Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN11443.5                           6 END     4          33       66                nuclear receptor coactivator 1 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012155731 Xt7.1-XZT27335.3.5 - 12 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT27335.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGACCTTGGAATCACCGAGCCGCAGTTTGGGCAGCCAGGAATTGGGGACCAGATACCCTGGAACGATGGGTTGGCGCCCATGAACCGCGTTACCCAGAGTGCACAGGAAGAGATTGACGACTTTCTGTGCCCCCCCACCACGGCCGAGGGACGCAATGACGAGAAGGCTCTGCTGGAGCAGCTCGTCTCCTTTCTCAGCGGCAAAGACGAGAACGAGCTGGCGGAACTAGACCGCGCCTTGGGGATTGACAAACTAGTGCAGGGAGGAGGTCTGGATGTGGTAAATGATCGGTTTCCTCAGCAATCCATTGCTCCTGTCATAATGGAGCAGAAGCCGGGCCTGTACCCCCAGCAATATCCTTCTGCTTCACCCAACCCAGGCCTCCCCTTCTTCAACATGGTCAGGCAGAAGGCTGCATTTGGGTCTGTCCCTGTCCAGGTACAACCTCCTCAGGCCCGTGGTACCTACCCCAATACCATGGGGATGCAGCCACGGCAGGCACTGGCGCGCTCAGTAACCACGTCCAACCAGCTACGGCTCCAGCTGCAGCAGCGACTACAGGGCCAGCAGCAGGTTCTGCACCAGAATCGGCAAGCCAACCTGAACCAGTTTGGAGTAGTCAATACCGTGGCCATGGGCATGAGGCCTGGCATGCAGCAAGCCATTTCCACCCAGCAGCCCCCGCTCAATGCTCAGATGTTGGCTCAGCGACAGAGGGAACTGTACAGCCAGCAGCATCGTCAGAGGCAGTTAATGCAGCAACGAAGCATCCTCATGAGGCAACAGGGCTTTGGGAACAGTCTGGCCCCTGCAGGAAGCCTGCCTGTCACTATGGGGGCCGGCCGACTCCCCCAGGGCCCCCCACAACAATTCCCTTATCCTCACAGCTACCGTACGAACCCTGGAAATCCTCCCCCATCCACCAGTCCCTTCTCGCCTTTGGCGACGACTCCCGAGGCCACGTTAGCCAACCGCGGCGGAGGAAATGGCAATGGCATTGTGAACAGAGGCATGATGGGAAACGTCGGAGGACAGTTTGGCTCTGGGATCAACCCTCAGATGCAGCAAAATGTCTTCCAGTATTCGGCAACGGGTATCAGCCAGCAAGGTGATCCAACCTTCGCTCCATCACTCAGCCCAACCAGTCCGCTCATGTCCCCCCGTATTACTCCCTCTCAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGCAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATATGCCTCTATATATATATATTCTGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAACAA
                                                  Xt7.1-CHK-1008267076                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGAATCACCGAGCCGCAGTTTGGGCAGCCAGGAATTGGGGACCAGATACCCTGGAACGATGGGTTGGCGCCCATGAACCGCGTTACCCAGAGTGCACAGGAAGAGATTGACGACTTTCTGTGCCCCCCCACCACGGCCGAGGGACGCAATGACGAGAAGGCTCTGCTGGAGCAGCTCGTCTCCTTTCTCAGCGGCAAAGACGAGAACGAGCTGGCGGAACTAGACCGCGCCTTGGGGATTGACAAACTAGTGCAGGGAGGAGGTCTGGATGTGGTAAATGATCGGTTTCCTCAGCAATCCATTGCTCCTGTCATAATGGAGCAGAAGCCGGGCCTGTACCCCCAGCAATATCCTTCTGCTTCACCCAACCCAGGCCTCCCCTTCTTCAACATGGTCAGGCAGAAGGCTGCATTTGGGTCTGTCCCTGTCCAGGTACAACCTCCTCAGGCCCGTGGTACCTACCCCAATACCATGGGGATGCAGCCACGGCAGGCACTGGCGCGCTCAGTAACCACGTCCAACCAGCTACGGCTCCAGCTGCAGCAGCGACTACAGGGCCAGCAGCAGGTTCTGCACCAGAATCGGCAAGCCAACCTGAACCAGTTTGGAGTAGTCAATACCGTGGCCATGGGCATGAGGCCTGGCATGCAGCAAGCCATTTCCACCCAGCAGCCCCCGCTCAATGCTCAGATGTTGGCTCAGCGACAGAGGGAACTGTACAGCCAGCAGCATCGTCAGAGGCAGTTAATGCAGCAACCAAGCATCCTCATGAGGCAACAGGGCTTTGGGAACAGTCTGGCCCCTGCAGGAAGCCTGCCTGTCACTATGGGGGCCGGCCGACTCCCCCAGGGCCCCCCACAACAATTCCCTTATCCTCACAGCTACCGTACGAACCCTGGAAATCCTCCCCCATCCACCAGTCCCTTCTCGCCTTTGGCGACGACTCCCGAGGCCACGTTAGCCAACCGCGGCGGAGGAAATGGCAATGGCATTGTGAACAGAGGCATGATGGGAAACGTCGGAGGACAGTTTGGCTCTGGGATCAACCCTCAGATGCAGCAAAATGTCTTCCAGTATTCGGCAACGGGTATCAGCCAGCAAGGTGATCCAACCTTCGCTCCATCACTCAGCCCAACCAGTCCGCTCATGTCCCCCCGTATTACTCCCTCTCAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGCAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATATGCCTCTATATATATATATTCTGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAACAAAAAAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     5     6     6     6     5     5     5     5     5     5     5     5     5     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3
  5   1   2      ests                                 Xt7.1-XZT27335.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGATGTAAAAGTAAAAGTGGAAAAGGAACAGGTTGATCAGTGCAGCTCCACTCCTACCACATTGATCAAAGCTGGTCAAGAGGATATTAAATTAGAGACCCAAAACCAGTTTGCAGATGATTTTGACCAACTCGATCAGTTGTTGCCTACACTGGACAAAGCAGCCCAACTACCGGGAATGGTGCCTGACCGGACAGACAACAGTGTCCCACTAAAGACGGAGATGTTACCCTCGTCACTGCAAACAGGCACTGTGGCGAGAACCCCCACCCGATTAAACAATTTTAATGGAATGAACACAAACCAATCCCCGTTTGGATTCTGTGACCCTATGGACCCCGTGCAGTTGGATTTGAACCCATTTCCAGCACCAAGTGACACCAGCCCACGTTCTGGACTAACACCGGACCAGGGACGTGGTGTAACGCATGACGCAACTGCTTTCCAATCTGATCCAGGCTTGCCAGATCCTGACCTTGGAATCACCGAGCCGCAGTTTGGGCAGCCAGGAATTGGGGACCAGATACCCTGGAACGATGGGTTGGCGCCCATGAACCGCGTTACCCAGAGTGCACAGGAAGAGATTGACGACTTTCTGTGCCCCCCCACCACGGCCGAGGGACGCAATGACGAGAAGGCTCTGCTGGAGCAGCTCGTCTCCTTTCTCAGCGGCAAAGACGAGAACGAGCTGGCGGAACTAGACCGCGCCTTGGGGATTGACAAACTAGTGCAGGGAGGAGGTCTGGATGTGGTAAATGATCGGTTTCCTCAGCAATCCATTGCTCCTGTCATAATGGAGCAGAAGCCGGGCCTGTACCCCCAGCAATATCCTTCTGCTTCACCCAACCCAGGCCTCCCCTTCTTCAACATGGTCAGGCAGAAGGCTGCATTTGGGTCTGTCCCTGTCCAGGTACAACCTCCTCAGGCCCGTGGTACCTACCCCAATACCATGGGGATGCAGCCACGGCAGGCACTGGCGCGCTCAGTAACCACGTCCAACCAGCTACGGCTCCAGCTGCAGCAGCGACTACAGGGCCAGCAGCAGGTTCTGCACCAGAATCGGCAAGCCAACCTGAACCAGTTTGGAGTAGTCAATACCGTGGCCATGGGCATGAGGCCTGGCATGCAGCAAGCCATTTCCACCCAGCAGCCCCCGCTCAATGCTCAGATGTTGGCTCAGCGACAGAGGGAACTGTACAGCCAGCAGCATCGTCAGAGGCAGTTAATGCAGCAACGAAGCATCCTCATGAGGCAACAGGGCTTTGGGAACAGTCTGGCCCCTGCAGGAAGCCTGCCTGTCACTATGGGGGCCGGCCGACTCCCCCAGGGC
