Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ19650.3                          22 END     1          14        4                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 581.0    0Xt7.1-TTpA067k23.3                         10 PI      96        443      786                (no blast hit)
     3 575.0    0Xt7.1-ANBT283.3                            10 PI      95        443      786                PREDICTED: similar to RP11-23J9.1 [Gallus gallus]
     4 227.0    0Xt7.1-XZT5230.3                             5 PI      82        537      790                (no blast hit)
     5 452.0    0Xt7.1-XZT424.3                              3 PI      89        443      784                (no blast hit)
     6 208.0    0Xt7.1-CAAN1629.5                            2 PI      98        612      726                breast cancer anti-estrogen resistance 3 [Mus musculus]
     7 238.0    0Xt7.1-TGas091a11.5                          2 PI      92        571      729                (no blast hit)
     8 568.0    0Xt7.1-XZT5605.5                             2 PI      86        443      913                LOC494743 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012155809 Xt7.1-CAAJ17943.3.5 - 7 ESTs
                                                                       ......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAJ17943.3.5                                                                                                                                                                                           CTAATGTGTAGCGCCGGCTCCTTCTGAAAGCTCAGACTCACTTTCTCACTGACTTCATTTTCTACTGAACGCAGTCTAAATGAACAGCAGGGGGTGCTGTGGTTTCAAAAGAAGCACGGGCAATTTTACATGTATTTGTTTCAAAGGCTTACATTTCAGTAACAGGGCCTTAATCAGGGGGCTAGGGTCTTCTGGGCAACTAGGGACTTATCCTGATGAAGTTTGTAGTCTGGTTTATATTGAGAACAATTAATCTCCTGTTTTAAATTATAAGGATATTATATGTCACTGAAGAGTTCAGCCTTTCACTTTTATATGGTCATGGAACTCCAAGGTGACTTCTAATGTCCTCATCTTATAATGCACAAGTTTCATTAAGTCATGTGACACACATTACATCACTAAGTATGGAGTACTAAGATATATTTTACAGGATATTAATTTATATTATATAGTAAATAAATTAACCCCTATTGTAACAGATAAGGATATTATAAGTCACAGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCAAAGGTGATCCATAACCATTAGAAGGTACAAGGGTGAAGGCCGAGTCATGGAACTCGGTGACTTCTGATGTCCTCATATTTTACAACAGAGGGTACTTTATTTATTATAATGCACAAGTTTCAGTGACAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTTAAAAGGTGGCAGCACTGGGTGTACAGAAAAGCTGCACCACAATA
                                                  Xt7.1-CHK-1008267372                                                                                                                                                                                                 TGTAGCGCCGGCTCCTTCTGAAAGCTCAGACTCACTTTCTCACTGACTTCATTTTCTACTGAACGCAGTCTAAATGAACAGCAGGGGGTGCTGTGGTTTCAAAAGAAGCACGGGCAATTTTACATGTATTTGTTTCAAAGGCTTACATTTCAGTAACAGGGCCTTAATCAGGGGGCTAGGGTCTTCTGGGCAACTAGGGACTTATCCTGATGAAGTTTGTAGTCTGGTTTATATTGAGAACAATTAATCTCCTGTTTTAAATTATAAGGATATTATATGTCACTGAAGAGTTCAGCCTTTCACTTTTATATGGTCATGGAACTCCAAGGTGACTTCTAATGTCCTCATCTTATAATGCACAAGTTTCATTAAGTCATGTGACACACATTACATCACTAAGTATGGAGTACTAAGATATATTTTACAGGATATTAATTTATATTATATAGTAAATAAATTAACCCCTATTGTAACAGATAAGGATATTATAAGTCACAGAGGAGTTCCTTATAATACATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCAAAGGTGATCCATAACCATTAGAAGGTACAAGGGTGAAGGCCGAGTCATGGAACTCGGTGACTTCTGATGTCCTCATGTTTTACAACAGAGGGTACTTTATTTATTATAATGCACAAGTTTCAGTGACAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTTAAAAGGTGGCAGCACTGGGTGTACAGAAAAGCTGCACC
                                                      consensus depths                                                                                                                                                                                                2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3
