Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI13198.5                           3 END     2          22       66                147744345

 This cluster: approximate FL confidence score = 79%

 1012155775 Xt7.1-CABC5786.3.5 - 9 ESTs
                                                                       ....-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABC5786.3.5                                                                                                                   CAACATTTCCACTAACCACGGCCCATAGGACAAAGTGGACGGGAGAAGAATGTTGACGTTTACTAGAGTATAAGTATCATTTACAAATGAATTTGCCTGTATATAGTGGGTGAGGGGTTGAAGAACGGATGTTGTTGGGGGTTTGCTTATTGAGAACAGGACCAAAGGGAACCTCACCATATGCACCTTCTCAGCCATAGGGCAAGGAGAGAACGTTCTCCACCTGAAGGGCTGGCGGGGAAGGATACCAACTCCTGGAAACTTGCCTCTGTACAGGAGAAAGCAGGAGTGTTCTTGCACCAGCAAATACCAGCTGACCCCCTAGAGAAGAGTAGGTATGGAGACTGGAGGATGGACAGGTTCCATGGGGGCACAATGACTTATCCCTACTACCTAAAACCTGGTATACAAGGAAAAGGTACAGTGAGGGGCATGAAGGCTACGGTAGGCCGTCCAGAACAATTTGTATATCCCCAAATACGAGAGCAGAATTGCTTGAGATGGTGGGAAGGTGCATTTCCTGGGCACATAATTGTACTTCCTTCCTGTGAAAGTCACACATTCCTTCCATGCTTTATGGCTTGTATTCCCCCAAGACTGGTGCATTGGTCCTTGATCATCTACATGATCCTACAGGGCTCATTAGTTTAGTTTCAAACTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATAC
                                                  Xt7.1-CHK-1008267363                                                                                                                         TTCCACTAACCACGGCCCATAGGACAAAGTGGACGGGAGAAGAATGTTGACGTTTACTAGAGTATAAGTATCATTTACAAATGAATTTGCCTGTATATAGTGGGTGAGGGGTTGAAGAACGGATGTTGTTGGGGGTTTGCTTATTGAGAACAGGACCAAAGGGAACCTCACCATATGCACCTTCTCAGCCATAGGGCAAGGAGAGAACGTTCTCCACCTGAAGGGCTGGCGGGGAAGGATACCAACTCCTGGAAACTTGCCTCTGTACAGGAGAAAGCAGGAGTGTTCTTGCACCAGCAAATACCAGCTGACCCCCTAGAGAAGAGTAGGTATGGAGACTGGAGGATGGACAGGTTCCATGGGGGCACAATGACTTATCCCTACTACCTAAAACCTGGTATACAAGGAAAAGGTACAGTGAGGGGCATGAAGGCTACGGTAGGCCGTCCAGAACAATTTGTATATCCCCAAATACGAGAGCAGAATTGCTTGAGATGGTGGGAAGGTGCATTTCCTGGGCACATAATTGTACTTCCTTCCTGTGAAAGTCACACATTCCTTCCATGCTTTATGGCTTGTATTCCCCCAAGACTGGTGCATTGGTCCTTGATCATCTACATGATCCTACAGGGCTCATTAGTTTAGTTTCAAACTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTC
                                                      consensus depths                                                                                                                        2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     2     3     3     4     3     5     4     5     4     5     4     5     5     5     5     5     5     6     5     6     6     6     6     6     6     6     7     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5
  5   1   2      2ovr                                 Xt7.1-CABC5786.3                                                                                                                   CAACATTTCCACTAACCACGGCCCATAGGACAAAGTGGACGGGAGAAGAATGTTGACGTTTACTAGAGTATAAGTATCATTTACAAATGAATTTGCCTGTATATAGTGGGTGAGGGGTTGAAGAACGGATGTTGTTGGGGGTTTGCTTATTGAGAACAGGACCAAAGGGAACCTCACCATATGCACCTTCTCAGCCATAGGGCAAGGAGAGAACGTTCTCCACCTGAAGGGCTGGCGGGGAAGGATACCAACTCCTGGAAACTTGCCTCTGTACAGGAGAAAGCAGGAGTGTTCTTGCACCAGCAAATACCAGCTGACCCCCTAGAGAAGAGTAGGTATGGAGACTGGAGGATGGACAGGTTCCATGGGGGCACAATGACTTATCCCTACTACCTAAAACCTGGTATACAAGGAAAAGGTACAGTGAGGGGCATGAAGGCTACGGTAGGCCGTCCAGAACAATTTGTATATCCCCAAATACGAGAGCAGAATTGCTTGAGATGGTGGGAAGGTGCATTTCCTGGGCACATAATTGTACTTCCTTCCTGTGAAAGTCACACATTCCTTCCATGCTTTATGGCTTGTATTCCCCCAAGACTGGTGCATTGGTCCTTGATCATCTACATGATCCTACAGGGCTCATTAGTTTAGTTTCAAACTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATAC
  5   1   2      2ovr                                 Xt7.1-CCAX8840.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATAC
                                               ORF LNG     715       7                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED < Hs <<<< 3e-012     XP_931515.1 PREDICTED: hypothetical protein [Homo sapiens] <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
                                                    Xt7.1-CABC5786.3.5                                                                                                                                            TAG---------------------ATG------------------TAA------------------------------TAG------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------ATG------------------------ATG---------TGA---------------TAA---------------------------TGA------TGA---------TAG------------------------------------------------TGA------------------------------TAA---------------------------------------------------------------------------------TGA---------TGA---------------TAG---------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------ATG------------------------------------------ATG------------------------------------------ATG------------------------------------------ATG------------------------------------------ATG------------------------------------------ATG------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------TAG------------------------TAA---------------------------------ATG------------------------TAA------------------------------------ATGTGA---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2      2ovr                                 Xt7.1-CABC5786.3                                                                                                                   CAACATTTCCACTAACCACGGCCCATAGGACAAAGTGGACGGGAGAAGAATGTTGACGTTTACTAGAGTATAAGTATCATTTACAAATGAATTTGCCTGTATATAGTGGGTGAGGGGTTGAAGAACGGATGTTGTTGGGGGTTTGCTTATTGAGAACAGGACCAAAGGGAACCTCACCATATGCACCTTCTCAGCCATAGGGCAAGGAGAGAACGTTCTCCACCTGAAGGGCTGGCGGGGAAGGATACCAACTCCTGGAAACTTGCCTCTGTACAGGAGAAAGCAGGAGTGTTCTTGCACCAGCAAATACCAGCTGACCCCCTAGAGAAGAGTAGGTATGGAGACTGGAGGATGGACAGGTTCCATGGGGGCACAATGACTTATCCCTACTACCTAAAACCTGGTATACAAGGAAAAGGTACAGTGAGGGGCATGAAGGCTACGGTAGGCCGTCCAGAACAATTTGTATATCCCCAAATACGAGAGCAGAATTGCTTGAGATGGTGGGAAGGTGCATTTCCTGGGCACATAATTGTACTTCCTTCCTGTGAAAGTCACACATTCCTTCCATGCTTTATGGCTTGTATTCCCCCAAGACTGGTGCATTGGTCCTTGATCATCTACATGATCCTACAGGGCTCATTAGTTTAGTTTCAAACTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATAC
                                                  Xt7.1-CHK-1008240020                                                                                                                         TTCCACTAACCACGGCCCATAGGACAAAGTGGACGGGAGAAGAATGTTGACGTTTACTAGAGTATAAGTATCATTTACAAATGAATTTGCCTGTATATAGTGGGTGAGGGGTTGAAGAACGGATGTTGTTGGGGGTTTGCTTATTGAGAACAGGACCAAAGGGAACCTCACCATATGCACCTTCTCAGCCATAGGGCAAGGAGAGAACGTTCTCCACCTGAAGGGCTGGCGGGGAAGGATACCAACTCCTGGAAACTTGCCTCTGTACAGGAGAAAGCAGGAGTGTTCTTGCACCAGCAAATACCAGCTGACCCCCTAGAGAAGAGTAGGTATGGAGACTGGAGGATGGACAGGTTCCATGGGGGCACAATGACTTATCCCTACTACCTAAAACCTGGTATACAAGGAAAAGGTACAGTGAGGGGCATGAAGGCTACGGTAGGCCGTCCAGAACAATTTGTATATCCCCAAATACGAGAGCAGAATTGCTTGAGATGGTGGGAAGGTGCATTTCCTGGGCACATAATTGTACTTCCTTCCTGTGAAAGTCACACATTCCTTCCATGCTTTATGGCTTGTATTCCCCCAAGACTGGTGCATTGGTCCTTGATCATCTACATGATCCTACAGGGCTCATTAGTTTAGTTTCAAACTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTC
  5   1   2      skin Hrt1      out                        CAAQ8142.5p CTCCATTATAGAGAGGAGGACAACAGTGGCTGCCACAGTGGGCACCATGATGTTTGTATATAAATGGAAACTGCAATGATGCATCCCATGTTGTATTCATAGTGTAAATATGAGCAACATTTCCACTAACCACGGCCCATAGGACAAAGTGGACGGGAGAAGAATGTTGACGTTTACTAGAGTATAAGTATCATTTACAAATGAATTTGCCTGTATATAGTGGGTGAGGGGTTGAAGAACGGATGTTGTTGGGGGTTTGCTTATTGAGAACAGGACCAAAGGGAACCTCACCATATGCACCTTCTCAGCCATAGGGCAAGGAGAGAACGTTCTCCACCTGAAGGGCTGGCGGGGAAGGATACCAACTCCTGGAAACTTGCCTCTGTACAGGAGAAAGCAGGAGTGTTCTTGCACCAGCAAATACCAGCTGACCCCCTAGAGAAGAGTAGGTATGGAGACTGGAGGATGGACAGGTTCCATGGGGGCACAATGACTTATCCCTACTACCTAAAACCTGGTATACAAGGAAAAGGTACAGTGAGGGGCATGAAGGCTACGGTAGGCCGTCCAGAACAATTTGTATATCCCCAAATACGAGAGCAGAATTGCTTGAGATGGTGGGAAGGTGCATTTCCTGGGCACATAATTGTACTTCCTTCCTGTGAAAGTCACACATTCCTTCCATGCTTTATGGCTTGTATTCCCCCCAGACTGGTGCATTGGTCCTTGATCATCTACATGATCCTACAGGGCTCATTAGTTTAG