  5   1   2      ests                                 Xt7.1-XZT27335.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGGATCAACCCTCAGATGCAGCAAAATGTCTTCCAGTATTCGGCAACGGGTATCAGCCAGCAAGGTGATCCAACCTTCGCTCCATCACTCAGCCCAACCAGTCCGCTCATGTCCCCCCGTATTACTCCCTCTCAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGCAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATATGCCTCTATATATATATATTCTGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAACAA
                                                                       ...PREDICTED - Sp ---- 2e-007     XP_785298.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 1e-009     NP_501749.1 PAX transcription activation domain interacting protein (4K558) [Caenorhabditiselegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-010     NP_729947.2 CG32133-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 3e-075     NP_571852.1 transcriptional intermediary factor 2 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 5e-076     CAB45389.1 TIF2 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-121     XP_691744.1 PREDICTED: similar to nuclear receptor coactivator 1 isoform 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 0          XP_982042.1 PREDICTED: similar to Nuclear receptor coactivator 1 (NCoA-1) (Steroid receptor coactivator 1) (SRC-1) (Nuclear receptor coactivator protein 1) (mNRC-1) isoform 3 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_671766.1 nuclear receptor coactivator 1 isoform 3 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_001012900.1 nuclear receptor coactivator 1 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT27335.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------ATG------------------------------------------ATG------------------------------------------------------ATG------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------ATG------------------------------------ATG---------ATG---ATG------------ATG------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------TAA------------TAG---------------------------------------------TGA------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2      ests                                 Xt7.1-XZT27335.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGATGTAAAAGTAAAAGTGGAAAAGGAACAGGTTGATCAGTGCAGCTCCACTCCTACCACATTGATCAAAGCTGGTCAAGAGGATATTAAATTAGAGACCCAAAACCAGTTTGCAGATGATTTTGACCAACTCGATCAGTTGTTGCCTACACTGGACAAAGCAGCCCAACTACCGGGAATGGTGCCTGACCGGACAGACAACAGTGTCCCACTAAAGACGGAGATGTTACCCTCGTCACTGCAAACAGGCACTGTGGCGAGAACCCCCACCCGATTAAACAATTTTAATGGAATGAACACAAACCAATCCCCGTTTGGATTCTGTGACCCTATGGACCCCGTGCAGTTGGATTTGAACCCATTTCCAGCACCAAGTGACACCAGCCCACGTTCTGGACTAACACCGGACCAGGGACGTGGTGTAACGCATGACGCAACTGCTTTCCAATCTGATCCAGGCTTGCCAGATCCTGACCTTGGAATCACCGAGCCGCAGTTTGGGCAGCCAGGAATTGGGGACCAGATACCCTGGAACGATGGGTTGGCGCCCATGAACCGCGTTACCCAGAGTGCACAGGAAGAGATTGACGACTTTCTGTGCCCCCCCACCACGGCCGAGGGACGCAATGACGAGAAGGCTCTGCTGGAGCAGCTCGTCTCCTTTCTCAGCGGCAAAGACGAGAACGAGCTGGCGGAACTAGACCGCGCCTTGGGGATTGACAAACTAGTGCAGGGAGGAGGTCTGGATGTGGTAAATGATCGGTTTCCTCAGCAATCCATTGCTCCTGTCATAATGGAGCAGAAGCCGGGCCTGTACCCCCAGCAATATCCTTCTGCTTCACCCAACCCAGGCCTCCCCTTCTTCAACATGGTCAGGCAGAAGGCTGCATTTGGGTCTGTCCCTGTCCAGGTACAACCTCCTCAGGCCCGTGGTACCTACCCCAATACCATGGGGATGCAGCCACGGCAGGCACTGGCGCGCTCAGTAACCACGTCCAACCAGCTACGGCTCCAGCTGCAGCAGCGACTACAGGGCCAGCAGCAGGTTCTGCACCAGAATCGGCAAGCCAACCTGAACCAGTTTGGAGTAGTCAATACCGTGGCCATGGGCATGAGGCCTGGCATGCAGCAAGCCATTTCCACCCAGCAGCCCCCGCTCAATGCTCAGATGTTGGCTCAGCGACAGAGGGAACTGTACAGCCAGCAGCATCGTCAGAGGCAGTTAATGCAGCAACGAAGCATCCTCATGAGGCAACAGGGCTTTGGGAACAGTCTGGCCCCTGCAGGAAGCCTGCCTGTCACTATGGGGGCCGGCCGACTCCCCCAGGGC
                                                  Xt7.1-CHK-1008251977                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAAAAGTAAAAGTGGAAAAGGAACAGGTTGATCAGTGCAGCTCCACTCCTACCACATTGATCAAAGCTGGTCAAGAGGATATTAAATTAGAGACCCAAAACCAGTTTGCAGATGATTTTGACCAACTCGATCAGTTGTTGCCTACACTGGACAAAGCAGCCCAACTACCGGGAATGGTGCCTGACCGGACAGACAACAGTGTCCCACTAAAGACGGAGATGTTACCCTCGTCACTGCAAACAGGCACTGTGGCGAGAACCCCCACCCGATTAAACAATTTTAATGGAATGAACACAAACCAATCCCCGTTTGGATTCTGTGACCCTATGGACCCCGTGCAGTTGGATTTGAACCCATTTCCAGCACCAAGTGACACCAGCCCACGTTCTGGACTAACACCGGACCAGGGACGTGGTGTAACGCATGACGCAACTGCTTTCCAATCTGATCCAGGCTTGCCAGATCCTGACCTTGGAATCACCGAGCCGCAGTTTGGGCAGCCAGGAATTGGGGACCAGATACCCTGGAACGATGGGTTGGCGCCCATGAACCGCGTTACCCAGAGTGCACAGGAAGAGATTGACGACTTTCTGTGCCCCCCCACCACGGCCGAGGGACGCAATGACGAGAAGGCTCTGCTGGAGCAGCTCGTCTCCTTTCTCAGCGGCAAAGACGAGAACGAGCTGGCGGAACTAGACCGCGCCTTGGGGATTGACAAACTAGTGCAGGGAGGAGGTCTGGATGTGGTAAATGATCGGTTTCCTCAGCAATCCATTGCTCCTGTCATAATGGAGCAGAAGCCGGGCCTGTACCCCCAGCAATATCCTTCTGCTTCACCCAACCCAGGCCTCCCCTTCTTCAACATGGTCAGGCAGAAGGCTGCATTTGGGTCTGTCCCTGTCCAGGTACAACCTCCTCAGGCCCGTGGTACCTACCCCAATACCATGGGGATGCAGCCACGGCAGGCACTGGCGCGCTCAGTAACCACGTCCAACCAGCTACGGCTCCAGCTGCAGCAGCGACTACAGGGCCAGCAGCAGGTTCTGCACCAGAATCGGCAAGCCAACCTGAACCAGTTTGGAGTAGTCAATACCGTGGCCATGGGCATGAGGCCTGGCATGCAGCAAGCCATTTCCACCCAGCAGCCCCCGCTCAATGCTCAGATGTTGGCTCAGCGACAGAGGGAACTGTACAGCCAGCAGCATCGTCAGAGGCAGTTAATGCAGCAACGAAGCATCCTCATGAGGCAACAGGGCTTTGGGAACAGTCTGGCCCCTGCAGGAAGCCTGCCTGTCACTATGGGGGCCGGCCGACTCCCCCAGGGCCCCCAC
