Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ15975.3                          27 END     1           7        3                (no blast hit)
     2   1.0    0Xt7.1-CAAQ11267.5                          19 END     2          15       10                (no blast hit)
     3   2.0    0Xt7.1-IMAGE:6999017.5                       3 END     1           7       33                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     4 189.0    0Xt7.1-IMAGE:6999017.5                       3 PI      100      1948     2046                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012155700 Xt7.1-CAAK10484.5.5 - 13 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     4     4     4     4     4     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     6     4     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     4     5     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2       e50                                 Xt7.1-CAAN5046.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAAGTTTTTCGGGTCCTGGAATTCCCTGGGATCAAGAGTCTGCCCTAATGATATTGGGTGGACAAAGAAGTCTTGTTAACAAGTGGACTACATTTTTGAAGGCTAGACTGGTATGCTCAGTGATGGATGATGATGGAACAGAAACCTATTTTGATGAATTAGAGGATGTTTTTCTAATGGAAACAGACAATCCTAGGACTACACTTGTGTATGGAATTTTTACAACATCAAGTTCCGTATTTAAAGGATCTGCAGTTTGTGTTTACCATATGTCAGACATCCAAACTGTATTTAATGGACCATTTGCACACAAAGAGGGTCCAAATCACCAACTGATACCATACCAGGGTAGAATTCCATACCCTAGGCCTGGTACGTGTCCCGGAGGTGCATTCACCCCAAATATGAAATCAACCAAAGAGTTTCCAGATGATGTTGTAACCTTTATCAGGAATCACCCTCTTATGTTTAACTCTATCTATCCAACACTTAAGAGGCCGCTTCTTATAAGGACAGGAACTGACTACAAGTTCACAAAAATAGTTGTAGACAGAGTAAATGCAGCAGATGGGAAGTACCATGTCTTATTCCTTGGAACAGACAAAGGGACTGTTCAGAAAGTTGTTGTTGTTCCTGCTAATGGTTCAGCAAGTGGGGAACTCATCTTGGAAGAAATGGAAGTATTTAAGAGTCATGCTCCTATAACCTCCATGAAGATTTCTTCAAAAAAGCAACAACTGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCCTTGCAGGGACCCATATTGTGCTTGGGATGGAAAATTTTG
  5   1   2       e50                                Xt7.1-CAAK10484.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCTTGCAAGGGACCCATATTGTGCTTGGGATGGAAAATTTTGTTCCAGATTTTATCCATCTGGAAAAAGGAGAAGTAGAAGACAAGATGTGAAGCATGGAAATCCAGTTACCCAGTGTCGTGGATTTAATTTAAAAGGATATAGGAACACTGCAGAAATTGTTCAGTATGGGGTTAGAAACAACACAACTTTCCTAGAGTGCATTGCTAAGTCTCCACAGGCTTCTGTCAAGTGGCTGCTGCAAAAAGATAATGATCGGAGGAAAGAGGTGAAATTAAATGAAAGGATCATTGCTACTGGTCAAGGACTCCTTATTCGCTCTGTCCAGGAAGTGGATCAAGGTCTTTATCATTGTATTGCCACAGAAAACACCTTCAAGCAGACAATAGCAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGAAAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTACAACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGTATTTTTGTCTGAATACACACTCATGTTCCTTTTTTGTTTACCGATCTAACTGTAAAATAGAGGGTTCAATATTTTCTTGAGTATGTGGTTGTTTAGAAACCTGTCTTTTGGTAAAAGAACAAAATAAGAACATGACGGATCAAAATGTTCTATTATAAATTATATTACCATTATTCTAGTGACTTTTTTCTAGGCTGATACATTGTTAATGGACTGGAATGAGTAGCAATGTTGAAATCTGAAGGCAAGCACAATTGGTTGAAAATAAGTCTAGTAAACTTGGATGGCTGGATCGTAGCTGGAAATCTTGGCATGGTTGAAATGAATTGTGAGGATCTAAAAAGTGTTTGTTTTTTATAGAAAAAATAAAAAATAAAAATTAAAGAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 4e-031     XP_787570.