  5   1   2       bld Eye       in                         CCAX8840.b1                                                                                           TTGTATTCATAGTGTCACCAAAATCAAGCATTCCACTAACCACGGCCCATAGGACAAAGTGGACGGGAGAAGAATGTTGACGTTTACTAGAGTATAAGTATCATTTACAAATGAATTTGCCTGTATATAGTGGGTGAGGGGTTGAAGAACGGATGTTGTTGGGGGTTTGCTTATTGAGAACAGGACCAAAGGGAACCTCACCATATGCACCTTCTCAGCCATGGGGCAAGGAGAGAACGTTCTCCACCTGAAGGGCTGGCGGGGAAGGATACCAACTCCTGGAAACTTGCCTCTGTACAGGAGAAAGCAGGAGTGTTCTTGCACCAGCAAATACCAGCTGACCCCCTAGAGAAGAGTAGGTATGGAGACTGGAGGATGGACAGGTTCCATGGGGGCACAATGACTTATCCCTACTACCTAAAACCTGGTATACAAGGAAAAGGTACAGTGAGGGGCATGAAGGCTACGGTAGGCCGTCCAGAACAATTTGTATATCCCCAAATACGAGAGCAGAATTGCTTGAGATGGTGGGAAGGTGCATTTCCTGGGC
  5   1   2   12  bld Tad5 5g3  in                         XZT64112.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATTGCTTGAGATGGTGGGAAGGTGCATTTCCTGGGCACATAATTGTACTTCCTTCCTGTGAAAGTCACACATTCCTTCCATGCTTTATGGCTTGTATTCCCCCAAGACTGGTGCATTGGTCCTTGATCATCTACATGATCCTACAGGGCTCATTAGTTTAGTTTCAAACTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATANGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCA
  3   1   2       bld Ovi1 PIPE out                       CABI13198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCCCTGTGAAAGTCACACATTCCTTCCATGCTTTATGGCTGTATTCCCCCCAAGACTGGTGCATTGGTCCTTGATCATCTACATGATCCTACAGGGCTCATTAGTTTAGTTCAAACTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATACTGTAAAAAAAAAAAAAAA
  5  -1   2       bld Int1      out                       CAAP12640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGCTCATTAGTTTAGTTTCAAACTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTT
  3   1   2      seed Fat1 5g3  out                        CABC5786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTAGAAGAGGAATAGAATTACAAAGAGACCAACCTGTAGCCAAAAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATACTGTT
  3   1   2       bld Tad5 5g3  in                         XZT64112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGAATGTACATTAAGCCAGACCAACNTGTAGNNAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATACTGTT
  5   1   2      2ovr                                 Xt7.1-CCAX8840.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATAC
                                                  Xt7.1-CHK-1008254255                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTC
  3   1   2      seed Liv1 5g3  out                        CAAR6501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTACATTAAGCCAGACCAACCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATACTGTT
  3   1   2       bld Eye       in                         CCAX8840.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCAATAAGAGCACTGGAATGTTTTATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAACAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAATCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGGCAGACCAGCCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTATATTAAGCCAGACCAACCTGTAGCCAATAAGAGCACTGGAATGTACATTAAGCCAGACCAACCTGTAGCCAATAAGAACAATGACATTTTGCTGGAGCTACCCCAACCCATCGGCCGTTACATAGGATTTCCCATAGAAATTCTCTAGTTTTGCTCAGGGAGACAGGCCGTATAAAGCCTGTTAGTAGCAGGGGATCTATTATACATAATGCTCAGGGAGTGTACAGATCTGGGATAACTTGAACACCAATCTCTAGAACAAAGTTTTTTATTTATGTGAAACAGATGTGCCATAATGTATTTGGTACCTACAGAAATAAACTTATTTTCCAATACTGTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)