Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 07 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM3016.5                            4 END     1           5       33                Discoidin domain receptor family, member 2 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012155732 Xt7.1-XZT56469.3.5 - 20 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT56469.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAACCGCCAGGAACGACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCAGCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGCATGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAAGGACCGACCAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCCACACCAGCATCTCTGGGCCCTCGGACCCCTCGGTTCTGCCGGAGGCAAAGTTGCACATCCCAACGGTCGAGCTGGGACTGAGGACTGGAAAGGAGGAGGAGCTACATGGCTCACTGAGGCCCCTCCTCTCTGTATGTAAATATATGTGAGTGTGAGTGTGAGCGTGAGTGGGTACTTGGGCTCCCGCTGCCACTGCACAGATTGTATATATTTATTCAGTGCCCGCCTCCCTGGCACCGACACTCTGTACATAGAAGCCAATCATCTCCTGTGCCCTCGGGGGGGGGGGGGGGCAATTCCTCTCGCCCAATCGGACACAGGACCAAGGATGCCAACGCCCGTGTGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGGATCTTT
                                                  Xt7.1-CHK-1008267630                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAGGAACGACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCAGCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGCATGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAAGGACCGACCAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCCACACCAGCATCTCTGGGCCCTCGGACCCCTCGGTTCTGCCGGAGGCAAAGTTGCACATCCCAACGGTCGAGCTGGGACTGAGGACTGGAAAGGAGGAGGAGCTACATGGCTCACTGAGGCCCCTCCTCTCTGTATGTAAATATATGTGAGTGTGAGTGTGAGCGTGAGTGGGTACTTGGGCTCCCGCTGCCACTGCACAGATTGTATATATTTATTCAGTGCCCGCCTCCCTGGCACCGACACTCTGTACATAGAAGCCAATCATCTCCTGTGCCCTCGGGGGGGGGGGGGGGCAATTCCTCTCGCCCAATCGGACACAGGACCAAGGATGCCAACGCCCGTGTGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     5     6     5     6     6     6     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     6     4     5     4     5     4     5     4     5     3     4     3     4     2     3     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     2     3     3     4     3     5     3     5     4     6     6     6     6     6     6     6     5     6     5     6     6     7     6     6     4     6     5     6     7     7     7     7     4     7     6     8     6     8     5     8     8     8     8     8     9    10    10    10     7    10    10    10    10    10     7    10     8    10     8    10    10    10     7    10     5    10    10    10    10    10     7    10    10    10     8    10     6    10     7    10     8    11     7    11     9    11     9    11     9    11     9    11     7    10     9    10     6    10     6    10     6    10     5    10     5    10     5     9     5     5     5     5     5     5     5     5
  5   1   2      ests                               Xt7.1-THdA046n12.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAACCGCCAGGAACGACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCAGCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGCATGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAAGGACCGACCAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCCACACCAGCATCTCTGGGCCCTCGGACCCCTCGGTTCTGCCGGAGGCAAAGTTGCACATCCCAACGGTCGAGCTGGGACTGAGGACTGGAAAGGAGGAGGAGCTACATGGCTCACTGAGGCCCCTCCTCTCTGTATGTAAATATATGTGAGTGTGAGTGTGAGCGTGAGTGGGTACTTGGGCTCCCGCTGCCACTGCACAGATTGTATATATTTATTCAGTGCCCGCCTCCCTGGCACCGACACTCTGTACATAGAAGCCAATCATCTCCTGTGCCCTCGGGGGGGGGGGG