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 8e-032     NP_493582.3 SeMaPhorin related family member (smp-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 2e-042     NP_725586.1 CG4700-PC, isoform C [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_692847.1 PREDICTED: similar to semaphorin 3C [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 0          NP_038685.3 semaphorin 3C; semaphorin E [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 0          NP_006370.1 semaphorin 3C [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 0          NP_989574.1 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 0          AAH84294.1 LOC495257 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                        PREDICTED - ?? ---- 0          NP_001088402.1 hypothetical protein LOC495257 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 0          AAH96502.1 LOC613059 protein [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAK10484.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------TAG------------------------------------------------------------TGA---------------------------------------------------------TAA---------------------------------------ATG---------------------TAA---------------------TAG------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------ATG---------------------TAA------------------TAGTGA------------------------TAA---------ATG------------------TGA---------------------------------------------------------------------------TGA---------TGA------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       e50                                 Xt7.1-CAAN5046.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAAGTTTTTCGGGTCCTGGAATTCCCTGGGATCAAGAGTCTGCCCTAATGATATTGGGTGGACAAAGAAGTCTTGTTAACAAGTGGACTACATTTTTGAAGGCTAGACTGGTATGCTCAGTGATGGATGATGATGGAACAGAAACCTATTTTGATGAATTAGAGGATGTTTTTCTAATGGAAACAGACAATCCTAGGACTACACTTGTGTATGGAATTTTTACAACATCAAGTTCCGTATTTAAAGGATCTGCAGTTTGTGTTTACCATATGTCAGACATCCAAACTGTATTTAATGGACCATTTGCACACAAAGAGGGTCCAAATCACCAACTGATACCATACCAGGGTAGAATTCCATACCCTAGGCCTGGTACGTGTCCCGGAGGTGCATTCACCCCAAATATGAAATCAACCAAAGAGTTTCCAGATGATGTTGTAACCTTTATCAGGAATCACCCTCTTATGTTTAACTCTATCTATCCAACACTTAAGAGGCCGCTTCTTATAAGGACAGGAACTGACTACAAGTTCACAAAAATAGTTGTAGACAGAGTAAATGCAGCAGATGGGAAGTACCATGTCTTATTCCTTGGAACAGACAAAGGGACTGTTCAGAAAGTTGTTGTTGTTCCTGCTAATGGTTCAGCAAGTGGGGAACTCATCTTGGAAGAAATGGAAGTATTTAAGAGTCATGCTCCTATAACCTCCATGAAGATTTCTTCAAAAAAGCAACAACTGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCCTTGCAGGGACCCATATTGTGCTTGGGATGGAAAATTTTG
