Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ20116.5                           7 END     1          10       14                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 223.0    0Xt7.1-TGas082a01.3                         49 PI      72          4      747                Activin A receptor, type IIB [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012155722 Xt7.1-ANHP1976.5.5 - 10 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-ANHP1976.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGTCTTGGCAAAATGAGTATGAAATCTACAACCTCCCTGGGATGAAGCACGAGAATATCCTGCAGTTCATCGGCGCCGAAAAGCGCGGCACCAACCTCGACACGGATCTGTGGTTAATTACTGCTTTCCATGAAAAGGGCTCCCTCACTGACTATCTGAAAGCCAACGTGGTGTCTTGGAATGAGCTGTGCCACATCGCTGAGACAATGGCCAGGGGCTTAGCTTACCTCCACGAAGATATCCCGGGGCTGAAGGATGGACACAAGCCTGCGGTGGCGCATAGGGATATCAAAAGCAAAAACATTCTCCTAAAAAACAGCCTGACAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTTCCGCCCAAGGAATCGAGCCTATGATACCCCTCGGTCGTGGTTACCCAGACCAACCGGACTCTGGCGCAGAGCTGCTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGCTCTTTTGCAGATCGTCCCGTTTGGACGCCCCACCGACGACTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTATCGACAAAATCATTCGAAAAGGAATGAAAGAACCAATGAAGAAACCCGACCCTAATAAACTGACCCCCGTTTTTTGTTTTTAAAACCCGTCAGACAAAAAGACTAATATTCCGGGAACTACTGCGTTTTTGTTTTTTTTTTTTTTAAATCAAAGCATTTCATTTCAGATTTAAAGGGTAACTGTTTTTATTGCATTTGCCGTTGTGTTTCTCTCAATGACTATTGTAACGTCATCATGACACAGCTTGTGAATGTTCCGTGTGCTGCTGTTCCGTGTATATAAACCCTAAAGTAATCAACGTGGGATATATTAAAAGAGGCTTCCAAGCAGACTGTAACCTCCCTCAACAAGGTATACCTCAGCTCCACCTTCTCA
                                                  Xt7.1-CHK-1008267073                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGCAAAATGAGTATGAAATCTACAACCTCCCTGGGATGAAGCACGAGAATATCCTGCAGTTCATCGGCGCCGAAAAGCGCGGCACCAACCTCGACACGGATCTGTGGTTAATTACTGCTTTCCATGAAAAGGGCTCCCTCACTGACTATCTGAAAGCCAACGTGGTGTCTTGGAATGAGCTGTGCCACATCGCTGAGACAATGGCCAGGGGCTTAGCTTACCTCCACGAAGATATCCCGGGGCTGAAGGATGGACACAAGCCTGCGGTGGCGCATAGGGATATCAAAAGCAAAAACATTCTCCTAAAAAACAGCCTGACAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTTCCGCCCAAGGAATCGAGCCTATGATACCCCTCGGTCGTGGTTACCCAGACCAACCGGACTCTGGCGCAGAGCTGCTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGCTCTTTTGCAGATCGTCCCGTTTGGACGCCCCACCGACGACTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTATCGACAAAATCATTCGAAAAGGAATGAAAGAACCAATGAAGAAACCCGACCCTAATAAACTGACCCCCGTTTTTTGTTTTTAAAACCCGTCAGACAAAAAGACTAATATTCCGGGAACTACTGCxxxxTTGTTTTTTTTTTTTTTAAATCAAAGCATTTCATTTCAGATTTAAAGGGTAACTGTTTTTATTGCATTTGCCGTTGTGTTTCTCTCAATGACTATTGTAACGTCATCATGACACAGCTTGTGAATGTTCCGTGTGCTGCTGTTCCGTGTATATAAACCCTAAAGTAATCAACGTGGGATATATTAAAAGAGGCTTCCAAGCAGACTGTAACCTCCCTCAACAAGGTATACCTCAGCTCCACCTTCTCACGAAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     3     4     3     4     3     4     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     5     4     5     4     5     4     5     4     5     4     5     4     5     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2
