Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC8392.3.5                         43 END     1           6        2                (no blast hit)
     2   2.0    0Xt7.1-THdA004b04.5                          2 END     1           6       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 229.0    0Xt7.1-XZG9376.5                            19 PI      79         81      389                MGC97660 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 87%

 1012155772 Xt7.1-THdA033a10.5.5 - 15 ESTs
                                                                       .-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-THdA033a10.5.5                                                                                                                                                                            TCGGCCCCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCGTATTTAGTATTTTTTTTTTTCCCTCTTTGAGCATTCAGGGAGAACAATACCTCTTATACACAGGAAATGACTCAACAGTACGGACCTGAGTTTCTCTTTTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTGTTCACCTTTGTAGAGATTGCTATTCTGAGACAATTTGCAATTGGTCTTCATTTTTTATTTGAATTTCTGTTCTGCAGTTTTCGAGTTTTAACAGATATCTGGTTGCTAGGGTGTTGCTTACCATAGCAACCAGCTAGCTGTTTGAATGAGAGATTGGTATATAAATAGGAGAGGGCCTAAATAGTAAAAGAAAGTATCAATAACAATAAAACTGTAACCTCACAGAGCAGTAGTTGTTGCTACCGGGGTCAGATAATTTAAAAACGATTGATAATGAAGACCAATTGAAAAGTTGCTTAGAATTGTCCAATCTATAATACTAAAAGGTTACTTAAAGGTGAACCACCC
                                                  Xt7.1-CHK-1008267085                                                                                                                                                                                  CCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCGTATTTAGTATTTTTTTTTTTCCCTCTTTGAGCATTCAGGGAGAACAATACCTCTTATACACAGGAAATGACTCAACAGTACGGACCTGAGTTTCTCTTTTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTGTTCACCTTTGTAGAGATTGCTATTCTGAGACAATTTGCAATTGGTCTTCATTTTTTATTTGAATTTCTGTTCTGCAGTTTTCGAGTTTTAACAGATATCTGGTTGCTAGGGTGTTGCTTACCATAGCAACCAGCTAGCTGTTTGAATGAGAGATTGGTATATAAATAGGAGAGGGCCTAAATAGTAAAAGAAAGTATCAATAACAATAAAACTGTAACCTCACAGAGCAGTAGTTGTTGCTACCGGGGTCAGATAATTTAAAAACGATTGATAATGAAGACCAATTGAAAAGTTGCTTAGAATTGTCCAATCTATAATACTAAAAGGTTACTTAAAGGTGAACCACCCCTTTAG
                                                      consensus depths                                                                                                                                                                                 2     4     3     4     3     4     3     4     3     4     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     5     3     5     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                               Xt7.1-THdA033a10.5                                                                                                                                                                            TCGGCCCCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCGTATTTAGTATTTTTT
  5   1   2      ests                               Xt7.1-TEgg036a24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTGTTCACCTTTGTAGAGATTGCTATTCTGAGACAATTTGCAATTGGTCTTCATTTTTTATTTGAATTTCTGTTCTGCAGTTTTCGAGTTTTAACAGATATCTGGTTGCTAGGGTGTTGCTTACCATAGCAACCAGCTAGCTGTTTGAATGAGAGATTGGTATATAAATAGGAGAGGGCCTAAATAGTAAAAGAAAGTATCAATAACAATAAAACTGTAACCTCACAGAGCAGTAGTTGTTGCTACCGGGGTCAGATAATTTAAAAACGATTGATAATGAAGACCAATTGAAAAGTTGCTTAGAATTGTCCAATCTATAATACTAAAAGGTTACTTAAAGGTGAACCACC
