Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012155734 Xt7.1-CABA3696.5.5 - 13 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABA3696.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGAGGAGTGCGCCGAATGTTTACGTGGAAATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGTAACTGGTGACAGATTTCCCCCGACAGCAAACAGTACAGCAGACCTTGTGAGGGAAGAAGAAGAATTCGAAGTGCGAGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGTGATGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTNCACTTACTACAAACCTTCAACAAGCAAGAAAGGAGAAAGATGAAATAATGAAAGAGTTTCTTGAACTTACAGAACAAAGCCAAAAATTTAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAACAATAGTCATACAAGTACAGCTGCAGATCTTCTGCAATCCAAGCAGCAAATACTCGCTTATCAGCAACAGCTGGAAGAACAGGAGCATCGGCTAAAACTTTATCAGAAAGATAATGAAAGCTACAAGGCACATAACGAATCCCTGCAGGCCAAGATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCGTATAAAAGAAGGTTAAACGAAAAAGATGTGTCCATTGACAATATGAAAATAGCATTACAGGAGGAAGAAAGCAAATCAAGCCAACTAACTGAAAGAATTTCACTGTTTGAAAAATCAGCAGAAGAACTGAGACAAGAGTTAGTAATAAAACATCAGGAAATAAATAACCTGGCTGAGGAACTTAGCTCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAATCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACCACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAATTAGAATTTACATTAAAAGAGGAGCTTGAACGACAAAAGAACACATTTTCATTTGCAGAGAAAAATTTTGAGGTCAATTTCCATGAATTACAAGAAGAATATACATGCCTTTTAAAGATAAAGAATCAATTAGAAGATAGC
                                                  Xt7.1-CHK-1008266800                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGTGCGCCGAATGTTTACGTGGAAATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGTAACTGGTGACAGATTTCCCCCGACAGCAAACAGTACAGCAGACCTTGTGAGGGAAGAAGAAGAATTCGAAGTGCGAGAGxxTGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGxGxTGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTNCACTTACTACAAACCTTCAACAAGCAAGAAAGGAGAAAGATGAAATAATGAAAGAGTTTCTTGAACTTACAGAACAAAGCCAAAAATTTAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAACAATAGTCATACAAGTACAGCTGCAGATCTTCTGCAATCCAAGCAGCAAATACTCGCTTATCAGCAACAGCTGGAAGAACAGGAGCATCGGCTAAAACTTTATCAGAAAGATAATGAAAGCTACAAGGCACATAACGAATCCCTGCAGGCCAAGATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCGTATAAAAGAAGGTTAAACGAAAAAGATGTGTCCATTGACAATATGAAAATAGCATTACAGGAGGAAGAAAGCAAATCAAGCCAACTAACTGAAAGAATTTCACTGTTTGAAAAATCAGCAGAAGAACTGAGACAAGAGTTAGTAATAAAACATCAGGAAATAAATAACCTGGCTGAGGAACTTAGCTCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAATCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACCACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAATTAGAATTTACATTAAAAGAGGAGCTTGAACGACAAAAGAACACATTTTCATTTGCAGAGAAAAATTTTGAGGTCAATTTCCATGAATTACAAGAAGAATATACATGCCTTTTAAAGATAAAGAATCAATTAGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     6     6     6     6     6     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                                Xt7.1-CAAN11630.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCACTGACTTCTCTCGCCGCTGCCGGGCGCTGGGGTGACGTCAGAGGAGTGCGCCGAATGTTTACGTGGAAATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGTAACTGGTGACAGATTTCCCCCGACAGCAAACAGTACAGCAGACCTTGTGAGGGAAGAAGAAGAATTCGAAGTGCGAGAGACTGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTNCACTTACTACAAACCTTCAACAAGCAAGAAAGGAGAAAGATGAAATAATGAAAGAGTTTCTTGAACTTACAGAACAAAGCCAAAAATTTAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAAACATAGTCATANCAGTACAGCTGCAGATCTTCTGCAAATCAAGCAG