  5   1   2       e50                                 Xt7.1-ANHP1976.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGTCTTGGCAAAATGAGTATGAAATCTACAACCTCCCTGGGATGAAGCACGAGAATATCCTGCAGTTCATCGGCGCCGAAAAGCGCGGCACCAACCTCGACACGGATCTGTGGTTAATTACTGCTTTCCATGAAAAGGGCTCCCTCACTGACTATCTGAAAGCCAACGTGGTGTCTTGGAATGAGCTGTGCCACATCGCTGAGACAATGGCCAGGGGCTTAGCTTACCTCCACGAAGATATCCCGGGGCTGAAGGATGGACACAAGCCTGCGGTGGCGCATAGGGATATCAAAAGCAAAAACATTCTCCTAAAAAACAGCCTGACAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTTCCGCCCAAGGAATCGAGCCTATGATACCCCTCGGTCGTGGTTACCCAGACCAACCGGACTCTGGCGCAGAGCTGCTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGCTCTTTTGCAGATCGTCCCGTTTGGACGCCCCACCGACGACTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTATCGA
  5   1   2       e50                                 Xt7.1-XZG26833.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAACGTGGACTTTCCGCCCAAGGAATGGAGCCTATGATACCCCTCGGTGGGGGTTACCCAGACCAACCGGATTCTGGCGCAGAGCTGTTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGTTTTTTTGCAGATCGTCCCGTTTGGACGCCCCCCCGATGATTTTTACAACCCGGAGACTTGTTTCTTTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTTTCGCCAAAATCATTCGAAAAGGAATGAAAGAACCAATGAAGAAACCCGACCCTAATAAACTGACCCCCGTTTTTTGTTTTTAAAACCCGTCAGACAAAAAGACTAATATTCCGGGAACTACTGCTACGTTTTTTTTTTTTTTTTTAAATCAAAGCATTTCATTTCAGATTTAAAGGGTAACTGTTTTTATTGCATTTGCCGTTGTGTTTCTCTCAATGACTATTGTAACGTCATCATGACACAGCTTGTGAATGTTCCGTGTGCTGCTGTTCCGTGTATATAAACCCTAAAGTAATCAACGTGGGATATATTAAAAGAGGCTTCCAAGCAGACTGTAACCTCCCTCAACAAGGTATACCTCAGCTCCACCTTCTCACGAAATTCTCAGATACCGCGGAAAAACACTAAGAAATTCGAAGAATAAATCCACCCCCTTTTTATCGTTTTTTTTTTTTATTGCTGTATTGCCAAAATTCAGTTGTTCGATTTTTAAAGGGTAAGCTACGCTGAAACCATTTTTGTTTTTGACTAGTGGAGGAGTTGGGTAGTGCATTCGGCCTTCTTGCCGCAGTCCGGCGTGTCGGCGGAGTATTCCGAACCCTCCTCGGGAATAAGGGAAACTTAAGACTGGTGTTTTTAGATTCGGCCTTATTTATTACTACGGAGACTTCTGTTGACTAACGCGACCCATTCTGTTGGCGTCTAATCAGATAATAATCCGATAGATGGAATGATCGGCGCAGCAAGGCAGTAAAGGGAGGTTCCCATGACGTGGAACCTTCCCACCATGAAAGACTTGCTGTCCCAGTCATTGGTTTATTGGGTTACAT
                                                                       ...PROTEIN --- Bf ---- 2e-008     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bb ---- 8e-011     BAA84727.1 FGFR [Branchiostoma belcheri] ---------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 6e-016     NP_014101.1 Involved in localizing cell growth with respect to the septin ring; Cla4p[Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 1e-046     NP_001021148.1 abnormal DAuer Formation family member (daf-4) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 1e-088     BAE06728.1 transforming growth factor beta receptor [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 5e-093     NP_731926.1 punt CG7904-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 8e-105     XP_780388.2 PREDICTED: similar to activin receptor:ISOTYPE=IIA, partial [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ---- 3e-132     AAH76986.1 Activin A receptor, type IIB [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 2e-151     XP_689012.1 PREDICTED: similar to activin receptor IIA [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 9e-159     NP_031422.2 activin receptor IIA [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 1e-159     NP_001607.1 activin A type II receptor precursor [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Gg ---- 3e-163     NP_990698.1 activin receptor IIA [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 9e-165     AAB20638.1 activin receptor [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- ?? ---- 9e-165     NP_001084061.1 activin receptor [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-ANHP1976.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------TGA---------------------------------------------------TAA------------------------------------------------------TGAATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------TAA---------------------------------------------------------------------------------------TAA------------------------------------------ATG------------------TGA---------TGAATG---------------------------------TAA---------------------TAA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       e50                                 Xt7.1-ANHP1976.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGTCTTGGCAAAATGAGTATGAAATCTACAACCTCCCTGGGATGAAGCACGAGAATATCCTGCAGTTCATCGGCGCCGAAAAGCGCGGCACCAACCTCGACACGGATCTGTGGTTAATTACTGCTTTCCATGAAAAGGGCTCCCTCACTGACTATCTGAAAGCCAACGTGGTGTCTTGGAATGAGCTGTGCCACATCGCTGAGACAATGGCCAGGGGCTTAGCTTACCTCCACGAAGATATCCCGGGGCTGAAGGATGGACACAAGCCTGCGGTGGCGCATAGGGATATCAAAAGCAAAAACATTCTCCTAAAAAACAGCCTGACAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTTCCGCCCAAGGAATCGAGCCTATGATACCCCTCGGTCGTGGTTACCCAGACCAACCGGACTCTGGCGCAGAGCTGCTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGCTCTTTTGCAGATCGTCCCGTTTGGACGCCCCACCGACGACTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTATCGA
                                                  Xt7.1-CHK-1008240191                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGCAAAATGAGTATGAAATCTACAACCTCCCTGGGATGAAGCACGAGAATATCCTGCAGTTCATCGGCGCCGAAAAGCGCGGCACCAACCTCGACACGGATCTGTGGTTAATTACTGCTTTCCATGAAAAGGGCTCCCTCACTGACTATCTGAAAGCCAACGTGGTGTCTTGGAATGAGCTGTGCCACATCGCTGAGACAATGGCCAGGGGCTTAGCTTACCTCCACGAAGATATCCCGGGGCTGAAGGATGGACACAAGCCTGCGGTGGCGCATAGGGATATCAAAAGCAAAAACATTCTCCTAAAAAACAGCCTGACAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTTCCGCCCAAGGAATCGAGCCTATGATACCCCTCGGTCGTGGTTACCCAGACCAACCGGACTCTGGCGCAGAGCTGCTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGCTCTTTTGCAGATCGTCCCGTTTGGACGCCCCACCGACGACTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTATCGACAAAAT
  5   1   0       add Te1       out                       CBWN10907.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCATTTCTAACTCGATCCCCCTCCTCCCTGGTTCATCAAAGCAATTGTGGGTTAATGAATTTTGCCAGACCATAATGCAATGAACTCCTCCTTATCTGTAAGCCTGTGATGCGAGCAGCAGCTGGGGAAAGGGAGGAACTTTTTCACATGGGGCTAGCCATATTCTTCATTTCCAGGGTGCCACAGCCTGGAAATGACCTGTGCTCTGATAAACTTCACTCACACATTACTGCTGCGCTGCAAGTTGGAGTGATATCCCCCCACCCCCAGCAGCCAATCAGCAGAACAATGGGAAGGGAGCAAGATAGCAGCTCCCAGTAGGTATCAGAATAGCACTCAATAGTAAGAAATCCAAGTCCGGCTTGGGACTCCTCCAGTTACATGAGAGTAGGAGAAACAATAGGTTACTTAGTGTGCGAGTGGGTTTGTACTCATGCATTTACAGCCACGTCTTTTGTTTTCCGTTTAAAGGATAAACTGTCTTGGCAAAATGAGTATGAAATCTACAACCTCCCTGGGATGAAGCACGAGAATATCCTGCAGTTCATCGGCGCCGAAAAGCGCGGCACCAACCTCGACACGGATCTGTGGTTAATTACTGCTTTCCATGAAAAGGTGAGCTTGCCCTTA
  3   1   2       bld Brn3      out                        CAAK6023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGGGATTAAAGCCATTGCAGCTGCTGGAGGTAAAAGCCAGAGGGAGGTTCGGCTGCGTGTGGAAAGCCCAGTTATTAAATGAAACCGTAGCTGTCAAGATATTCCCAATACAGGATAAACTGTCTTGGCAAAATGAGTATGAAATCTACAACCTCCCTGGGATGAAGCACGAGAATATCCTGCAGTTCATCGGCGCCGAAAAGCGCGGCACCAACCTCGACACGGATCTGTGGTTAATTACTGCTTTCCATGAAAAGGGCTCCCTCACTGACTATCTGAAAGCCAACGTGGTGTCTTGGAATGAGCTGTGCCACATCGCTGAGACAATGGCCAGGGGCTTAGCTTACCTCCACGAAGATATCCCGGGGCTGAAGGATGGACACAAGCCTGCGGTGGCGCATAGGGATATCAAAAGCAAAAACATTCTCCTAAAAAACAGCCTGACAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCAC
  5   1   2       bld Gas7      in                         XZG26833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCAGAGGGAGGTTCGGCTGCGTGTGGAAAGCCCAGTTATTAAATGAAACCGTAGCTGTCAAGATATTCCCAATACAGGGCTCCCTCACTGACTATCTGAAAGCCAACGTGGTGTCTTGGAATGAGCTGTGCCACATCGCTGAGACAATGGCCAGGGGCTTAGCTTACCTCCACGAAGATATCCCGGGGCTGAAGGATGGACACAAGCCTGCGGTGGCGCATAGGGATATCAAAAGCAAAAACATTCTCCTAAAAAACAGCCTGACAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTT
  5   1   2       bld HeRe      in                     EC2CAA38DH07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCGCGGCACCAACCTCGACACGGATCTGTGGTTAATTACTGCTTTCCATGAAAAGGGCTCCCTCACTGACTATCTGAAAGCCAACGTGGTGTCTTGGAATGAGCTGTGCCACATCGCTGAGACAATGGCCAGGGGCTTAGCTTACCTCCACGAAGATATCCCGGGGCTGAAGGATGGACACAAGCCTGCGGTGGCGCATAGGGATATCAAAAGCAAAAACATTCTCCTAAAAAACAGTCTGACAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCAT
  5   1   2      seed Neu5      in                         ANHP1976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCCTGTATAGCAGATTTCGGCCTCGCCTTAAAGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTTCCGCCCAAGGAATCGAGCCTATGATACCCCTCGGTCGTGGTTACCCAGACCAACCGGACTCTGGCGCAGAGCTGCTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGCTCTTTTGCAGATCGTCCCGTTTGGACGCCCCACCGACGACTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTATCGACAAAATCAATCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu5      in                         ANHP1976.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTCGAAGCTGGGAAATCTGCAGGGGACACTCACGGCCAGGTCGGAACCCGCAGGTACATGGCCCCCGAGGTGTTAGAAGGTGCTATCAATTTCCAGAGAGATGCCTTTTTAAGGATAGACATGTATGCCTTTGGCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTTCCGCCCAAGGAATCGAGCCTATGATACCCCTCGGTCGTGGTTACCCAGACCAACCGGACTCTGGCGCAGAGCTGCTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGCTCTTTTGCAGATCGTCCCGTTTGGACGCCCCACCGACGACTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTATCGACAAAATCAATC
  3   1   2       bld Gas7 PIPE out                        XZG59587.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTTAGTACTCTGGGAGCTGGCGTCGAGGTGCACTGCCTCGGATGGTCCAGTCGATGAGTACATGTTACCTTTTGAAGAAGAAGTTGGGCAGCACCCATCTCTGGAAGACATGCAGGAAGTGGTAGTGCACAAAAAGAAAAGACCCATCTTAAGGGAGTGCTGGCAGAAACATGCTGGAATGGCGATGCTCTGCGAAACCATAGAGGAGTGCTGGGATCACGACGCGGAAGCCCGGTTGTCGGCCGGCTGCGTCGAAGAGCGAATCATTCAAATGCAAAAACTCACAAACATTATCACAACCGAGGACATTGTCACAGTGGTCACGATGGTGACAAACGTGGACTTTCCGCCCAAGGAATCGAGCCTATGATACCCCTCGGTCGTGGTTACCCAGACCAACCGGACTCTGGCGCAGAGCTGCTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGCTCTTTTGCAGATCGTCCCGTTTGGACGCCCCACCGATGACTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTATCGACAAAATCAATCGAAAAGGAATGAAAGAAACAATGAAGAAACACGAACCTAATAAACTGACACCCGTTTTTTGTTTTTAAAACACGTCAGACAAAAAGACTAATTTTCC
  5   1   2       e50                                 Xt7.1-XZG26833.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAACGTGGACTTTCCGCCCAAGGAATGGAGCCTATGATACCCCTCGGTGGGGGTTACCCAGACCAACCGGATTCTGGCGCAGAGCTGTTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGTTTTTTTGCAGATCGTCCCGTTTGGACGCCCCCCCGATGATTTTTACAACCCGGAGACTTGTTTCTTTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTTTCGCCAAAATCATTCGAAAAGGAATGAAAGAACCAATGAAGAAACCCGACCCTAATAAACTGACCCCCGTTTTTTGTTTTTAAAACCCGTCAGACAAAAAGACTAATATTCCGGGAACTACTGCTACGTTTTTTTTTTTTTTTTTAAATCAAAGCATTTCATTTCAGATTTAAAGGGTAACTGTTTTTATTGCATTTGCCGTTGTGTTTCTCTCAATGACTATTGTAACGTCATCATGACACAGCTTGTGAATGTTCCGTGTGCTGCTGTTCCGTGTATATAAACCCTAAAGTAATCAACGTGGGATATATTAAAAGAGGCTTCCAAGCAGACTGTAACCTCCCTCAACAAGGTATACCTCAGCTCCACCTTCTCACGAAATTCTCAGATACCGCGGAAAAACACTAAGAAATTCGAAGAATAAATCCACCCCCTTTTTATCGTTTTTTTTTTTTATTGCTGTATTGCCAAAATTCAGTTGTTCGATTTTTAAAGGGTAAGCTACGCTGAAACCATTTTTGTTTTTGACTAGTGGAGGAGTTGGGTAGTGCATTCGGCCTTCTTGCCGCAGTCCGGCGTGTCGGCGGAGTATTCCGAACCCTCCTCGGGAATAAGGGAAACTTAAGACTGGTGTTTTTAGATTCGGCCTTATTTATTACTACGGAGACTTCTGTTGACTAACGCGACCCATTCTGTTGGCGTCTAATCAGATAATAATCCGATAGATGGAATGATCGGCGCAGCAAGGCAGTAAAGGGAGGTTCCCATGACGTGGAACCTTCCCACCATGAAAGACTTGCTGTCCCAGTCATTGGTTTATTGGGTTACAT
                                                  Xt7.1-CHK-1008247228                