  5   1   2      2ovr                                 Xt7.1-CAAK5497.5 CAAGTTGGAGTGATATCCCCCCCCCCTCACCCCCAGCAGCCGATCAGCAGAACAATGGGAAGGAAGCAAGATAGCAGCTCCCAGTAGGTATCAGAATAGCACTCAATAGTAAGAAATCCAAGTCCGGCTTGGGACTCCTCCAGTTACATGGGAGTAGGAGAAACAATAGGTTAGCTGAAAGCAGTTCTAATGTGTAGCGCCGGCTCCTTCTGAAAGCTCAGACTCACTTTCTCACTGACTTCATTTTCTACTGAACGCAGTCTAAATGAACAGCAGGGGGTGCTGTGGTTTCAAAAGAAGCACGGGCAATTTTACATGTATTTGTTTCAAAGGCTTACATTTCAGTAACAGGGCCTTAATCAGGGGGCTAGGGTCTTCTGGGCAACTAGGGACTTATCCTGATGAAGTTTGTAGTCTGGTTTATATTGAGAACAATTAATCTCCTGTTTTAAATTATAAGGATATTATATGTCACTGAAGAGTTCAGCCTTTCACTTTTATATGGTCATGGAACTCCAAGGTGACTTCTAATGTCCTCATCTTATAATGCACAAGTTTCATTAAGTCATGTGACACACATTACATCACTAAGTATGGAGTACTAAGATATATTTTACAGGATATTAATTTATATTATATAGTAAATAAATTAACCCCTATTGTAACAGATAAGGATATTATAAGTCACAGAGGAGTTCCTTATAATACATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCATATTGTAACATATAGGGATATTATAAGCCCCCGAGGGGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGTCCC
  5   1   2      2ovr                                Xt7.1-CAAJ17943.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAAGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCAAAGGTGATCCATAACCATTAGAAGGTACAAGGGTGAAGGCCGAGTCATGGAACTCGGTGACTTCTGATGTCCTCATGTTTTACAACAGAGGGTACTTTATTTATTATAATGCACAAGTTTCAGTGACAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTTAAAAGGTGGCAGCACTGGGTGTACAGAAAAGCTGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---A--------
                                                   Xt7.1-CAAJ17943.3.5                                                                                                                                                                                              ATG------------------TGA------------------------------------------------------------------------------------------------------ATG---------------------------TAA---------------------------------------------------TGATGA------TAG------------TGA---------------------------TAA---------ATG------------------------------ATG---ATG------------------TAA---------------ATG------------TAA---ATGTGA---------------TAA---------------------------------TAA------------------TAA---------------------TAA------------------------------TAA---------------------------------------------------------------------------TAGTGA------------------TAA---------------TAA---------------------------------TAA---------------------TAG------------------------------TAA------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------ATG---TAA------------------------TAA------------------TAA------------------------------------------------------------ATGTAA------------------------------------------------------------------TAA---------------------------TAA------------------------------------------------------------------TGA------------------------------------------------------TAA
  5   1   2      2ovr                                 Xt7.1-CAAK5497.5 CAAGTTGGAGTGATATCCCCCCCCCCTCACCCCCAGCAGCCGATCAGCAGAACAATGGGAAGGAAGCAAGATAGCAGCTCCCAGTAGGTATCAGAATAGCACTCAATAGTAAGAAATCCAAGTCCGGCTTGGGACTCCTCCAGTTACATGGGAGTAGGAGAAACAATAGGTTAGCTGAAAGCAGTTCTAATGTGTAGCGCCGGCTCCTTCTGAAAGCTCAGACTCACTTTCTCACTGACTTCATTTTCTACTGAACGCAGTCTAAATGAACAGCAGGGGGTGCTGTGGTTTCAAAAGAAGCACGGGCAATTTTACATGTATTTGTTTCAAAGGCTTACATTTCAGTAACAGGGCCTTAATCAGGGGGCTAGGGTCTTCTGGGCAACTAGGGACTTATCCTGATGAAGTTTGTAGTCTGGTTTATATTGAGAACAATTAATCTCCTGTTTTAAATTATAAGGATATTATATGTCACTGAAGAGTTCAGCCTTTCACTTTTATATGGTCATGGAACTCCAAGGTGACTTCTAATGTCCTCATCTTATAATGCACAAGTTTCATTAAGTCATGTGACACACATTACATCACTAAGTATGGAGTACTAAGATATATTTTACAGGATATTAATTTATATTATATAGTAAATAAATTAACCCCTATTGTAACAGATAAGGATATTATAAGTCACAGAGGAGTTCCTTATAATACATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCATATTGTAACATATAGGGATATTATAAGCCCCCGAGGGGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGTCCC
                                                  Xt7.1-CHK-1008252031       GGAGTGATATCCCCCCCCCCTCACCCCCAGCAGCCGATCAGCAGAACAATGGGAAGGAAGCAAGATAGCAGCTCCCAGTAGGTATCAGAATAGCACTCAATAGTAAGAAATCCAAGTCCGGCTTGGGACTCCTCCAGTTACATGGGAGTAGGAGAAACAATAGGTTAGCTGAAAGCAGTTCTAATGTGTAGCGCCGGCTCCTTCTGAAAGCTCAGACTCACTTTCTCACTGACTTCATTTTCTACTGAACGCAGTCTAAATGAACAGCAGGGGGTGCTGTGGTTTCAAAAGAAGCACGGGCAATTTTACATGTATTTGTTTCAAAGGCTTACATTTCAGTAACAGGGCCTTAATCAGGGGGCTAGGGTCTTCTGGGCAACTAGGGACTTATCCTGATGAAGTTTGTAGTCTGGTTTATATTGAGAACAATTAATCTCCTGTTTTAAATTATAAGGATATTATATGTCACTGAAGAGTTCAGCCTTTCACTTTTATATGGTCATGGAACTCCAAGGTGACTTCTAATGTCCTCATCTTATAATGCACAAGTTTCATTAAGTCATGTGACACACATTACATCACTAAGTATGGAGTACTAAGATATATTTTACAGGATATTAATTTATATTATATAGTAAATAAATTAACCCCTATTGTAACAGATAAGGATATTATAAGTCACAGAGGAGTTCCTTATAATACATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCATATTGTAACATATAGGGATATTATAAGCCCCCGAGGGGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATA
  5   1   2      seed Brn3                                 CAAK5497.5p caagttggagtgatatcccccccccctcacccccagcagccgatcagcagaacaatgggaaggaagcaagatagcagctcccagtaggtatcagaatagcactcaatagtaagaaatccaagtccggcttgggactcctccagttacatgggagtaggagaaacaataggttagctgaaagcagttctaatgtgtagcgccggctccttctgaaagctcagactcaCTTTCTCACTGACTTCATTTTCTACTGAACGCAGTCTAAATGAACAGCAGGGGGTGCTGTGGTTTCAAAAGAAGCACGGGCAATTTTACATGTATTTGTTTCAAAGGCTTACATTTCAGTAACAGGGCCTTAATCAGGGGGCTAGGGTCTTCTGGGCAACTAGGGACTTATCCTGATGAAGTTTGTAGTCTGGTTTATATTGAGAACAATTAATCTCCTGTTTTAAATTATAAGGATATTATATGTCACTGAAGAGTTCAGCCTTTCACTTTTATATGGTCATGGAACTCCAAGGTGACTTCTAATGTCCTCATCttataatgcacaagtttcattaagtcatgtgacacacattacatcactaagtatggagtactaagatatattttacaggatattaatttatattatatagtaaataaattaacccctattgtaacagataaggatattataagtcacagaggagttccttataatacatagtgaataaagtgccccctattgtaacatatagggatattataagtccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatatagggatattataagCCCCCG
  5   1   2       bld Tad5      out                        XZT53282.5p                                                                                                                                                                                           ctaatgtgtagcgccggctccttctgaaagctcagactcaCTTTCTCACTGACTTCATTTTCTACTGAACGCAGTCTAAATGAACAGCAGGGGGTGCTGTGGTTTCAAAAGAAGCACGGGCAATTTTACATGTATTTGTTTCAAAGGCTTACATTTCAGTAACAGGGCCTTAATCAGGGGGCTAGGGTCTTCTGGGCAACTAGGGACTTATCCTGATGAAGTTTGTAGTCTGGTTTATATTGAGAACAATTAATCTCCTGTTTTAAATTATAAGGATATTATATGTCACTGAAGAGTTCAGCCTTTCACTTTTATATGGTCATGGAACTCCAAGGTGACTTCTAATGTCCTCATCttataatgcacaagtttcattaagtcatgtgacacacattacatcactaagtatggagtactaagatatattttacaggatattaatttatattatatagtaaataaattaacccctattgtaacagataaggatattataagtcacagaggagttccttataatacatagtgaataaagtgccccctattgtaacatatagggatattataagtccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatatagggatattataagcccccgaggagttccttataatatatagtgaataaagtaccccatattgtaacatatagggatattataagcccccgaggggttccttataatatatagtgaataaagtaccccctattgtaacatatagggatattataagTCCCAG
  5   1   2      2ovr                                Xt7.1-CAAJ17943.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAAGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCAAAGGTGATCCATAACCATTAGAAGGTACAAGGGTGAAGGCCGAGTCATGGAACTCGGTGACTTCTGATGTCCTCATGTTTTACAACAGAGGGTACTTTATTTATTATAATGCACAAGTTTCAGTGACAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTTAAAAGGTGGCAGCACTGGGTGTACAGAAAAGCTGC
