Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012155927 Xt7.1-XZG25791.3.5 - 7 ESTs
                                                                       ....-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZG25791.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACCTGAGTAACTGCGGCTGTGACCGGGAAAAACAAGGCTACTATAACCAGGAGGAAGGCTGGAAGTGGGGAGGCTGCTCGGCTGACATTAAATACGGCATCGATTTCTCCAGGAAATTTGTAGACGCGCGAGAAATCAAGAAGAATGCACGTAGGCTCATGAACTTGCACAACAACGAGGCGGGAAGAAAGGTGCTGGAAGAAAAGATGAAGCTGGAGTGCAAATGTCACGGTGTTTCGGGCTCCTGTACCACAAAAACCTGCTGGAACACATTGCCTAAATTCCGGGAAATTGGATTCGTGCTGAAGGAGAAGTACAATGACGCGGTACATGTGGAGGTGGTGAGAGCCAATCGCTTGCGGCAGCCCACCTTTTTGAAGATCAAAAAAGTCCGCAGTTACCAGAAACCCATGGAGACGGACTTGGTCTACATTGAGAGGTCCCCCAACTACTGTGAGGAGGACAGCGCCACCGGAAGTGTGGGGACGCAGGGACGGCTTTGTAACCGCACTTCTCCGCACACAGACGGCTGCGATCTTATGTGCTGTGGGCGTGGCTACAATACCCACCAGTATACGAAGGTCTGGCAATGCAACTGTAAGTTCCACTGGTGCTGTTTTGTGAAATGCAATACCTGCAGTGAAAGGACAGAGGTTTTCACCTGCAAATAAGGCACTCCGGTGATGGGCATTGGAAAAACACGGACCATTGTGGCGTCATTTTGCACACTTTATAATTTTCTTTGCCATAGAAAATTATGCCTCTTGGTCCCTCCTTAAAAGGGGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGAGAAGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATGAACATTAA
                                                  Xt7.1-CHK-1008267402                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTAACTGCGGCTGTGACCGGGAAAAACAAGGCTACTATAACCAGGAGGAAGGCTGGAAGTGGGGAGGCTGCTCGGCTGACATTAAATACGGCATCGATTTCTCCAGGAAATTTGTAGACGCGCGAGAAATCAAGAAGAATGCACGTAGGCTCATGAACTTGCACAACAACGAGGCGGGAAGAAAGGTGCTGGAAGAAAAGATGAAGCTGGAGTGCAAATGTCACGGTGTTTCGGGCTCCTGTACCACAAAAACCTGCTGGAACACATTGCCTAAATTCCGGGAAATTGGATTCGTGCTGAAGGAGAAGTACAATGACGCGGTACATGTGGAGGTGGTGAGAGCCAATCGCTTGCGGCAGCCCACCTTTTTGAAGATCAAAAAAGTCCGCAGTTACCAGAAACCCATGGAGACGGACTTGGTCTACATTGAGAGGTCCCCCAACTACTGTGAGGAGGACAGCGCCACCGGAAGTGTGGGGACGCAGGGACGGCTTTGTAACCGCACTTCTCCGCACACAGACGGCTGCGATCTTATGTGCTGTGGGCGTGGCTACAATACCCACCAGTATACGAAGGTCTGGCAATGCAACTGTAAGTTCCACTGGTGCTGTTTTGTGAAATGCAATACCTGCAGTGAAAGGACAGAGGTTTTCACCTGCAAATAAGGCACTCCGGTGATGGGCATTGGAAAAACACGGACCATTGTGGCGTCATTTTGCACACTTTATAATTTTCTTTGCCATAGAAAATTATGCCTCTTGGTCCCTCCTTAAAAGGGGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGAGAAGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATGAACATTAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     2     3
  5   1   2      ests                                 Xt7.1-CBXT5491.5   CTGAACTGCAGCTCCCAGCAACAGAACTGCCGTTTTCCGCAGCAGAACTGCAACTCTCTGCAGTAACCTCGGCTTGGTCGTCCAGGGTGTTCACTCGCTCAGGGACCTCCATTACAGATGGAACGCCGCACGTGCCGCTTTATCATCCGTGGTGGCTTTGGGAGCGAATATCATCTGCAATAAAATCCCAGGGTTGGCGCCTCGGCAAAGAGCGATCTGCGAAAGCCGCCCAGATGCCATCATAGTTATTGGCGAAGGGGCACAGATGGGGATCAATGAGTGTCAGTACCAGTTCCGCTACGGGCGGTGGAATTGCTCGGCGCTAGGGGAAAGGACCGTCTTCGGCCAAGAGCTGCGAGTAGGCAGTCGGGAGGCCGCATTCACGTACGCCATCACTGCTGCCGGAGTTGCCCACGCTGTGACATCGGCATGCAGCCAGGGCAACCTGAGTAACTGCGGCTGTGACCGGGAAAAACAAGGCTACTATAACCAGGAGGAAGGCTGGAAGTGGGGAGGCTGCTCGGCTGACATTAAATACGGCATCGATTTCTCCAGGAAATTTGTAGACGCGCGAGAAATCAAGAAGAATGCACGTAGGCTCATGAACTTGCACAACAACGAGGCGGGAAGAAAGGTGCTGGAAGAAAAGATGAAGCTGGAGTGCAAATGTCACGGTGTTTCGGGCTCCTGTACCACAAAAACCTGCTGGAACACATTGCCTAAATTCCGGGAAATTGGATTCGTGCTGAAGGAGAAGTACAATGACGCGGTACATGTGGAGGTGGTGAGAGCCAATCGCTTGCGGCAGCCCACCTTTTTGAAGATCAAAAAAGTCCGCAGTTACCAGAAACCCATGGAGACGGACTTGGTCTACATTGAGAGGTCCCC