  5   1   2      ests                                 Xt7.1-CABA3696.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCCAAGATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCGTATAAAAGAAGGTTAAACGAAAAAGATGTGTCCATTGACAATATGAAAATAGCATTACAGGAGGAAGAAAGCAAATCAAGCCAACTAACTGAAAGAATTTCACTGTTTGAAAAATCAGCAGAAGAACTGAGACAAGAGTTAGTAATAAAACATCAGGAAATAAATAACCTGGCTGAGGAACTTAGCTCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAATCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACCACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAATTAGAATTTACATTAAAAGAGGAGCTTGAACGACAAAAGAACACATTTTCATTTGCAGAGAAAAATTTTGAGGTCAATTTCCATGAATTACAAGAAGAATATACATGCCTTTTAAAGATAAAGAATCAATTAGAAGATAG
                                               BLH ATG      99     686                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      99     128                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      99     646                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -42       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Cs ==== 4e-010     AAX84194.1 cytospin A [Ciona savignyi] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bf ---- 5e-014     CAA11444.1 intermediate filament protein C1 [Branchiostoma floridae] --------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bb ---- 4e-023     BAC16746.1 myosin heavy chain [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 6e-026     NP_611787.2 CG3493-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                    PROTEIN --- Ci ---- 3e-027     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 3e-027     NP_508635.1 M protein repeat containing protein (XE304) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-029     AAW88309.1 ventricular myosin heavy chain [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 1e-029     NP_001085151.1 hypothetical protein LOC432231 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-032     XP_782330.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 5e-035     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Dr ---- 4e-050     XP_692773.1 PREDICTED: similar to A-kinase anchor protein 9 (Protein kinase A anchoring protein 9) (PRKA9) (A-kinase anchor protein 450 kDa) (AKAP 450) (A-kinase anchor protein 350 kDa) (AKAP 350) (hgAKAP 350) (AKAP 120-like protein) (Hyperion protein) (Yotiao protein [Danio rerio]  ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 2e-150     CAJ81717.1 A kinase (PRKA) anchor protein (yotiao) 9 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 1e-154     NP_997062.1 A-kinase anchor protein 9 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 0          NP_919444.1 A kinase (PRKA) anchor protein (yotiao) 9 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_005742.4 A kinase anchor protein 9 isoform 2; yotiao; A-kinase anchoring protein 450;AKAP120-like protein [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABA3696.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAG------TAG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------ATG------------------------------------------ATG------------------------------------------------------------ATGATG------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                         ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   1           Egg  FLt3                   TEgg139l02.