                                               BLH ATG      27     391                                                                                                                                                                            
                                               BLH MIN      27     183                                                                                                                                                                            
                                               EST CLI     -37       1                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bb ==== 5e-018     BAE46385.1 Ets1/2 [Branchiostoma belcheri] =====================================================================================
                                                                                                                          PROTEIN --- Dm ---- 2e-026     NP_523945.2 Ets at 65A CG7018-PB [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-027     NP_508865.1 friend leukemia integration 1 like (XF694) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 3e-054     BAE06411.1 transcription factor protein [Ciona intestinalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 2e-056     XP_800545.2 PREDICTED: similar to Erf protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 4e-099     NP_006485.1 Ets2 repressor factor [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 2e-100     NP_001038392.1 hypothetical protein LOC560416 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 4e-174     NP_036181.2 ets variant gene 3; ETS-domain transcriptional repressor; ETS-domain protein;mitogenic Ets transcriptional suppressor METS [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PREDICTED - Gg ---- 0          XP_424336.2 PREDICTED: similar to ets variant gene 3 [Gallus gallus] --------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          AAH84755.1 LOC495299 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          AAI28621.1 Unknown (protein for MGC:145286) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN === ?? ==== 0          NP_001090698.1 ets variant gene 3 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-THdA033a10.5.5                                                                                                                                                                                                       ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------TAG---------------------------------------ATGTAG------------------------------------------------------------------------------------TGA------------------------------------ATG------------------------------------------------------------TGA---------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------TGA------TAG------TAG---------------------------------ATG---------TAGTAG------------------------------------------ATG---TAATAG---------TAA---------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------TAG---------TAA------------------------------------------------------------------------------TAA------------ATG---------TGA---------TAG