  5   1   2       bld Te3       in                        CAAM14851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGATGTAAAAGTAAAAGTGGAAAAGGAACAGGTTGATCAGTGCAGCTCCACTCCTACCACATTGATCAAAGCTGGTCAAGAGGATATTAAATTAGAGACCCAAAACCAGTTTGCAGATGATTTTGACCAACTCGATCAGTTGTTGCCTACACTGGACAAAGCAGCCCAACTACCGGGAATGGTGCCTGACCGGACAGACAACAGTGTCCCACTAAAGACGGAGATGTTACCCTCGTCACTGCAAACAGGCACTGTGGCGAGAACCCCCACCCGATTAAACAATTTTAATGGAATGAACACAAACCAATCCCCGTTTGGATTCTGTGACCCTATGGACCCCGTGCAGTTGGATTTGAACCCATTTCCAGCACCAAGTGACACCAGCCCACGTTCTGGACTAACACCGGACCAGGGACGTGGTGTAACGCATGACGCAACTGCTTTCCAATCTGATCCAGGCTTGCCAGATCCTGACCTTGGAATCACCGAGCCGCAGTTTGGGCAGCCAGGAATTGGGGACCAGATACCCTGGAACGATGGGTTGGCGCCCATGAACCGCGTTACCCAGAGTGCACAGGAAGAGATTGACGACTTTCTGTGCCCCCCCACCACGGCCGAGGGACGCAATGACGAGAAGGCTCTGCTGGAGCAGCTCGTCTCCTTTCTCAGTGGCAAAGACGAGAACGAGCTGGCGGAACTAGACCGCGCCTTGNGGATTGACAAACTAGTACAGGGAGGAGGTCTGGATGTGGTAAATGATCGGTTTCCTCAGCAATCCATTGCTCCTGTCATAATGNAGC
  5   1   2      seed Tad5      in                         XZT27335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGACCTTGGAATCACCGAGCCGCAGTTTGGGCAGCCAGGAATTGGGGACCAGATACCCTGGAACGATGGGTTGGCGCCCATGAACCGCGTTACCCAGAGTGCACAGGAAGAGATTGACGACTTTCTGTGCCCCCCCACCACGGCCGAGGGACGCAATGACGAGAAGGCTCTGCTGGAGCAGCTCGTCTCCTTTCTCAGCGGCAAAGACGAGAACGAGCTGGCGGAACTAGACCGCGCCTTGGGGATTGACAAACTAGTGCAGGGAGGAGGTCTGGATGTGGTAAATGATCGGTTTCCTCAGCAATCCATTGCTCCTGTCATAATGGAGCAGAAGCCGGGCCTGTACCCCCAGCAATATCCTTCTGCTTCACCCAACCCAGGCCTCCCCTTCTTCAACATGGTCAGGCAGAAGGCTGCATTTGGGTCTGTCCCTGTCCAGGTACAACCTCCTCAGGCCCGTGGTACCTACCCCAATACCATGGGGATGCAGCCACGGCAGGCACTGGCGCGCTCAGTAACCACGTCCAACCAGCTACGGCTCCAGCTGCAGCAGCGACTACAGGGCCAGCAGCAGGTTCTGCACCAGAATCGGCAAGCCAACCTGAACCAGTTTGGAGTAGTCAATACCGTGGCCATGGGCATGAGGCCTGGCATGCAGCAAGCCATTTCCACCCAGCAGCCCCCGCTCAATGCTCAGATGTTGGCTCAGCGACAGAGGGAACTGTACAGCCAGCAGCATCGTCAGAGGCAGTTAATGCAGCAACGAAGCATCCTCATGAGGCAACAGGGCTTTGGGAACAGTCTGGCCCCTGCAGGAAGCCTGCCTGTCACTATGGGGGCCGGCCGACTCCCCCAGGGCCCCCAC
  5   1   2      ests                                 Xt7.1-XZT27335.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGGATCAACCCTCAGATGCAGCAAAATGTCTTCCAGTATTCGGCAACGGGTATCAGCCAGCAAGGTGATCCAACCTTCGCTCCATCACTCAGCCCAACCAGTCCGCTCATGTCCCCCCGTATTACTCCCTCTCAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGCAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATATGCCTCTATATATATATATTCTGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAACAA
                                                  Xt7.1-CHK-1008236001                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAACCCTCAGATGCAGCAAAATGTCTTCCAGTATTCGGCAACGGGTATCAGCCAGCAAGGTGATCCAACCTTCGCTCCATCACTCAGCCCAACCAGTCCGCTCATGTCCCCCCGTATTACTCCCTCTCAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGCAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATATGCCTCTATATATATATATTCTGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAACAAAAAAAC
  5   1   2       bld Spl2      in                        CBSS9149.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATTCGCTCGCACCCACGCGCTCCGGCCCCCGCTCAATGCTCAGATGTTGGCTCAGCGACCGAGGGAACTGTACAGCCCGCAGCATCCTCAGAGGCAGTTAATGCAGCAACCAAGCATCCTCATGAGGCAACAGGGCTTTGGGAACAGTCTGGCCCCTGCAGGAAGCCTGCCTGTCACTATGGGGGCCGGCCGACTCCCCCAGGGCCCCCCACAACAATTCCCTTATCCTCACAGCTACCGTACGAACCCTGGAAATCCTCCCCCATCCACCAGTCCCTTCTCGCCTTTGGCGACGACTCCCGAGGCCACGTTAGCCAACCGCGGCGGAGGAAATGGCAATGGCATTGTGAACAGAGGCATGATGGGAAACGTCGGAGGACAGTTTGGCTCTGGGATCAACCCTCAGATGCAGCAAAATGTCTTCCAGTATTCGGCAACGGGTATCAGCCAGCAAGGTGATCCAACCTTCGCTCCATCACTCAGCCCAACCAGTCCGCTCATGTCCCCCCGTATTACTCCCTCTCAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCA
  3   1   2       bld Te4       out                       CAAN11443.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGGATCAACCCTCAGATGCAGCAAAATGTCTTCCAGTATTCGGCAACGGGTATCAGCCAGCAAGGTGATCCAACCTTCGCTCCATCACTCAGCCCAACCAGTCCGCTCATGTCCCCCCGTATTACTCCCTCTCAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGCAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATATGCCTCTATATAT
  3   1   2       bld Te3  5g3  out                        CAAM6511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCAACCCTCAGATGCAGCAAAATGTCTTCCAGTATTCGGCAACGGGTATCAGCCAGCAAGGTGATCCAACCTTCGCTCCATCACTCAGCCCAACCAGTCCGCTCATGTCCCCCCGTATTACTCCCTCTCAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGCAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTCTAGAAAAATATATATGCCTCTATATATAT
  5   1   2       bld Abd0                               IMAGE:7017792                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGCCCCATGCTTCAGCAAACGCCATCCACGCCTGGGTACCAGTCACCTGACCTCAAGACGTGGCAGCAGAGTCCCCTGGGCAATTCTGGGGTTTTTAGCCAAGGGGGACAGACGCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGCAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATATGCCTCTATATATATATATTCTGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCCGTAGACAAAGGACGGATTTCTC
  3   1   2       bld Spl2      in                        CBSS9149.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGCCCCCGCCTGGCCAGCAGGGAATGTACAACAACATGAGCATCACAGTTTCTATGGGAGGGGGCAACACTGGTGTCCAGAATGTGAATCAAATGACCGGACAGATGCAGATGAGTTCCCTTCCCATGTCCAACATGAACGCTATGTGCACAGAACAGGTGAGTGATCCAGCACTGAGGCCAAGTGGGCTGTACTGCAACCAGCTTTCCTCTACAGACCTGCTGAAAACAGAGCCAGAGACGGGCCAGGTGCAGCAGGTACAGGTCTTTGCCGACGTCCAGTGCACGGTGAATTTGGTGGGCGGTGACCCCTATATTAACCAACCGGGATCCATCACCTCACAGAAGGCAACGACCGGACCCCAGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATATGCCTCTATATATATATATTCGGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTGCGGGCGGCGTCGGACGTTTGC