                                                  Xt7.1-CHK-1008249356                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTCGGGTCCTGGAATTCCCTGGGATCAAGAGTCTGCCCTAATGATATTGGGTGGACAAAGAAGTCTTGTTAACAAGTGGACTACATTTTTGAAGGCTAGACTGGTATGCTCAGTGATGGATGATGATGGAACAGAAACCTATTTTGATGAATTAGAGGATGTTTTTCTAATGGAAACAGACAATCCTAGGACTACACTTGTGTATGGAATTTTTACAACATCAAGTTCCGTATTTAAAGGATCTGCAGTTTGTGTTTACCATATGTCAGACATCCAAACTGTATTTAATGGACCATTTGCACACAAAGAGGGTCCAAATCACCAACTGATACCATACCAGGGTAGAATTCCATACCCTAGGCCTGGTACGTGTCCCGGAGGTGCATTCACCCCAAATATGAAATCAACCAAAGAGTTTCCAGATGATGTTGTAACCTTTATCAGGAATCACCCTCTTATGTTTAACTCTATCTATCCAACACTTAAGAGGCCGCTTCTTATAAGGACAGGAACTGACTACAAGTTCACAAAAATAGTTGTAGACAGAGTAAATGCAGCAGATGGGAAGTACCATGTCTTATTCCTTGGAACAGACAAAGGGACTGTTCAGAAAGTTGTTGTTGTTCCTGCTAATGGTTCAGCAAGTGGGGAACTCATCTTGGAAGAAATGGAAGTATTTAAGAGTCATGCTCCTATAACCTCCATGAAGATTTCTTCAAAAAAGCAACAACTGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCCTTGCAGGGACCCATATTGTGCTTGGGATGGAAA
  3  -1   2       bld Abd0 FLt5 out                      IMAGE:6999017                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAAGTTTTTCGGGTCCTGGAATTCCCTGGGATCAAGAGTCTGCCCTAATGATATTGGGTGGACAAAGAAGTCTTGTTAACAAGTGGACTACATTTTTGAAGGCTAGACTGGTATGCTCAGTGATGGATGATGATGGAACAGAAACCTATTTTGATGAATTAGAGGATGTTTTTCTAATGGAAACAGACAATCCTAGGACTACACTTGTGTATGGAATTTTTACAACATCAAGTTCCGTATTTAAAGGATCTGCAGTTTGTGTTTACCATATGTCAGACATCCAAACTGTATTTAATGGACCATTTGCACACAAAGAGGGTCCAAATCACCAACTGATACCATACCAGGGTAGAATTCCATACCCTAGGCCTGGTACGTGTCCCGGAGGTGCATTCACCCCAAATATGAAATCAACCAAAGAGTTTCCAGATGATGTTGTAACCTTTATCAGGAATCACCCTCTTATGTTTAACTCTATCTATCCAACACTTAAGAGGCCGCTTCTTATAAGGACAGGAACTGACTACAAGTTCACAAAAATAGTTGTAGACAGAGTAAATGCAGCAGATGGGAAGTACCATGTCTTATTCCTTGGAACAGACAAAGGGACTGTTCAGAAAGTTGTTGTTGTTCCTGCTAATGGTTCAGCAAGTGGGGAACTCATCTTGGAAGAAATGGAAGTATTTAAGAGTCATGCTCCTATAACCTCCATGAAGATTTCTTCAAAAAAGCAACAACTGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCTTGCANGGNACC
  5   1   2      seed Te4       in                         CAAN5046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGTCTGCCCTAATGATATTGGTGGACAAAGAAGTCTTGTTAACAAGTGGACTACATTTTTGAAGGCTAGACTGGTATGCTCAGTGATGGATGATGATGGAACAGAAACCTATTTTGATGAATTAGAGGATGTTTTTCTAATGGAAACAGACAATCCTAGGACTACACTTGTGTATGGAATTTTTACAACATCAAGTTCCGTATTTAAAGGATCTGCAGTTTGTGTTTACCATATGTCAGACATCCAAACTGTATTTAATGGACCATTTGCACACAAAGAGGGTCCAAATCACCAACTGATACCATACCAGGGTAGAATTCCATACCCTAGGCCTGGTACGTGTCCCGGAGGTGCATTCACCCCAAATATGAAATCAACCAAAGAGTTTCCAGATGATGTTGTAACCTTTATCAGGAATCACCCTCTTATGTTTAACTCTATCTATCCAACACTTAAGAGGCCGCTTCTTATAAGGACAGGAACTGACTACAAGTTCACAAAAATAGTTGTAGACAGAGTAAATGCAGCAGATGGGAAGTACCATGTCTTATTCCTTGGAACAGACAAAGGGACTGTTCAGAAAGTTGTTGTTGTTCCTGCTAATGGTTCAGCAAGTGGGGAACTCATCTTGGAAGAAATGGAAGTATTTAAGAGTCATGCTCCTATAACCTCCATGAAGATTTCTTCAAAAAAGCAACAACTGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCCTTGCAGGGACCCATATTGTGCTTGGGATGGAAAATTTTGT
  5   1   2       bld Te1       in                        CBWN10975.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATGTTTAACTCTATCTATCCAACACTTAAGAGGCCGCTTCTTATAAGGACAGGAACTGACTACAAGTTCACAAAAATAGTTGTAGACAGAGTAAATGCAGCAGATGGGAAGTACCATGTCTTATTCCTTGGAACAGACAAAGGGACTGTTCAGAAAGTTGTTGTTGTTCCTGCTAATGGTTCAGCAAGT