  5   1   2      ests                                 Xt7.1-XZT56469.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACAGGACCAAGGATGCCAACGCCCGTGTGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGGATCTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sc ---- 6e-017     NP_009411.1 Promotes the exit from mitosis by directly switching on the kinase activity ofDbf2. Required for mitosis and sporulation, cell division cycle blocked at 36C.; Cdc15p [Saccharomyces cerevisiae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bb ---- 2e-040     BAA84741.1 src-like A-1 [Branchiostoma belcheri] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 5e-040     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Br ---- 2e-042     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bf ---- 1e-052     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 9e-058     NP_001014474.2 Discoidin domain receptor CG33531-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 2e-061     NP_508573.1 domain (86.9 kD) (XD941) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 2e-080     CAD58831.1 discoidin receptor [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-088     XP_001202828.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 9e-096     AAH60755.1 MGC69083 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 9e-103     NP_072075.1 discoidin domain receptor family, member 2 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-103     NP_006173.2 discoidin domain receptor family, member 2 precursor [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - ?? ---- 6e-107     XP_700879.1 PREDICTED: similar to discoidin domain receptor family, member 2, partial [Danio rerio] ----------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-107     XP_693702.1 PREDICTED: similar to Discoidin domain receptor 2 precursor (Receptor protein-tyrosine kinase TKT) (Tyrosine-protein kinase TYRO 10) (Neurotrophic tyrosine kinase, receptor-related 3) [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 2e-125     NP_001012818.1 general transcription factor II H, polypeptide 4 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-142     AAI21932.1 Discoidin domain receptor family, member 2 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT56469.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------ATG------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------TAA------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGA---TGA---TGA---TGA------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------TAA------------------------------TAA---------------------------------------------TAA---------------------------------------------TAG------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------TGATGAATG---------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2      ests                               Xt7.1-THdA046n12.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAACCGCCAGGAACGACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCAGCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGCATGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAAGGACCGACCAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCCACACCAGCATCTCTGGGCCCTCGGACCCCTCGGTTCTGCCGGAGGCAAAGTTGCACATCCCAACGGTCGAGCTGGGACTGAGGACTGGAAAGGAGGAGGAGCTACATGGCTCACTGAGGCCCCTCCTCTCTGTATGTAAATATATGTGAGTGTGAGTGTGAGCGTGAGTGGGTACTTGGGCTCCCGCTGCCACTGCACAGATTGTATATATTTATTCAGTGCCCGCCTCCCTGGCACCGACACTCTGTACATAGAAGCCAATCATCTCCTGTGCCCTCGGGGGGGGGGGG