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGACTTTCCGCCCAAGGAATGGAGCCTATGATACCCCTCGGTGGGGGTTACCCAGACCAACCGGATTCTGGCGCAGAGCTGTTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGTTTTTTTGCAGATCGTCCCGTTTGGACGCCCCCCCGATGATTTTTACAACCCGGAGACTTGTTTCTTTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTTTCGCCAAAATCATTCGAAAAGGAATGAAAGAACCAATGAAGAAACCCGACCCTAATAAACTGACCCCCGTTTTTTGTTTTTAAAACCCGTCAGACAAAAAGACTAATATTCCGGGAACTACTGCTACGTTGTTTTTTTTTTTTTTAAATCAAAGCATTTCATTTCAGATTTAAAGGGTAACTGTTTTTATTGCATTTGCCGTTGTGTTTCTCTCAATGACTATTGTAACGTCATCATGACACAGCTTGTGAATGTTCCGTGTGCTGCTGTTCCGTGTATATAAACCCTAAAGTAATCAACGTGGGATATATTAAAAGAGGCTTCCAAGCAGACTGTAACCTCCCTCAACAAGGTATACCTCAGCTCCACCTTCTCACGAAATTCTCCGATACCGCGGAAAAxxxCTAAGAAATTCGAAGAATAAATCCACCCCCTTTTTATCGTTTTTTTTTTTTATTGCTGTATTGCCAAAATTCAGTTGTTCGATTTTTAAAGGGTAAGCTACGCTGAAACCATTTTTGTTTTTGACTAGTGGAGGAGTTGGGTAGTGCATTCGGCCTTCTTGCCGCAGTCCGGCGTGTCGGCGGAGTATTCCGAACCCTCCTCGGGAATAAGGGAAACTTAAGACTGGTGTTTTTAGATTCGGCCTTATTTATTACTACGGAGACTTCTGTTGACTAACGCGACCCATTCTGTTGGCGTCTAATCAGATAATAATCCGATAGATGGAATGATCGGCGCAGCAAGGCAGTAAAGGGAGGTTCCCATGACGTGGAACCTTCCCACCATGAAAGACTTGCTGTCCCAGTCATTGGTTTATTGGG
  3   1   1       add Gas7      in                         XZG26833.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAACGTGGACTTTCCGCCCAAGGAATGGAGCCTATGATACCCCTCGGTGGGGGTTACCCAGACCAACCGGATTCTGGCGCAGAGCTGTTAAGCTAAAGGGGAACTTCTGCCTAATGAAAATGATATAAACCGGCAAAGGTCCGCGTGAATGGAGGCGGGGGGGTTGTTTTTTTGCAGATCGTCCCGTTTGGACGCCCCCCCGATGATTTTTACAACCCGGAGACTTGTTTCTTTCCACGCAAACGCCCCGAAGGACTCGCCGCGGGTTTTTTTCGCCAAAATCATTCGAAAAGGAATGAAAGAACCAATGAAGAAACCCGACCCTAATAAACTGACCCCCGTTTTTTGTTTTTAAAACCCGTCAGACAAAAAGACTAATATTCCGGGAACTACTGCTACGTTTTTTTTTTTTTTTTTAAATCAAAGCATTTCATTTCAGATTTAAAGGGTAACTGTTTTTATTGCATTTGCCGTTGTGTTTCTCTCAATGACTATTGTAACGTCATCATGACCCAGCTTGTGAATGTTCCGTGGGCTGCTGTTCCGTGTATATAAACCCTAAAGTAATCAACGTGGGATATATTAAAAGGGGCTTCCAGGC
  3   1   2      seed HeRe      in                     EC2CAA38DH07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCCCCGACGCCTCTTACAACCCGGAGACTTGTTTCATTCCACGCAAACGCCCTGAAGGACTCGCCGCGGGTTTTTATCGACAAAATCAATCGAAAAGGAATGAAAGAAACAATGAAGAAACACGAACCTAATAAACTGACACCCGTTTTTTGTTTTTAAAACACGTCAGACAAAAAGACTAATATTACGTGAACTACTGCTACGTTTTTGTTTTTTTTTTTTTTAAATCAAAGCATTTCATTTCAGATTTAAAGGGTAACTGTTTTTATTGCATTTGCCGTTGTGTTTCTCTCAATGACTATTGTAACGTCATCATGACACAGCTTGTGAATGTTCCGTGTGCTGCTGTTCCGTGTATATAAACCCTAAAGTAATCAACGTGGGATATATTAAAAGAGGCTTCCAAGCAGACTGTAACCTCCCTCAACAAGGTATACCTCAGCTCCACCTTCTCACGAAATTCTCAGATACCGCGGAAAACACTAAG
  5   1   2       bld Neu                            TNeu011n02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTATTGCATTTGCCGTTGTGTTCCTCTCAATGACTATTGTAACGTCATCATGACACAGCTTGTGAATGTTCCGTGTGCTGCTGTTCCGTGTATATAAACCCTAAAGTAATCAACGTGGGATATATTAAAAGAGGCTTCCAAGCAGACTGTAACCTCCCTCAACAAGGTATACCTCAGCTCCACCTTCTCACGAAATTCTCCGATACCGCGNGAAAACACTAAGAAATTCGAAGAATAAATCCACCCCCTTTTTATCGTTTTTTTTTTTTATTGCTGTATTGCCAAAATTCAGTTGTTCGATTTTTAAAGGGTAAGCTACGCTGAAACCATTTTTGTTTTTGACTAGTGGAGGAGTTGGGTAGTGCATTCGGCCTTCTTGCCGCAGTCCGGCGTGTCGGCGGAGTATTCCGAACCCTCCTCGGGAATAAGGGAAACTTAAGACTGGTGTTTTTAGATTCGGCCTTATTTATTACTACGGAGACTTCTGTTGACTAACGCGACCCATTCTGTTGGCGTCTAATCAGATAATAATCCGATAGATGGAATGATCGGCGCAGCAAGGCAGTAAAGGGAGGTTCCCATGACGTGGAACCTTCCCACCATGAAAGACTTGCTGTCCCAGTCATTGGTTTATTGGGTTACATTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)