  5   1   2       e50                                Xt7.1-CAAK10484.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCTTGCAAGGGACCCATATTGTGCTTGGGATGGAAAATTTTGTTCCAGATTTTATCCATCTGGAAAAAGGAGAAGTAGAAGACAAGATGTGAAGCATGGAAATCCAGTTACCCAGTGTCGTGGATTTAATTTAAAAGGATATAGGAACACTGCAGAAATTGTTCAGTATGGGGTTAGAAACAACACAACTTTCCTAGAGTGCATTGCTAAGTCTCCACAGGCTTCTGTCAAGTGGCTGCTGCAAAAAGATAATGATCGGAGGAAAGAGGTGAAATTAAATGAAAGGATCATTGCTACTGGTCAAGGACTCCTTATTCGCTCTGTCCAGGAAGTGGATCAAGGTCTTTATCATTGTATTGCCACAGAAAACACCTTCAAGCAGACAATAGCAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGAAAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTACAACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGTATTTTTGTCTGAATACACACTCATGTTCCTTTTTTGTTTACCGATCTAACTGTAAAATAGAGGGTTCAATATTTTCTTGAGTATGTGGTTGTTTAGAAACCTGTCTTTTGGTAAAAGAACAAAATAAGAACATGACGGATCAAAATGTTCTATTATAAATTATATTACCATTATTCTAGTGACTTTTTTCTAGGCTGATACATTGTTAATGGACTGGAATGAGTAGCAATGTTGAAATCTGAAGGCAAGCACAATTGGTTGAAAATAAGTCTAGTAAACTTGGATGGCTGGATCGTAGCTGGAAATCTTGGCATGGTTGAAATGAATTGTGAGGATCTAAAAAGTGTTTGTTTTTTATAGAAAAAATAAAAAATAAAAATTAAAGAAAAAAAA
                                                  Xt7.1-CHK-1008236306                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCTTGCAAGGGACCCATATTGTGCTTGGGATGGAAAATTTTGTTCCAGATTTTATCCATCTGGAAAAAGGAGAAGTAGAAGACAAGATGTGAAGCATGGAAATCCAGTTACCCAGTGTCGTGGATTTAATTTAAAAGGATATAGGAACACTGCAGAAATTGTTCAGTATGGGGTTAGAAACAACACAACTTTCCTAGAGTGCATTGCTAAGTCTCCACAGGCTTCTGTCAAGTGGCTGCTGCAAAAAGATAATGATCGGAGGAAAGAGGTGAAATTAAATGAAAGGATCATTGCTACTGGTCAAGGACTCCTTATTCGCTCTGTCCAGGAAGTGGATCAAGGTCTTTATCATTGTATTGCCACAGAAAACACCTTCAAGCAGACAATAGCAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGAAAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTACAACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGTATTTTTGTCTGAATACACACTCATGTTCCTTTTTTGTTTACCGATCTAACTGTAAAATAGAGGGTTCAATATTTTCTTGAGTATGTGGTTGTTTAGAAACCTGTCTTTTGGTAAAAGAACAAAATAAGAACATGACGGATCAAAATGTTCTATTATAAATTATATTACCATTATTCTAGTGACTTTTTTCTAGGCTGATACATTGTTAATGGACTGGAATGAGTAGCAATGTTGAAATCTGAAGGCAAGCACAATTGGTTGAAAATAAGTCTAGTAAACTTGGATGGCTGGATCGTAGCTGGAAATCTTGGCATGGTTGAAATGAATTGTGAGGATCTAAAAAGTGTTTGTTTTTTATAGAAAAAATAAAAAATAAAAATTAAAGAA
  3   1   2       chi Te1       in                        CBWN10975.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTTCAAAAAAGCAACAACTGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCTTGCAAGGGACCCATATTGTGCTTGGGATGGAAAATTTTGTTCCAGATTTTATCCATCTGGAAAAAGGAGAAGTAGAAGACAAGATGTGAAGCATGGAAATCCAGTTACCCAGTGTCGTGGATTTAATTTAAAAGGATATAGGAACACTGCAGAAATTGTTCAGTATGGGGTTAGAAACAACACAACTTTCCTAGAGTGCATTGCTAAGTCTCCACAGGCTTCTGTCAAGTGGCTGCTGCAAAAAGATAATGATCGGAGGAAAGAGACTATTCCAGCTTGCCCTAAATCATCAATTATACTTTCTGCTTAGACAACACCAGCATCATTGTCTGGAAATGAGACCTCAGAGTGCCAAATATTAGATCAAACTCAATGTTACTTTGCAAAAAAAGATCTAAAGTTCACTCTAAGATTCAGAACGTGCCAGATACAAACAATACTTGATAAAGCTTGAAAAAAGGCACAATGGTATCTTTGTTTTAGTCAGTCTACAAAGCATAAAATACATCTTTTTCCTTGTCAGTACTAATAAATTATACATTTTGTAAAAAAAAAAAAAAA