                                                  Xt7.1-CHK-1008243460                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAAGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTACCCCCTATTGTAACATATAGGGATATTATAAGCCCCCGAGGAGTTCCTTATAATATATAGTGAATAAAGTGCCCCCTATTGTAACATATAGGGATATTATAAGTCCCAAAGGTGATCCATAACCATTAGAAGGTACAAGGGTGAAGGCCGAGTCATGGAACTCGGTGACTTCTGATGTCCTCATGTTTTACAACAGAGGGTACTTTATTTATTATAATGCACAAGTTTCAGTGACAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTTAAAAGGTGGCAGCACTGGGTGTACAGAAAAGCTGCACCACA
  5   1   2       bld Brn2      in                        CAAJ17943.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATagtgaataaagtgccccctattgtaacatatagggatattataagtccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatataaggatattataagcccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatatagggatattataagcccccgaggagttccttataatatatagtgaataaagtgccccctattgtaacatatagggatattataagtcccaaaggtgatccataaccattagaaggtacaagggtgaaggccgagtcatggaactcggtgacttctgatgtcctcatattttacaacagagggtgctttatttattataatgcacaagtttcagtgaCAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTT
  3   1   2      seed Brn2      in                        CAAJ17943.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTCCCCGAGGAGTTCCTTATAATATATagtgaataaagtgccccctattgtaacatatagggatattataagtccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatataaggatattataagcccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatatagggatattataagcccccgaggagttccttataatatatagtgaataaagtgccccctattgtaacatatagggatattataagtcccaaaggtgatccataaccattagaaggtacaagggtgaaggccgagtcatggaactcggtgacttctgatgtcctcatattttacaacagagggtgctttatttattataatgcacaagtttcagtgaCAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTTAAAAGGTGGCAGCACTGGGTGTACAGAAAAGCTGCACCACAATAT
  3   1   2       bld Brn2      out                       CAAJ20561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAATATATagtgaataaagtgccccctattgtaacatatagggatattataagtccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatataaggatattataagcccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatatagggatattataagcccccgaggagttccttataatatatagtgaataaagtgccccctattgtaacatatatggatattataagtcccaaaggtgatccataaccattagaaggtacaagggtgaaggccgagtcatggaactcggtgacttctggtgtcctcatgttttacaacagagggtactttatttattataatgcacaagtttcagtgaCAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTTAAAAGGTGGCAGCACTGGGTGTACAGAAAAGCTGCACCACAATAT
  5   1   2       bld Brn3      in                          CAAK497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTATAAGTCCCCGAGGAGTTCCTTATAATATATagtgaataaagtaccccctattgtaacatatagggatattataagtccccgaggagttccttataatatatagtgaataaagtaccccctattgtaacatatagggatattataagcccccgaggagttccttataatatatagtgaataaagtgccccctattgtaacatatagggatattataagtcccaaaggtgatccataaccattagaaggtacaagggtgaaggccgagtcatggaactcggtgacttttgatgtcctcatgttttacaacagagggtactttatttattataatgcacaagtttcagtgaCAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGT
  3   1   2       bld Brn3      in                          CAAK497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGTAACATATAGGGATATTATAAGTCCCCGAGGAGTTCCTTATAATATATagtgaataaagtaccccctattgtaacatatagggatattataagcccccgaggagttccttataatatatagtgaataaagtgccccctattgtaacatatagggatattataagtcccaaaggtgatccataaccattagaaggtacaagggtgaaggccgagtcatggaactcggtgacttttgatgtcctcatgttttacaacagagggtactttatttattataatgcacaagtttcagtgaCAGAAATGACATAATTGAGCAACAATATATATATATATTAAATATATAAAAAACCTTTATAAGAATATTATTTACAGTACATTCATGGCTCTTGTGTATTATATATATATATATATATATATATGTAATGTTCAGTTAGACAGATACCAACTTTAACCAAAGGTTACAAACAATTGAGGGTGTTACTGGCCCTTTAAGGAGAAAGACAGAAGATCAAGGTTGCTTAAATCTTGCCCCCCCCACTGTGGTTTGTATGTACCAGGACATTTGCTGCCCCCGGGGGAGAGGAAGGATGATGTGTTTTGTTTAAAAAGAAATTATATTATATAAATGATATCAATGTGTCAGGTTAAAAGGTGGCAGCACTGGGTGTACAGAAAAGCTGCACCACAATAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)