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCCACTGACTTCTCTCGCCGCTGCCGGGCGCTGGGGTGACGTCAGAGGAGTGCGCCGAATGTTTACGTGGAAATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGTAACTGGTGACAGATTTCCCCCGACAGCAAACAGTACAGCAGACCTTGTGAGGGAAGAAGAAGAATTCGAAGTGCGAGAGACTTACTCTGAGCAAGGCACGTGCAGCTCTCTGACAAGGCTGGAGGTGATGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTCAACTTACTACAAACCTTCAACAAGCAAGAAAGGAGAAAGATGAAATAATGAAAGAGTTTCTTGAACTTACAGAACAAAGCCAAAAATTAAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAACAATAGTCATACAAGTACAGCTGCAGATCTTCTGCAATCCAAGCAGCAAATACTCGCTTATCAGCAACAGCTGGAAGAACAGGAGCATCGGCTAAAACTTTATCAGAAAGATAATGAAAGCTACAAGGCACATAACGAATCCCTGCAGGCCAAGATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCATATAAAAGAAGGTTAAACGAAAAAGATGTGTCCATTGACAATATGAAAATAGCATTACAGGAGGAAGAAAGCAAATCAAGCCAACTAACTGAAAGAATTTCACTGTTTGAAAAATCAGCAGAAGAACTGAGACAAGAGTTAGTAATAAAACATCAGGAAATAAATAACCTGGCTGAGGAACTTAGCTCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAATCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACAACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FLt3                   TEgg137g17.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGAAGAAGAAGAATTCGAAGTGCGAGAGACTTACTCTGAGCAAGGCACGTGCAGCTCTCTGACAAGGCTGGAGGTGATGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTCAACTTACTACAAACCTTCAACAAGCAAGAAAGGAGAAAGATGAAATAATGAAAGAGTTTCTTGAACTTACAGAACAAAGCCAAAAATTAAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAACAATAGTCATACAAGTACAGCTGCAGATCTTCTGCAATCCAAGCAGCAAATACTCGCTTATCAGCAACAGCTGGAAGAACAGGAGCATCGGCTAAAACTTTATCAGAAAGATAATGAAAGCTACAAGGCACATAACGAATCCCTGCAGGCCAAGATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCATATAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                Xt7.1-CAAN11630.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCACTGACTTCTCTCGCCGCTGCCGGGCGCTGGGGTGACGTCAGAGGAGTGCGCCGAATGTTTACGTGGAAATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGTAACTGGTGACAGATTTCCCCCGACAGCAAACAGTACAGCAGACCTTGTGAGGGAAGAAGAAGAATTCGAAGTGCGAGAGACTGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTNCACTTACTACAAACCTTCAACAAGCAAGAAAGGAGAAAGATGAAATAATGAAAGAGTTTCTTGAACTTACAGAACAAAGCCAAAAATTTAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAAACATAGTCATANCAGTACAGCTGCAGATCTTCTGCAAATCAAGCAG
                                                  Xt7.1-CHK-1008245161                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGACTTCTCTCGCCGCTGCCGGGCGCTGGGGTGACGTCAGAGGAGTGCGCCGAATGTTTACGTGGAAATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGTAACTGGTGACAGATTTCCCCCGACAGCAAACAGTACAGCAGACCTTGTGAGGGAAGAAGAAGAATTCGAAGTGCGAGAGxxTGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGxGxTGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTNCACTTACTACAAACCTTCAACAAGCAAGAAAGGAGAAAGATGAAATAATGAAAGAGTTTCTTGAACTTACAGAACAAAGCCAAAAATTTAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAAACATAGTCATANCAGTACAGCTGCAGATCTTCTGCAAATCAAGCAGCAAATA
  5   1   2      seed Egg  FLt3                      TEgg139l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCACTGACTTCTCTCGCCGCTGCCGGGCGCTGGGGTGACGTCAGAGGAGTGCGCCGAATGTTTACGTGGAAATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGTAACTGGTGACAGATTTCCCCCGACAGCAAACAGTACAGCAGACCTTGTGAGGGAAGAAGAAGAATTCGAAGTGCGAGAGACTTACT
  5   1   2       bld Te4       in                        CAAN11630.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGAGGAGTGCGCCGAATGTTTACGTGGAGATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTACGCATTGCTGTGTGTGTCTGTACAGGGGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGTTCAGAGGTAACTGGTGACAGATTTCCCCCGACAGCAAACAGTACAGCAGACCTTGTGAGGGAAGAAGAAGAATTCGAAGTGCGAGAGACTTACTCTGAGCAAGGCACGTGCAGCTCTCTGACAAGGCTGGAGGTGATGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTNCACTTACTACAAACCTTCAACAAGCAAGAAAGGAGAAAGATGAAATAATGAAAGAGTTTCTTGAACTTACAGAACAAAGCCAAAAATTTAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAAACATAGTCATANCAGTACAGCTGCAGATCTTCTGCAAATCAAGCAGCAAATACT