  5   1   2       bld Brn2      out                       CAAJ15975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCTTGCAAGGGACCCATATTGTGCTTGGGATGGAAAATTTTGTTCCAGATTTTATCCATCTGGAAAAAGGAGAAGTAGAAGACAAGATGTGAAGCATGGAAATCCAGTTACCCAGTGTCGTGGATTTAATTTAAAAGGATATAGGAACACTGCAGAAATTGTTCAGTATGGGGTTAGAAACAACACAACTTTCCTAGAGTGCATTGCTAAGTCTCCACAGGCTTCTGTCAAGTGGCTGCTGCAAAAAGATAATGATCGGAGGAAAGAGGTGAAATTAAATGAAAGGATCATTGCTACTGGTCAAGGACTCCTTATTCGCTCTGTCCAGGAAGTGGATCAAGGTCTTTATCATTGTATTGCCACAGAAAACACCTTCAAGCAGACAATAGCAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGANAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTTACACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGNGATATTTATATGCGCAACATCTATTGAATAAACATCTC
  5   1   2       bld Brn2      out                       CAAJ17989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTATGTTAGCTCAGAAGAAGGCATTACCCAGTTGTCTTTACATCGCTGCCACATTTATGGTACTGCCTGTGCTGACTGTTGCCTTGCAAGGGACCCATATTGTGCTTGGGATGGAAAATTTTGTTCCAGATTTTATCCATCTGGAAAAAGGAGAAGTAGAAGACAAGATGTGAAGCATGGAAATCCAGTTACCCAGTGTCGTGGATTTAATTTAAAAGGATATAGGAACACTGCAGAAATTGTTCAGTATGGGGTTAGAAACAACACAACTTTCCTAGAGTGCATTGCTAAGTCTCCACAGGCTTCTGTCAAGTGGCTGCTGCAAAAAGATAATGATCGGAGGAAAGAGGTGAAATTAAATGAAAGGATCATTGCTACTGGTCAAGGACTCCTTATTCGCTCTGTCCAGGAAGTGGATCAAGGTCTTTATCATTGTATTGCCACAGAAAACACCTTCAAGCAGACAATAGCAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGAAAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTTACACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAA
  5   1   2      seed Brn3      out                       CAAK10484.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTAGAAGACAAGATGTGAAGCATGGAAATCCAGTTACCCAGTGTCGTGGATTTAATTTAAAAGGATATAGGAACACTGCAGAAATTGTTCAGTATGGGGTTAGAAACAACACAACTTTCCTAGAGTGCATTGCTAAGTCTCCACAGGCTTCTGTCAAGTGGCTGCTGCAAAAAGATAATGATCGGAGGAAAGAGGTGAAATTAAATGAAAGGATCATTGCTACTGGTCAAGGACTCCTTATTCGCTCTGTCCAGGAAGTGGATCAAGGTCTTTATCATTGTATTGCCACAGAAAACACCTTCAAGCAGACAATAGCAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGAAAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTACAACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGTATTTTTGTCTGA
  3   1   2       bld Te4       in                         CAAN5046.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATATAGGAACACTGCAGAAATTGTTCAGTATGGGGTTAGAAACAACACACTTTTCCTAGAGTGCATTGCTAAGTCTCCACAGGCTTCTGTCAAGTGGCTGCTGCAAAAAGATAATGATCGGAGGAAAGAGGTGAAATTAAATGAAAGGATCATTGCTACTGGTCAAGGACTCCTTATTCGCTCTGTCCAGGAAGTGGATCAAGGTCTTTATCATTGTATTGCCACAGAAAACACCTTCAAGCAGACAATAGCAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGAAAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTACAACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGTATTTTTGTCTG
  5   1   0       add Tad5                                  XZT7387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTGGATTTGCAGACTATTCCAGCTTGCCGTAAATCATCAATTATACTTTCTGCTTAGACAACACCAGCATCATTGTCTGGAAATGAGACCTCAGAGTGCCAAATATTAGATCAAACTCAATGTTACTTTGCAAAAAAAGATCTAAAGTTCACTCTAAGATTCAGAACGTGCCAGATACAAACAATACTTGATAAAGCTTGAAAAAAGGCACAATGGTATCTTTGTTTTAGTCAGTCTACAAAGCATAAAATACATCTTTTTCCTTGTCAGTACTAATAAATTATACATTTTGTGAGCCATGTTATTCTGATTTATAGTCTCATTCTCTATTAAGGGAGTTCTCTATATGTATCCCAGAATTGTATTACTGTATTACAGTATTACGGTATTGGTTTAGTTGGCTGGGAAAAAAATCTGTGGGCTTTTTTAACTGAGGATTATGTTGCGAATGTTGAAACAACAGGCAGTACACTCTTATTTCTACATAAGAGTTAAAAGGTGTAATTTTTTTTACGCATTTTAAATCCTTTCTTAAGCCCAGACACTGAAACCCTAGGGCCTTATATATCAATGATTTCCTTGTTTCAATTTTTTTGCATGAAAACTCCCAATTTTTTTAATATATAAGCAGTTTGGCAAAAATTTGAGTTTATTCAAATTAAAAAAAACACTAAGGGGCTGATATATCAAAGTCCGAATTTCAGACTTTAAATAGTACGAGCACAAAAACTTTGTATTATTAAGGAAAATTTCTAGTGTGCGGAATTGTTGCGAAAATTCGTAACGTTACAatctgaacgtcacanaattttcgtatcccaacgatcggaaacggcgctaaaaactttctgactttgaAACTCAGTGCATGTT
  3   1   2       bld Sto1      in                         CABG3397.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGAAAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTACAACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGT
  5   1   2       bld Sto1      in                         CABG3397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAAGGTTAATTTAAAAGTTCTAGAGCCAGAGTTAGTCACATTCATGACGGATAAATCTCAGTGGCTTTGGGCCAGTACTTTGAGTGGAATGCAGTTCCATCCAAAGGATCTCACAGGTGCATTCAGTCACTCGGAAATGCAAATAATTAACCAGTACTGCAAAGAGAGTCGGCAGAAAACTCGACAAGAAGCAGAAAATCAGAAAATGAGAGGGGACTATAGCAAGTTAAAGGTTCTTTTAAACACCAGAAAAAGTAGAAATCGAAGAAACCATTTTCCTGGATCGTAGGCCTGCAAGTTTCCTTGCTTATGGCAACACCATACTTTTGTTCTTTACAACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG33398.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCACGCGTCCGCAACACCATACTTTTGTTCTTTACAACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGTATTTTTGTCTGAATACACACTCATGTTCCTTTTTTGTTTACCGATCTAACTGTAAAATAGAGGGTTCAATATTTTCTTGAGTATGTGGTTGTTTAGAAACCTGTCTTTTGGTAAAAGAACAAAATAAGAACATGACGGATCAAAATGTTCTATTATAAATTATATTACCATTATTCTAGTGACTTTTTTCTAGGCTGATACATTGTTAATGGACTGGAATGAGTAGCAATGTTGAAATCTGAAGGCAAGCACAATTGGTTGAAAATAAGTCTAGTAAACTTGGATGGCTGGATCGTAGCTGGAAATCTTGGCATGGTTGAAATGAATTGTGAGGATCTAAAAAGTGTTTGTTTTTTATAGAAAAAATAAAAAATAAAAATTAAAGAAAAAAAAAAAAG
  5   1   2       bld Gas7      in                         XZG33398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACACCATACTTTTGTTCTTTACACTATTGTAAGTGAAAATACTTAAATAATCTTATAAACTATGGGATATTTATATGCGCAACATCTATTGAATAAACATCTCAGAATGTCTTTTTAACACCTACAGTAATTTGCATGGCCTTAAAGCACCCAGCACAATAACGACTCCTTAACCTTATTTATTAGATTGCATTTCAGGTAGAAAATAAAGTGAATTTTCAGTATTTTTGTCTGAATACACACTCATGTTCCTTTTTTGTTTACCGATCTAACTGTAAAATAGAGGGTTCAATATTTTCTTGAGTATGTGGTTGTTTAGAAACCTGTCTTTTGGTAAAAGAACAAAATAAGAACATGACGGATCAAAATGTTCTATTATAAATTATATTACCATTATTCTAGTGACTTTTTTCTAGGCTGATACATTGTTAATGGACTGGAATGAGTAGCAATGTTGAAATCTGAAGGCAAGCACAATTGGTTGAAAATAAGTCTAGTAAACTTGGATGGCTGGATCGTAGCTGGAAATCTTGGCATGGTTGAAATGAATTGTGAGGATCTAAAAAGTGTTTGTTTTTTATAGaaaaaataaaaaataaaaattaaagaaaaaaaaaaaagaaaaaaaaaaaaaaaaaGG

In case of problems mail me! (