcctggttgctagggtaaatTGGAACTTAGCTACATAATTAAAAAAAAAAAAAAAAA
  5  -1   2       bld Kid1      in                          CABA642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCAAACTGGCTGCCCTAGTAGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAACAAAACCTGAAGCGTTATTTCATTTGTTTCATGGAGCTGGCGTATGCTTTCAGAGCTAAGGAATGCAGCTCTAATCTTTATCTCCTTATAGTGGATTTACGAGGATGTGTCTGACGCAGTACGAGGTTTCCTGGCCGTGGGGAAGGGGTACACCCTTGGGAAAGGGCCGGGCCC
  3   1   2       bld Gas  5g3  in                    TGas061b03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGCTGCCCTAGTAGGGGGCAACATCAGGGTGATTCCCCCCGTTTCACCATAAAGCTGTTCCAATGGGAGTGGCTTCCGCACAGTCATTGGCTGAATGGGCACAGTTTGGCCGATACCGGGGCCAGTCAGGAAAGGGCAAGTTGAAGCCTGTCTGTGTATAGACACATGTAGTTCCTAAAGCCCCTCTCTGTAATAGGCCCCTCTATGGTACAGAGTTTATTTATGCTGGAGACAGGGAAGATTTGTTGCTTTTGGGCGCCCCAGTCTCCCGCTTCCCATAATCTGCCCCCAACCCCTAATGTTGAATAGATACAAATGCCTTCTGAATAGAGAGTGGTTTTGGGGGCAGCCCTAGTATTTTACTATTCGTATTAGTGAGTAGAATGACTGAAACAGCATGCTTCATAGTAAAGGGTAAGTACAACCAACAGTGAGAGCATTTTGGGACATTTACAGGGTTCATCAGCCAATGAGTTGTCATCTGCCAAATGCATTTAGACTACGGAAGGCAAATATCTGATTGGTTGCTAATCCTTAGGTACCATTATAGTATCTCTAGTGCTACAAAGGCTTTTATTTTTTCTTTAAAGGGCAACTAAAGCACTGGAACAAAACCTGAAGCGTTATTTCATTTGTTTCATGGAGCTGGCGTATGCTTTCAGAGCTAAGGAATGCAGCTCTAATCTTTATCTCCTTATAGTGGATTTACGAGGATGTGTCTGACGCAGTAGGAGGTTTCCTGGCCGTGGGGAAGGGGTACACCCTTGGGAAAGGGCCAGGCCCATTtctatatatcttccagtttctcattcacaccactgcctggttgctagggtaaatTGGAACTTAGCTACATAATTTTTAAAACAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)