                                                                   ORF                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  0   1   1           Brn3 FL                         CAAK12349.FL-MGC                                                                                                                                                   GGAGTGGCGGCGGAGCTGTGACCTAGCGGTCGGCCCCGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCGTATTTAGTATTTTTTTTTTTTCCCTCTTTGAGCATTCAGGGAGAACAATACCTCTTATACACAGGAAATGACTCAACAGTACGGACCTGAGTTTCTCTTTTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTGTTCACCTTTGTAGAGATTGCTATTCTGAGACAATTTGCAATTGGTCTTCATTTTTTATTTGAATTTCTGTTCTGCAGTTTTCGAGTTTTAACAGATATCTGGTTGCTAGGGTGTTGCTTACCATAGCAACCAGCTAGCTGTTTGAATGAGAGATTGGTATATAAATAGGAGAGGGCCTAAATAGTAAAAGAAAGTATCAATAACAATAAAACTGTAACCTCACAGAGCAGTAGTTGTTGCTACCGGGGTCAGATAATTTAAAAACGATTGATAATGAAGACCAATTGAAAAGTTGCTTAGAATTGTCCAATCTATAATACTAAAAGGTTACTTAAAGGTGAACCACCCCTTTAGACATTGGATTTGATTAAAAAAAAACAACCCACATTCATTCTATTCTCTCTAGATATTTATAAAGATATATATGTTTATAGAGAGAGACCTGCTTTAACTTTTTATATCGCAAGTTTGTCGGATTCAACTACATTCACCCAAAATTCTAGGTGTCGTTTTCCCCAAAACATTTTATATCATAAATGAGATTCCACAACATTGTCACTTTTTTTTTCCCCCCCTCACCTGTGTTTTTTTGTATATATTCAACTGAATGAACTCATGTCAAAAAGGGGGGTTTATTTTTCCTTTTTAAGTACCTGCCAAATCTTGTTTGGTTTGGCCATAAATTTGACTTTGTAGCGCTATTAAGTTGCCTGTGCCTCAGGGACTGATGAATCATTATGGTCTGCGGCCGGTGTAGTGTGAGAGCCCTTGTTTATGTCTGCCTGCAGCCTTGTGGGTCAAACCCTACCTAGGCAGGTACGTAGCTCATACCAGGGTCACTTGAAAAATCAGTATATACGGGCTCTGTTGCATGTTAGTGTCCCTGCTGGGGCCCCGTACACTGACTGGAATCTATCAAATATGCCAGGTTGTTCCAAAGGGGTTGTTCACCTTCTGAGTTAACGTTTATTATGATGTAGAGAGTAATATCCCGAGACAGTTTGCAATTGGTCTTCATTTTTTATTGTATAGGACCCGTTATCCAGAATGCTCGGGACCTAGGGTATTCTGGATAAGGGGTCTCTCCGTAGTTTGGATCTTCATACCTTAAGTCTATTAAAAAAAATTAATAAAACATATCTTAGTTTGGATCTAATACAAAGCACTGTTTTTTATTTTTACAGAGAAAAAGGAAATCGGTTTTAAAAAATCTGAATTATTTGATTAAAATGTAGCCTATGGGAGACGGGCTTTCCGTAATTCGGAGCTTTCTGGATAATGGGTTTCCGTATAAGGGATCCCATACCTGTATGTAGTGGATTTTTTTTTTTTTTTTATCGTTTCAGTGTTTGTTCAGCAGCTTTGCAGTTTGGAGTTTTTAGCAGCTATCTGGTTGCTAGGGTCCAAATTACCTTAGCAGTCAGCAAGCAGTTTGAATAAGAAACTGGAATATGAATAGGCGAGGGCCTGAATAGAAAGATAAGTAATAAAAAGTACCAATAATAATAAAACTGGAGCCTCACAGAACAATAGGTTTTTGGCTGCCGGGGTCAGTGATCCCCATTTGAAAGCTGGAAAGAGTCAGAAAAGAAGGCAAATAATTTAAAAACTATATAAAAAAAAAATAATAATGAAGACCAATTGAAAAGTTGCTTAGAAATGGCCATTCTATAACATACTAACAGTTAACATAAAGGTGAACCGCCCCTTTAAGATTGAGTTGCCTTTATTAAGAATATACAAGATCCCTACCGCTTTTCTCAAGTTGGTATTCAAACCAAAGCTTCCCCAGAATAACCATGCCTGTTTTAAAAAGAAGAACCTGTAAATATATATATATTTTTATTGGTGAATTTGTATTTTTCTAAGCAAAGCTACAAATATTTTATTAAAGCAAGAATGTAGTTAATTGGATTATGCACGTAATTGCCTCTCGTTCCATAGTGTTAGAGAGACAGTCGTCTCGTGGTTTCTTCCTGCTGCTGCTATTCTATCTGTCTCTGCCCTGGGTGTGCTGCTCTAACAGGTTGTTCCCATCCTGCCCCAAACTGCCCCAAGCTTCCTGTGCTCCCATCCAGGAATGCAGTCAGACCTGTCCCCTTGGCTTGTACAAACATCCCCTTTCATTTCCTCGTATGAAATGATTCCCGCTGATGCAAATTCTAGCTCATACGTACGTGTTTTTAGAGCGTAGAACCATAATAAGGACTTGGCAATCCCCCGCTTTTATTAAAAGCTCAATGCGACATAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas038n24.FL-Sanger                                                                                                                                                                         CGGTCGGCCCCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATCATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCATATTTAGTATTTTTTTTTTTTTCCCTCTTTGAGCATTCAGGGAGAACAATACCTCTTATACACAGGAAATGACTCAACAGTACGGACCTGAGTTTCTCTTTTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTGTTCACCTTTGTAGAGATTGCTATTCTGAGACAATTTGCAATTGGTCTTCATTTTTTATTTGAATTTCTGTTCTGCAGTTTTCGAGTTTTAACAGATATCTGGTTGCTAGGGTGTTGCTTACCATAGCAACCAGCTAGCTGTTTGAATGAGAGATTGGTATATAAATAGGAGAGGGCCTAAATAGTAAAAGAAAGTATCAATAACAATAAAACTGTAACCTCACAGAGCAGTAGTTGTTGCTACCGGGGTCAGATAATTTAAAAACGATTGATAATGAAGACCAATTGAAAAGTTGCTTAGAATTGTCCAATCTATAATACTAAAAGGTTACTTAAAGGTGAACCACCCCTTTAGACATTGGATTTGATTAAAAAAAAACAACCCATATTCATTCTATTCTCTCTAGATATTTATAAAGATATATATGTTTATAGAGAGAGACCTGCTTTAACTTTTTATATCGCAAGTTTGTCGGATTCAACTACATTCACCCAAAATTCTAGGTGTCGTTTTCCCCAAAACATTTTATATCATAAATGAGATTCCACAACATTGTCACTTTTTTTTTCCCCCCCTCACCTGTGTTTTTTTGTATATATTCAACTGAATGAACTCATGTCAAAAAGGGGGGTTTATTTTTCCTTTTTAAGTACCTGCCAAATCTTGTTTGGTTTGGCCATAAATTTGACTTTGTAGCGCTATTAAGTTGCCTGTGCCTCAGGGACTGATGAATCATTATGGTCTGCGGCCGGTGTAGTGTGAGAGCCCTTGTTTATGTCTGCCTGCAGCCTTGTGGGTCAAACCCTACCTAGGCAGGTACGTAGCTCATACCAGGGTCACTTGAAAAATCAGTATATACGGGCTCTGTTGCATGTTAGTGTCCCTGCTGGGGCCCCGTAAACTGACTGGAATCTATCAAATATGCCAGGTTGTTCCAAAGGGGTTGTTCACCTTCTGAGTTAACGTTTATTATGATGTAGAGAGTAATATCCCGAGACAGTTTGCAATTGGTCTTCATTTTTTATTGTATAGGACCCGTTATCCAGAATGCTCGGGACCTAGGGTATTCTGGATAAGGGGTCTCTCCGTAGTTTGGATCTTCATACCTTAAGTCTATTAAAAAAAATTAATAAAACATATCTTAGTTTGGATCTAATACAAAGCACTGTTTTTTATTTTTACAGAGAAAAAGGAAATCGGTTTTAAAAAATCTGAATTATTTGATTAAAATGTAGCCTATGGGAGACGGGCTTTCCGTAATTCGGAGCTTTCTGGATAATGGGTTTCCGTATAAGGGATCCCATACCTGTATGTAGTGGATTTTTTTTTTTTTTTTATCGTTTCAGTGTTTGTTCAGCAGCTTTGCAGTTTGGAGTTTTAAGCAGCTATCTGGTTGCTAGGGTCCAAATTACCTTAGCAGTCAGCAAGCAGTTTGAATAAGAAACTGGAATATGAATAGGCGAGGGCCTGAATAGAAAGATAAGTAATAAAAAGTACCAATAATAATAAAACTGGAGCCTCACAGAACAATAGGTTTTTGGCTGCCGGGGTCAGTGATCCCCATTTGAAAGCTGGAAAGAGTCAGAAAAGAAGGCAAATAATTTAAAAACTATATATAAAAAAAAAAAAAAAAAA
  5   1   2      ests                               Xt7.1-THdA033a10.5                                                                                                                                                                            TCGGCCCCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCGTATTTAGTATTTTTT
                                                  Xt7.1-CHK-1008236259                                                                                                                                                                                  CCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCGTATTTAGTATTTTTTTTTTTT
  5   1   2       bld Egg  5g                        TEgg112g12.p1kSP6                                                                                                                                       AAGCGACAGGAGTGGCGGCGGAGCTGTGACCTAGCGGTCGGCCCCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTC
  5   1   2       bld Brn3 FL   out                       CAAK12349.5p                                                                                                                                                    GAGTGGCGGCGGAGCTGTGACCTAGCGGTCGGCCCCGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTT
  5   1   2      seed Gas  FL                        TGas038n24.p1kSP6                                                                                                                                                                         CGGTCGGCCCCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTACCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTC
  5   1   2       bld Gas  5g3  in                   TGas051p14.p1cSP6                                                                                                                                                                          CGGTCGGCCCCGTCAGCAAGAAGAGGAAATATGAAAACTGGCTGTAGCATTGGGGAAAAGCCTAAAGGAGGGGGAGGGTCCACTTTCCAGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGC
  5   1   2       bld HdA       ?                    THdA033a10.p1kSP6                                                                                                                                                                                                                                    CCTAAAGGAGGGGGNAGGGTACCACTTTCCTGACTGGGCGTACAAGGCGGAGTCAAGTCCTGGCTCCCGACAGATTCAGCTATGGCATTTTATCTTGGAACTGCTGCAGAAGGAGGAATTTCGGCACGTTATTGCCTGGCAGCAAGGGGAATATGGAGAGTTTGTGATCAAGGACCCGGATGAAGTAGCCAGGCTGTGGGGCCGGCGCAAATGCAAACCTCAGATGAACTATGACAAGCTGAGCCGAGCGCTAAGATATTATTACAACAAGCGGATCCTGCATAAAACAAAAGGAAAGCGTTTTACCTACAAATTTAACTTCAACAAGCTGGTTATGCCCAATTACCCGTTCATCAACATCCGGCCCAATGCTGTTCCTCAGAGTGCTCCGCCAGTTCCAACCGCATCCTCGCATTTCCACTTCCCCCCGCTAGACTCCCCCAGTGAAGATGCCCAAGGAAGCCGTTTCTCGGGGAACTCCACCGCGCAGTCCAGCCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTA
  5   1   2       bld Te3       out                        CAAM6473.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGCGAGTCTTTGAATGAGGTCGCTGATCGCAAGGCAAACTCTTCGGAACAAGATGACATTTCCTCCGATTGGCGTCGCAGCGCAGACCTCATGGCCCCTCGGAATCCTGTGGGTCTAAGCCATCCTGCTCTTCAGAAGCACAAATCGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGAT
  5   1   2       bld Brn4      in                        CAAL10495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGATCTGATGCTCCCTGTTTTTCCAATGCCGGGAATGTATGCAGACCCCCACAGTCCCTTTGCATTGTCCCCTCTTCCTGGGCGTGGTAGCATCCTGAATGTACCCATCTCGCCTGCCTTATCTCTGACTCCGACTGTCTTTTCGTATAGTCCATCACCGGGTCTGAGCCCAGCTTTCCAAAGCGGCAGCTGCTTTAACTTCAACCCTGAAGAGATGAAACACTACCTGCAGGCCCAGGCTTGCTCTGTATTAAACTACCACCTCAGTCCGCGGACTTTACCGAGATACCCTGGTTTCATGATGCCCCCACGTCAGCATCTTTATCCTCCAGAGGAGCAGTCCTCATTCCCCATCAAGTTGCAGCCTCCGCCAATGGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGT
  5   1   2       bld Gas7      ?                          XZG65477.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGACGCAAACACAGAGAGCGTCATCAGAGCCAAGAGGAGACCCAGACTCCTCCACAGCAAACTCCCGTTGTAACTGCTATGAAGGTCGAGCCTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCGTATTTAGTATTTTTTTTTTTTCCCTCTTTGAGCATTCAGGGAGAACAATACCTCTTATACACAGGAAATGACTCAACAGTACGGACCTGAGTTTCTCTTTTTTCGCTTTATATTTTGCCTTTAC
  5   1   2       bld Gas7      in                         XZG49235.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTTCTGATGATGAGCGAACCTCTGATGAGGATCTAGACACTTCAGACCCCGCAGAGAGAGATTTCCACAGCGATGAGGAAGAAGACTCCTTCTCTCCAAGAGAAGACCCTAGTAAGTCGGGGCATAAATTTATCAAGCCCGCTACCCCATCTTGGACCGCAGTTTCATCCGCATCTTCCAGACCTTCTTATCCTTATGCGGCTGCAGTAGATCCTTCCGAATCTAGCGACAGAGCAGCGAAGGACATTTCTGTGGATGTGGCTACAGTGGAAAAGAAAGAAGACTCTCTCCCGCCAAAGCTGCGTCTCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCGTATTTAGTATTTTTTTTTTTCCCTCTTTGAGCATTCAGGGAGAACAATACCTCTTATACACAGGAAATGACTCAACAGTACGGACCTGAGTTTCTCTTTTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTAT
  3   1   2       bld Gas0                                 dad27h01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAAGCGCATGTGGAACGGCGACCGTCAGATGGAGGTTGCGGAGGACAGAGGAGGAGAGAGCAGGAAAGTCAGCTGCATTGTTAATGGTCTCAGGTCTCCAGTCATCCCCGCCGAAAACAAGGCAGTGGCTGCTGTGGCTGATTATTAGTCATGGGAATTTTATTTTTTTAATGATCTAATCCCGTTCATGTAGCCATTGCTACAGGATGGTCGTTTTATCGATTTCCAAACTTTCCTAACAGCTGACCCATATTTAGTATTTTTTTTTTTTTCCCTCTTTGAGCATTCAGGGAGAACAATACCTCTTATACACAGGAAATGACTCAACAGTACGGACCTGAGTTTCTCTTTTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTTTTTTAGTAAGAGAAAAAGAAAAAAAAAAAAAA