  3   1   2      seed Tad5      in                         XZT27335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACGCCTCAGGCTCAGCAAAAGAGCCTCTTACAGCAACTGCTGACGGAATGAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGACCGAGTTATAGAAAAATATATATGCCTCTATATATATATATTCTGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAAC
  3   1   2       bld Te3  5g3  out                        CAAM5075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGCGGGGCCCCCACCGAGCCACGCAAGAGCCACGGAGAGTAACAGAACGAGTTATAGAAAAATATATAGGCCTCTATATATATATATTCTGTACATTTGCGGTGATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAACAAAAAAACAC
  3   1   2       bld Brn2                                CAAJ22913.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAG
  3   1   2       bld Te3       in                        CAAM14851.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTCCTCGGCAACGGCAGCCATTTACGGGGGGTTCGAAAAGGCGTAGAGAGACGCGTTCCCGTCCGTAGGACAAAGGACGGATTTCTCGCCGCAGTTCTGTTTCCATTTCCCCTTTAAACCCCCCCCCCACTTTGGAGAACGCTCGGGCGGCGTCGGACGTTTGCAAAAAGAAAGAGAGAGTTTTTGCAGGGCTGGGACAATCGGACCCCCGGGGTCCCCATTTCGAGCCAAATGATAGATGAAAACTTATTTTTGTACGCAGTCGCTGTGATGACACTGAATGGTTCCGGGCAAACGCGCGGAGAGAATGTCGCAAAGAGAACTCAGTTTCAGCTGGTTCTGTCACTGATGTGGAACCCCCCCACCGGAGAGGCGGAGAAGAGGAGGGTTCTGGGTAATTTACGGGTGGCGGGGACGGGGGAAATAAGAGAAAAGTATATATATATATTATACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAACAAAAAAACAC
  3   1   2       bld Brn2 FL   out                       CAAJ24025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGAGGTAAAGCGCATCTTTGTTGCAGCTGAAGTGCATTTGTAGAGCTATCTCTGGCTTGTATGTACAATCATGTTTTTCTACGTGGGAGGCTTGCTTTGCGCACCTTTTTTAGGGCCTGTTTTTAACCCCTTGGCCGCTGGCGCGGCGATCGGGCAGCCCGCAATGTTCATGAATTTCTTGGCAAGAAAAAAAAACAAAAAAACACAAAAAAAAGAGAAAAATCTTTGAGATCATCGTCACAGGTTCATTGAATCTTTCCGCTTTCCATCTGTAATCCATAGAGATGAGGTTCTTGGCAGCCTGACGGGCTACAGGGCTCTCCCCTCCATTGTCGGGGGCTACGTTCTTGTTCTGGTAAGCACTTGTATTCCAGCAATCAGCAGATTACCAAGGTTACAAAAACAACAAAAGGAACGTCTAACGATGATGTTTTTATCTCTTTTCAACAACATGGGAAGCCATAGGGCGCCTTCAGTCCTCCTCCGACGTCAGCCATGTTTGAGCGTCAGCCATGTTTGTTTCAGGTCTTGAGAAGGTTGTCGAGATGAAGCCAGACCAACTCATGTCTCGGTGGCTGGCGCAGACTATATATAAGCTCTAATGAATAGTACCTAGCACCTTTTGTTTAATAAAAGGGGTGTAACGATGTCATGAAAACAAAGAAACAGGCAAAAAAAAATGGATTGTAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)