  5   1   2       bld Egg  5g3  in                   TEgg026o17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGGAGTGCGCCGAATGTTTACGTGGAAATGGGAGAGAGCGGTAGGCGCTGTAGCTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGAAGAAGAAGAATTCGAAGTGCGAGAGACTTACTCTGAGCAAGGCACGTGCAGCTCTCTGACAAGGCTGGAGGTGATGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGGAATG
  5   1   2       bld Egg  FLt3                      TEgg137g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAACGCTGCGCATTGCTGTGTGTGTCTGTACAGGCGCAGGCATGGAGGAGGAGGACCAGGAGAGGAAGAGGAAGCTGGAGGCCGGCAAGGCTAAGCTTGCTCAGTTCAGACAGCGCAAAGGGCAGGCTGATGGCCAACATGCAGCAAAGAAGCCCAAGAAGAAGAAAGCCTCAACTGGCTCCAAAGGACAACAAACTGCTGAAGATGCACAGGAAACAAGCTATTCACAGAGTCATCATAGTCACTCCCAGAGCACCGAAGGCGCTTCTGCTACCGAAGAGTTTTCCATCATGAGAACCTTGTCCCAGGGGGAAAGTGTAAAACATGACAAGACTTACACAATAGAACCTGAAAGTGAAATTTCCAGTACAGCTGATGATTATAGCTCAGAGGAAGAAGAAGAATTCGAAGTGCGAGAGACTTACTCTGAGCAAAGCACGTGCAGCTCTCTGACAAGGCTGGAGGTGATGGAGGATGAGCTGGCTGGAAAGCAGCAAGAAATTGAAGAGCTGAACAAAGAGCTGGAGGAAATGAGGGCAGCCTGTGGTACACAAGGACTGCAGCAGCTCCAAGAGTTTGAAATGGCAATAAAGCAAAGAGATGATATCATCACTCAACTTACTACAAACCTTCAACAAGCA
  5   1   2      ests                                 Xt7.1-CABA3696.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCCAAGATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCGTATAAAAGAAGGTTAAACGAAAAAGATGTGTCCATTGACAATATGAAAATAGCATTACAGGAGGAAGAAAGCAAATCAAGCCAACTAACTGAAAGAATTTCACTGTTTGAAAAATCAGCAGAAGAACTGAGACAAGAGTTAGTAATAAAACATCAGGAAATAAATAACCTGGCTGAGGAACTTAGCTCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAATCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACCACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAATTAGAATTTACATTAAAAGAGGAGCTTGAACGACAAAAGAACACATTTTCATTTGCAGAGAAAAATTTTGAGGTCAATTTCCATGAATTACAAGAAGAATATACATGCCTTTTAAAGATAAAGAATCAATTAGAAGATAG
                                                  Xt7.1-CHK-1008237533                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCGTATAAAAGAAGGTTAAACGAAAAAGATGTGTCCATTGACAATATGAAAATAGCATTACAGGAGGAAGAAAGCAAATCAAGCCAACTAACTGAAAGAATTTCACTGTTTGAAAAATCAGCAGAAGAACTGAGACAAGAGTTAGTAATAAAACATCAGGAAATAAATAACCTGGCTGAGGAACTTAGCTCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAATCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACCACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAATTAGAATTTACATTAAAAGAGGAGCTTGAACGACAAAAGAACACATTTTCATTTGCAGAGAAAAATTTTGAGGTCAATTTCCATGAATTACAAGAAGAATATACATGCCTTTTAAAGATAAAGAATCAATTAGA
  5   1   2       bld Tad5      in                         XZT39863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAACTTACAGAACAAAGCCAAAAATTAAAGATTCAGTTTCAGCACTTACAGGCCAGTGAAGCACTTAGAAACAATAGTCATACAAGTACAGCTGCAGATCTTCTGCAATCCAAGCAGCAAATACTCGCTTATCAGCAACAGCTGGAAGAACAGGAGCATCGGCTAAAACTTTATCAGAAAGATAATGAAAGCTACAAGGCACATAACGAATCCCTGCAGGCCAAGATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCGTATAAAAGAAGGTTAAACGAAAAAGATGTGTCCATTGACAATATGAAAATAGCATTACAGGAGGAAGAAAGCAAATCAAGCCAACTAACTGAAAGAATTTCACTGTTTGAAAAATCAGCAGAAGAACTGAGACAAGAGTTAGTAATAAAACATCAGGAAATAAATAACCTGGCTGAGGAACTTAGCTCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATNCATGAACTCAATATTANCATANACAAATTANATGCCNCACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTT
  3   1   2       bld Egg  5g3  in                    TEgg026o17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAATGAAAGCTACAAGGCACATAACGAATCCTGCNAGGCCAAGATTCAGGATATGGAACAGCTAAAAGAACTTGAACTCTCATATAAAAGAAGGTTAAACGAAAAAGATGTGTCCATTGACAATATGAAAATAGCATTACAGGAGGAAGAAAGCAAATCAAGCCAACTAACTGAAAGAATTTCACTGTTTGAAAAATCAGCAGAAGAACTGAGACAAGAGTTAGTAATAAAACATCAGGAAATAAATAACCTGGCTGAGGAACTTAGCTCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg133b08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTCCAGACAGAGGGAAAGACAGTCTTCCGAAGAAATTAAGCAGTTGATGGGTACAGTGGAAGAGCTGCAGAAAAAACATTATAAAGGCACTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACAAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTG
  5   1   2      seed Kid1      in                         CABA3696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAATTTGAGGCAGACATAGTTCAGCGAATGGAGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAAGTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAANACACTGAAAATCTAAAACAAAATCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTANTAGCACCATGCAGTCT
  3   1   2       bld Int1      in                         CAAP7365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAACTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTAA
  5   1   2       bld Int1      in                         CAAP7365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTGGAAGCAGGAAGGAAGCTGGAACAACTTCGAGCAGAACTAGATGAAATGTATGGACAACAGATAGTGCAGATGAAACAAGAGCTAGTCAAGCAACATGCATCTGAGATTGAGAAGCTTCTTGCACAGCATAAAGCAGAATTAGATAATATTTCTATTCAGTCGACAGTCAGTATGACCAATGAACAGATCAATGAACTCAATATTACAATAAACAAATTAAATGCCCAACTGCAGTGTTCTAATCAAAAGCAAACTAAAATAAAGGAAGATTTTTCCTTGCAACTTAAAGTTGTAACATCTGAAAAATCTCTTTTGCAAGGGCAAATCAAAGACTTGCTGCAGGATATGACTCTTGCTCGTGAGCAGATTCAAAAAGCAAAAGAAAGCATAACAGAAAAAGAAAGCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAA
  3   1   2       bld Kid1      in                         CABA3696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCAAACTCAGTGAAGCTAGTAGTTTACTTGTTGCAGTTGATGATCTGAAAGCAGAGCTGGCAGCTGCAAATGCATATACAAAAGAGTTACAAACCAAACATGAATCTGAAATTACAAATTACAAGATTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAATCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACAACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAATTAGAATTTACATTAAAAGAGGAGCTTGAACGACAAAAGAACACATTTTCATTTGCAGAGAAAAATTTGAGGTCA
  3   1   2       bld Te4       in                        CAAN11630.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATTTAAACTTGATATGTTAGAGAGGGAAAAAGATGCTGTTTTAGATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTCTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAACCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACCACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAATTAGAATTTACATTAAAAGAGGAGCTTGAACGACAAAAGAACACATTTTCATTTGCAGAGAAAAATTTTGAGGTCAATTTCCATGAATTACAAGAAGAATATACATGCCTTTTAAAGATAAAGAATCAATTAGAAGATAGCATAAC
  3   1   2       bld Tad5      in                         XZT39863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATAGAATGGCCGAATCTCAAGAAGCTGAATTTGAGAAGCTAAGGACTCATTTTTGTTCAGCCAAGAAGAGGAACTCTCAAAACTTAGAGAAGATTTAACTCGAGAGCATTCAGAAAACACTGAAAATCTAAAACAAAACCTCGAGACAAAATTTAGGCAACAACTTGATAATATGCAGCATGACATGAACCAGACTATAAGCACCATGCAGTCTGAAAAAGATACCTTAGTAACCAAACAGAACAATTTAATGTTGGAGATTTCAAAGTTGAAAGACCTACTGCAATCAGTTGGTGATCCCCAATCAGAAGAAATGATGATTCAGATGAATGAACTTCAGAAAGATCTGGAACCTTATAGAAGGGAAGAGAAAGAGAAGGAAACAACAGAACAAGACTTTCAGATGCTTCAACTTAAAATTAAGTTGCTCGAAAAAGAGGTGAAAGAGAAAGACACTCTGAGTGAACAGATTGCATCTCAAAAGGTGGATATCCGAATTCTCAGAGATGAAAACAATACTTTGCAGGCAACACTAAAAAACTACCACATTATTGGTTCTGTCAGTGATCAGGGTGATGACAGAAACTCTGAGTTGAGAAATGAAATGGAAAAGCTCACTTTAGAGAACAAGCAACTTAAAAAATTAGAATTTACATTAAAAGAGGAGCTTGAACGACAAAAGAACACATTTTCATTTGCAGAGAAAAATTTTGAGGTCAATTTCCATGAATTACAAGAAGAATATACATGCCTTTTAAAGATAAAGAATCAATTAGAAGATAGCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)