                                                  Xt7.1-CHK-1008237650                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAGGAACGACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCAGCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGCATGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAAGGACCGACCAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCCACACCAGCATCTCTGGGCCCTCGGACCCCTCGGTTCTGCCGGAGGCAAAGTTGCACATCCCAACGGTCGAGCTGGGACTGAGGACTGGAAAGGAGGAGGAGCTACATGGCTCACTGAGGCCCCTCCTCTCTGTATGTAAATATATGTGAGTGTGAGTGTGAGCGTGAGTGGGTACTTGGGCTCCCGCTGCCACTGCACAGATTGTATATATTTATTCAGTGCCCGCCTCCCTGGCACCGACACTCTGTACATAGAAGCCAATCATCTCCTGTGCCCTCGGGGGG
  5   1   2      skin Tad5      in                         XZT56469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTCCTGCCTGACCATGGGAAAGAGAGCAGCCCAGGAGCAGGAAGTACAGAGAATCAGAGCTCTGTACCTGGGTAAGTACTGGGGGGAGATTGGATTCACTTACCCAGGGGGGGGGGTTCCTGCCTGACCATGGGAAAGAGAGCAGCCCAGGAGCAGGAAGTACAGAGAATCAGAGCTCTGTACCTGGGTAAGTACTGGGGGGAGATTGTATTCACTTACCCAGGGGGGGGGGTTCCTGCCTGACCATGGGAAAGAGAGCAGCCCAGGAGCAGGAAGTACAGAGAATCAGAGCTCTGTACCTGGGTAAGTACTGGGGGGAGATTGGATTCACTTACCCAGGGGGGGGGGGTTCCTGCCTGACCATGGGAAAGAGAGCAGCCCCGGAGCAGGAAGTACAGAGAATCAGAGCTCTGTACCTGGGTAAGTACTGGGGGGAGATTGGATTCCCTTACCCAGAGGGGAGGTTCCTGCCTGACCATGGGAAAGAGAGCAACCCCGGAGCAGGAAGTACAGAAAATCAGAGCTCTGTACCTGGGTAAGTACTGGGGGGGAGTTCGGGGTCACCTACCCAATGGGAGAGTTCCCAGGGGTAACTGAGTGCCAGTCTAATTCCCCATTTCTCTGCCACAGGGCAAGTTTACCACCTGCAGAGATGCCTGGGCCTTCCGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACCGCGTTCTAACCGACGAGCAGGTGAT
  5   1   2       bld Gas8      in                          st81c12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGTGGCCGTGAAGATGCTGAGACCCGACGTTCACCAAAACCGCCAGGAACGACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCAGCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGCATGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGA
  5   1   2      seed HdA                            THdA046n12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGACCCGACGTCACCAAAACCGCCAGGAACGACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCAGCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGCATGAGCCGCAACCTGTACAGCGGTGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAAGGACCGACCAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGNGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAG
  5   1   2       bld Gas8      in                          st94a05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAACCGCCAGGAACGACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCAGCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGCATGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCC
  5   1   2       bld Gas8      in                          st95a05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACNACTTTCTGAAGGAGATAAAGATCATCTCCCGCCTGAAGCACCCCAACATTATCCGCCTCCTGGGGGTGTGTGTGCGGGACGACCCCCTCTGTATGATCACCGAGTATATGGAGAATGGGGACCTCAACCAGTTCCTGTCCCAGCGGGAAATCCGCANCCAATTCACCAAAGCCAACAACATCCCGTCTGTGAGCCGGCAGAACCTCCTGTATATGGCCGCGCAGATTGCCGCCGGCATGAAGTATCTGGCGTCGCTCAACTTTGTGCACCGGGACCTGGCGACCCGCAACTGCCTCGTGGGCAACAGCTACACCATCAAGGTGGCCGACTTCGGNATGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGNATGGCCTGGGAGAGNATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGNNCCTTCGGNGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACNGGCGAGTTCTTCCGGGACCAGGGCANACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAANGANCGACCAA
  5   1   2       chi In63                            IMAGE:8959985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTTCAGGGGGGGCCGACTTCGGCATTGAGCCGCAACCTGTACAGCGGCGACTACTACCGCATCCAGGGCCGGGCCGTGCTGCCCATACGTTGGATGGCCTGGGAGAGCATCCTGCTGGGCAAGTTTACCACCTGCAGTGATGCCTGGGCCTTCGGGGTGACCCTGTGGGAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGGTAGGGGCAGATACAGTTGGGTGCTGAGGCATCACTCCAGCCATTTTGTGGGGGAAGCACTATGGCAGCACCAACTGAGTGGCTTGCGTTTCCCTTGGCAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAAGGACCGACCAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCACACCAGCATCTCTGGGCCCTCGGACCCCTCGGGTTCTGCCGGAGGCAAAGTTGCACATCCCAACGGTCGAGCTGGGACTGAGGACTGGAAGGAGGAGGAGCTACATGGCTCACTGAGCCCTCTCTCTGTTGTAATAATGTGATGTGATGGTGACGTGATGGGTACTGGTCTCCGCTGCCTGGCAGATGATTATTTATTCATGCCGCCTCCCTGCACGAACCTCTGTACATAAAGCATA
  5   1   2       bld Neu                            TNeu073n18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATGTTCAGTCTGTGCAAGGAGCAGCCGTACAGCGTTCTAACCGACGAGCAGGTGATCGAGAACACGGGCGAGTTCTTCCGGGACCAGGGCAGACAGATTTACCTTTCCCAGACTCCCCTGTGCCCCGGCCCAGTCTTCGAGTTGATGATGCGGTGCTGGAGCCGAGACATCAAGGACCGACCAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCCACACCAGCA
  5   1   2       bld Te3                                  CAAM1432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAACCTTCGAGACGATTCACCACTTCCTGATCGAGCAGTTGGACTGTGCCGCCTAAACCTGCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCCACACCAGCATCTCTGGGCCCTCGGACCCCTCGGTTCTGCCGGAGGCAAAGTTGCACATCCCAACGGTCGAGCTGGGACTGAGGACTGGAAAGGAGGAGGAGCTACATGGCTCACTGAGGCCCCTCCTCTCTGTATGTAAATATATGTGAGTGTGAGTGTGAGCGTGAGTGGGTACTTGGGCTCCCGCTGCCACTGCACAGATTGTATATATTTATTCAGTGCCCGCCTCCCTGGCACCGACACTCTGTACATAGAAGCCAATCATCTCCTGTGCCCTCGGGGGGGGGGGGGGGCAATTCCTCTCGCCCAATCGGACACAGGACCAAGGATGCCAACCCCCGTGTGATGGCACAAAGGGTGAAAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGGGGGCGGTGCCAAACAGGGGGCCGGCCCA
  5   1   2       bld AbdN                               IMAGE:7005088                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCGCCTTGGGCTTGTGAGGGGGCACTAAGGACTAGTTGCCCAGCCAGCGTGGGGCAGTGTGCCTGGGACTGGACTAGCCTGGGCAACCTTTAGTTTTCTAGATGTAGATGGACCAAGAGACATTGGGGGGGAAATCTCCAGGGGCCACACCAGCATCTCTGGGCCCTCGGACCCCTCGGTTCTGCCGGAGGCAAAGTTGCACATCCCAACGGTCGAGCTGGGACTGAGGACTGGAAAGGAGGAGGAGCTACATGGCTCACTGAGGCCCCTCCTCTCTGTATGTAAATATATGTGAGTGTGAGTGTGAGCGTGAGTGGGTACTTGGGCTCCCGCTGCCACTGCACAGATTGTATATATTTATTCAGTGCCCGCCTCCCTGGCACCGACACTCTGTACATAGAAGCCAATCATCTCCTGTGCCCTCGGGGGGGGGGGGGGN
  5   1   2      ests                                 Xt7.1-XZT56469.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACAGGACCAAGGATGCCAACGCCCGTGTGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGGATCTTT
                                                  Xt7.1-CHK-1008235544                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACCAAGGATGCCAACGCCCGTGTGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGG
  5   1   2       bld Te4                                  CAAN4710.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCGCCCAATTGGACACAGGACCAAGGATGCCAACGCCCGTGTGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGGGGGGCACCCTCCACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCCGGTCCCCCCCCCTCGACCCGGTGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAAACTGGGTCTGTGGGATTATCTGTAG
  3   1   2       bld Tad5      in                         XZT56469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACAGGACCAAGGATGCCAACGCCCGTGTGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTTTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGGATCTTTCC
  3   1   2       add Gas8      in                          st15n09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGGATGCCAACGCCCGTGTGATGGCANGAAGGGTGANAAAGGGCCCCCCCCCGGGAGTGAAGGGGTTAANAGCCTAANGNGTGGGNGGTGCCAANCAGGGGGCCGGCNCAGGGATTGCCCCNCCCNCCTGTNTCACAAACANTTAATGGCCGTGGGCAGCGCTGATTAATTNCCNCTAAACGAGCGGGGTGATNGGATTGCAANCAGTTTGGNNCANTGGTAGTTAACCCTTTTGTGCCCCCCAGGACTGCNCAGGGCACCGGTANAACCNNTAGGGGGTCCCGNTGATTAACCCTTTCAGGGGNGNTGANTATTGTGTTTTANAACCACTTGCCCTTTGCTCCCCCCGANANAAAGAGGGGCNCCCTTTANTGCCCCAAGTGCCAACTGTGCCCGGTTANTGGNGCCGCCCCGGCCGGTCCCCCCCCCTNGACCCGGNGCCGANAGNGAGAGAGTTGTTTTTCCCNCACTGGATTTGTATTTGATGAATGTCACTCACGGGTCCCCCAAATATTNTTTTACGGACCCAGTAANGTGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCGCAATGGACTGAAGTGCAATGG
  5   1   2       bld Gas8      in                          st15n09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGCCCGTGTGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGG
  3   1   2      seed Te4  FL   out                        CAAN2096.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATGGCACGAAGGGTGAGAAAGGGCCCCCCCCGGGAGTGAAGGGGTTAATAGCCTAATGTGTGGGCGGTGCCAAGCAGGGGGCCGGCACAGGGATTGCCCCGCCCACCTGTATCACAAACAGTTAATGGCCGTGGGCAGCGCTGATTAATTACCACTAAACGAGCGGGGTGATCGGATTGCAAGCAGTTTGGCGCACTGGTAGTTAACCCTTCTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGGATCTTTCC
  3   1   2       add Gas8      in                          st81c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAACAGGGGGCCGGCNCAGGGATTGCCCCNCCCNCCTNTNTCANAAACANTTAATGGCCGTGGGCAGCGCTGATTAATTACCNNTAAACGAGNGGGGTGATNGGATTNCAANCANTTTGGNNCANTGGTANTTAACCCTTTTGTGCCCCCCAGGACTGCNCAGGGCACCGGTANAACCNNTAGGGGGTCCCGNTGATTAACCCTTTCAGGGGNGNTGANTATTGTNTTTTANAACCACTTGCCNTTTGNTCCCCCCGANANAAANAGGGGCNCCCTTTANTGCCCCAAGTGCCAACTGTGCCCGGTTANTGGNGCCGCCCCGGCCGGTCCCCCCCCCTNGACCCGGNGCCGANAGNGANANAGTTGTTTTTCCCNCACNGGATTTGTNTTTGATGAATGTCACTCACGGGTCCCCCAAATATTNTTTTACGGACCCAGTAATGTGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCGCAATGGACTGAAGTG
  3   1   2       add Gas8      in                          st94a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAANANTTAATGGCCGNGGGCAGCGNTGATTAATTACCNNTAAACGAGNGGGGTGATNGGATTNCAANCANTTTGGCNCANTGGTAGTTAACCCTTTTGTGCCCCCCAGGANTGCNCAGGGCACCGGTANAACCNNTAGGGGGTCCCGNTGATTAACCCTTTCAGGGGNGNNGANTNTTGTNTTTTANAACCACTTGCCNTTTGNTCCCCCCGANANAAANAGGGGCNCCCTTTANTGCCCCAAGTGCCAACTGTGCCCGGTTANTGGNGCCGCCCCGGCCGGTCCCCCCCCCTNGACCCGGNGCCGANAGNGANANAGTTNTTTTTCCCNCNCNGGATTTGTNTTTGATGAATGTCACTCNCGGGTCCCCCAAATATTNTTTTACGGACCCAGTAATGNGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCGCAATGGACTGAAGTGC
  3   1   2       bld Te3                                  CAAM2490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACGAGCGGGGTGATCGGATTGCAAGCATTTTGGCGCACTGGTAGTTAACCCTTTTGTGCCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGATTATTGTGTTTTATAACCACTTGCCTTTTGCTCCCCCCGAGATAAAGAGGGGCACCCTTTATTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTGGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGGATCTTTC
  3   1   2       bld Te4       in                         CAAN5027.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGGATCTTTCC
  5   1   2       bld Te4       in                         CAAN5027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCCCAGGACTGCACAGGGCACCGGTATAACCACTAGGGGGTCCCGCTGATTAACCCTTTCAGGGGCGCTGACTATTGTGTTTTATAACCACTTGCCCTCTGCTCCCCCCGAGATAAAGAGGGGCACCCTCTACTGCCCCAAGTGCCAACTGTGCCCGGTTACTGGTGCCGCCCCGGCCGGTCCCCCCCCCTCGACCCGGCGCCGATAGCGAGAGAGTTGTTTCTCCCACACTGGATTTGTATCTGATGAATGTCACTCACGGGTCCCCCAAATATTGTTTTACGGACCCAGTAATGTGGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGACTGGGTCTGTGGGATTATCTGTAGCCACAATGGACTGAAGTGCAATGGGAATCTGTATTGCCCAATAAATATGAGCCGGATCTTTCCAAAAAAAAAAAAAAA
  3   1   2       add Gas8      in                          st95a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTTNTTTNTCCCNCNCNGGATTTGNNTTTGATNAATNNCANTCCCGGGTCCCCCAAATACTTNTTTTNCGGACCCNANAATGTGGGGGGGGGGGGTTGGTTCTGTTGATACTGTACTACTGTCACGCTGCAGAGATCTNGGNNTGTGGGATTATCTGTAGCCGCAATGGACTGAAGTGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)