  5   1   2      ests                               Xt7.1-TEgg036a24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTGTTCACCTTTGTAGAGATTGCTATTCTGAGACAATTTGCAATTGGTCTTCATTTTTTATTTGAATTTCTGTTCTGCAGTTTTCGAGTTTTAACAGATATCTGGTTGCTAGGGTGTTGCTTACCATAGCAACCAGCTAGCTGTTTGAATGAGAGATTGGTATATAAATAGGAGAGGGCCTAAATAGTAAAAGAAAGTATCAATAACAATAAAACTGTAACCTCACAGAGCAGTAGTTGTTGCTACCGGGGTCAGATAATTTAAAAACGATTGATAATGAAGACCAATTGAAAAGTTGCTTAGAATTGTCCAATCTATAATACTAAAAGGTTACTTAAAGGTGAACCACC
                                                  Xt7.1-CHK-1008243355                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTGTTCACCTTTGTAGAGATTGCTATTCTGAGACAATTTGCAATTGGTCTTCATTTTTTATTTGAATTTCTGTTCTGCAGTTTTCGAGTTTTAACAGATATCTGGTTGCTAGGGTGTTGCTTACCATAGCAACCAGCTAGCTGTTTGAATGAGAGATTGGTATATAAATAGGAGAGGGCCTAAATAGTAAAAGAAAGTATCAATAACAATAAAACTGTAACCTCACAGAGCAGTAGTTGTTGCTACCGGGGTCAGATAATTTAAAAACGATTGATAATGAAGACCAATTGAAAAGTTGCTTAGAATTGTCCAATCTATAATACTAAAAGGTTACTTAAAGGTGAACCACCCCTTTA
  3  -1   2      seed Egg       ?                     TEgg036a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTTTTTTTTTCCCTCTTTGAGCATTCAGGGAGAACAATACCTCTTATACACAGGAAATGACTCAACAGTACGGACCTGAGTTTCTCTTTTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTG
  3   1   2       bld Neu0                             NISC_ng09a01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTCGCTTTATATTTTGCCTTTACTGGTGGTGACGTAAAACATTCAGCTGTTTTTTTCTTTTTAGTAAGAGCATTTTGCTTTGTGGTTTTGCAGCTCTCTGCTTCAGATAAAATAATGGCCTAGGAAAGCATTTGGAATGGAAGAATCTTGCACTTGGCTTTTCAGTTCCGGTCTTTGGGTTATTTATACCTTTTATTAAGGATGTTTTTTTTCCCATTTTTCTGGAACATTTTTGACTGCTTTAGTCATATTAGCCCGGACAACCGGAAATTTTATTACTCAACCGAATGGATTTTGAATAGTAGTGTAAAGATCTGTGTCAACTATATACCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas7      in                         XZG49235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTATATACCCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACAGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAATCTGGTGTGTTAAAGGGGTTGTTCACCTttgtagagattgctattctgagacaatttgcaattggtcttcattttttatttgaatttctgttctgcagttttcgagttttaacagatatctggttgctagggtgttgcttaccatagcaaccagctagctgtttgaatgagagattggtatataaataggagagggcctaaatagtaaaagaaagtatcaataacaataaaactgtaacctcacagagcagtagttgttgctaccggggtcagataatttaaaaacgattgataatgaagaccaattgaaaagttgcttagaattgtccaatctataatactaaaaggttacttaaaggtgaaccacccctttaGACAGAAAAAAAAAAGAAAAAGAAAAAATAAAAG
  3   1   2       bld Brn4      in                        CAAL10495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCCCCCCCCCCCCCATCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACATCCATCAAGTTTAATCCAGCAGTACTATCTACAAATATACCTCCTGTGGTCCAGCCACTCTTTTTCTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTGACGGGAAGTCGAGGAAGCGCAGCTTGCGGGTTTTATGACCTACAGGAAGGAGAGTTTAAAGAAATGGCGGAAGGTGAGGAGAAATATAACGGGAGAGCCTTGTTCTCAGTTGTTGGGATTTTCCCACACCGCCGCCAGTGTATACACCTAAACACACATGCATCTAAGTCTGGTGTGTTAAAGGGGTTGTTCACCTttgtagagattgctattctgagacaatttgcaattggtcttcattttttatttgaatttctgttctgcagttttcgagttttgacagatatctggttgctagggtgttgcttaccatagcaaccagctagctgtttgaatgagagattggtatataaataggagagggcctaaatagtaaaagaaagtatcaataacaataaaactgtaacctcacagagcagtagttgttgctaccggggtcagataatttaaaaacgattgataatgaggaccaattgaagagttgcttagaattgtccaatctataatactaaaaggttacttaaaggtgaaccacccctTTAGACATTGGATTTGATT
  3   1   2       bld Gas  5g3  in                    TGas051p14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCCCCCCNCCCCCCCCATGATTTAATAGGTTCACTGGTAAGCTCATGTACCAAACTTCCTTCAAGTTTAATCCCGCGGTACTATCTACAAATATACCCCCTGTGGTCCAGCCACTCTTTTTTTTTTTGCCTGTAGGAAAAATATTTATTGCTTCAGCCTTGTCACTTTCTATAGAAACCCTGCCGTCGCAGTGACTCAGTGTTTGTGTGCTGAATAATTCCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)