  5   1   2      ests                                 Xt7.1-XZG25791.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCTTTGTAACCGCACTTCTCCGCACACAGACGGCTGCGATCTTATGTGCTGTGGGCGTGGCTACAATACCCACCAGTATACGAAGGTCTGGCAATGCAACTGTAAGTTCCACTGGTGCTGTTTTGTGAAATGCAATACCTGCAGTGAAAGGACAGAGGTTTTCACCTGCAAATAAGGCACTCCGGTGATGGGCATTGGAAAAACACGGACCATTGTGGCGTCATTTTGCACACTTTATAATTTTCTTTGCCATAGAAAATTATGCCTCTTGGTCCCTCCTTAAAAGGGGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGAGAAGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATGAACATTAAAAA
                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 8e-057     BAE06752.1 Wnt signaling ligand [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN --- Ce ---- 3e-057     NP_501822.1 C. elegans WNT family CWN-2 (40.4 kD) (cwn-2) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    
                                                                                                                                                                 PROTEIN --- Dm ---- 3e-064     NP_476810.1 Wnt oncogene analog 2 CG1916-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 2e-093     XP_001194363.1 PREDICTED: similar to AmphiWnt7b [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bb ---- 3e-100     AAF19839.1 secreted protein Wnt7 [Branchiostoma belcheri] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Bf ---- 2e-104     AAC80433.1 AmphiWnt7b [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PREDICTED - Dr ---- 1e-118     XP_691878.1 PREDICTED: similar to wingless-type MMTV integration site family, member 7B precursor [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Hs ---- 6e-128     NP_478679.1 wingless-type MMTV integration site family, member 7B precursor [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Mm ---- 3e-128     NP_033554.2 wingless-related MMTV integration site 7B [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Gg ---- 9e-131     NP_001032351.1 wingless-type MMTV integration site family, member 7B [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- Xl ---- 4e-138     AAB82725.1 Wnt7B [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN --- ?? ---- 4e-138     NP_001084202.1 Wnt7B [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZG25791.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------TAA------------ATG------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------TAA---------ATG---------------------------------------------------------------------------------------------------------------------TAA------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2      ests                                 Xt7.1-CBXT5491.5   CTGAACTGCAGCTCCCAGCAACAGAACTGCCGTTTTCCGCAGCAGAACTGCAACTCTCTGCAGTAACCTCGGCTTGGTCGTCCAGGGTGTTCACTCGCTCAGGGACCTCCATTACAGATGGAACGCCGCACGTGCCGCTTTATCATCCGTGGTGGCTTTGGGAGCGAATATCATCTGCAATAAAATCCCAGGGTTGGCGCCTCGGCAAAGAGCGATCTGCGAAAGCCGCCCAGATGCCATCATAGTTATTGGCGAAGGGGCACAGATGGGGATCAATGAGTGTCAGTACCAGTTCCGCTACGGGCGGTGGAATTGCTCGGCGCTAGGGGAAAGGACCGTCTTCGGCCAAGAGCTGCGAGTAGGCAGTCGGGAGGCCGCATTCACGTACGCCATCACTGCTGCCGGAGTTGCCCACGCTGTGACATCGGCATGCAGCCAGGGCAACCTGAGTAACTGCGGCTGTGACCGGGAAAAACAAGGCTACTATAACCAGGAGGAAGGCTGGAAGTGGGGAGGCTGCTCGGCTGACATTAAATACGGCATCGATTTCTCCAGGAAATTTGTAGACGCGCGAGAAATCAAGAAGAATGCACGTAGGCTCATGAACTTGCACAACAACGAGGCGGGAAGAAAGGTGCTGGAAGAAAAGATGAAGCTGGAGTGCAAATGTCACGGTGTTTCGGGCTCCTGTACCACAAAAACCTGCTGGAACACATTGCCTAAATTCCGGGAAATTGGATTCGTGCTGAAGGAGAAGTACAATGACGCGGTACATGTGGAGGTGGTGAGAGCCAATCGCTTGCGGCAGCCCACCTTTTTGAAGATCAAAAAAGTCCGCAGTTACCAGAAACCCATGGAGACGGACTTGGTCTACATTGAGAGGTCCCC
                                                  Xt7.1-CHK-1008253914         TGCAGCTCCCAGCAACAGAACTGCCGTTTTCCGCAGCAGAACTGCAACTCTCTGCAGTAACCTCGGCTTGGTCGTCCAGGGTGTTCACTCGCTCAGGGACCTCCATTACAGATGGAACGCCGCACGTGCCGCTTTATCATCCGTGGTGGCTTTGGGAGCGAATATCATCTGCAATAAAATCCCAGGGTTGGCGCCTCGGCAAAGAGCGATCTGCGAAAGCCGCCCAGATGCCATCATAGTTATTGGCGAAGGGGCACAGATGGGGATCAATGAGTGTCAGTACCAGTTCCGCTACGGGCGGTGGAATTGCTCGGCGCTAGGGGAAAGGACCGTCTTCGGCCAAGAGCTGCGAGTAGGCAGTCGGGAGGCCGCATTCACGTACGCCATCACTGCTGCCGGAGTTGCCCACGCTGTGACATCGGCATGCAGCCAGGGCAACCTGAGTAACTGCGGCTGTGACCGGGAAAAACAAGGCTACTATAACCAGGAGGAAGGCTGGAAGTGGGGAGGCTGCTCGGCTGACATTAAATACGGCATCGATTTCTCCAGGAAATTTGTAGACGCGCGAGAAATCAAGAAGAATGCACGTAGGCTCATGAACTTGCACAACAACGAGGCGGGAAGAAAGGTGCTGGAAGAAAAGATGAAGCTGGAGTGCAAATGTCACGGTGTTTCGGGCTCCTGTACCACAAAAACCTGCTGGAACACATTGCCTAAATTCCGGGAAATTGGATTCGTGCTGAAGGAGAAGTACAATGACGCGGTACATGTGGAGGTGGTGAGAGCCAATCGCTTGCGGCAGCCCACCTTTTTGAAGATCAAAAAAGTCCGCAGTTACCAGAAACCCATGGAGACGGACTTGGTCTACATTGAGAG
  5   1   2       bld Gas7 PIPE in                         XZG25791.5p   CTGAACTGCAGCTCCCAGCAACAGAACTGCCGTTTTCCGCAGCAGAACTGCAACTCTCTGCAGTAACCTCGGCTTGGTCGTCCAGGGTGTTCACTCGCTCAGGGACCTCCATTACAGATGGAACGCCGCACGTGCCGCTTTATCATCCGTGGTGGCTTTGGGAGCGAATATCATCTGCAATAAAATCCCAGGGTTGGCGCCTCGGCAAAGAGCGATCTGCGAAAGCCGCCCAGATGCCATCATAGTTATTGGCGAAGGGGCACAGATGGGGATCAATGAGTGTCAGTACCAGTTCCGCTACGGGCGGTGGAATTGCTCGGCGCTAGGGGAAAGGACCGTCTTCGGCCAAGAGCTGCGAGTAGGCAGTCGGGAGGCCGCATTCACGTACGCCATCACTGCTGCCGGAGTTGCCCACGCTGTGACATCGGCATGCAGCCAGGGCAACCTGAGTAACTGCGGCTGTGACCGGGAAAAACAAGGCTACTATAACCAGGAGGAAGGCTGGAAGTGGGGAGGCTGCTCGGCTGACATTAAATACGGCATCGATTTCTCCAGGAAATTTGTAGACGCGCGAGAAATCAAGAAGAATGCACGTAGGCTCATGAACTTGCACAACAACGAGGCGGGAAGAAAGGTGCTGGAAGAAAAGATGAAGCTGGAGTGCAAATGTCACGGTGTTTCGGGCTCCTGTACCACAAAAACCTGCTGGAAC
  5   1   2      seed Tbd1      in                         CBXT5491.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACCTGAGTAACTGCGGCTGTGACCGGGAAAAACAAGGCTACTATAACCAGGAGGAAGGCTGGAAGTGGGGAGGCTGCTCGGCTGACATTAAATACGGCATCGATTTCTCCAGGAAATTTGTAGACGCGCGAGAAATCAAGAAGAATGCACGTAGGCTCATGAACTTGCACAACAACGAGGCGGGAAGAAAGGTGCTGGAAGAAAAGATGAAGCTGGAGTGCAAATGTCACGGTGTTTCGGGCTCCTGTACCACAAAAACCTGCTGGAACACATTGCCTAAATTCCGGGAAATTGGATTCGTGCTGAAGGAGAAGTACAATGACGCGGTACATGTGGAGGTGGTGAGAGCCAATCGCTTGCGGCAGCCCACCTTTTTGAAGATCAAAAAAGTCCGCAGTTACCAGAAACCCATGGAGACGGACTTGGTCTACATTGAGAGGTCCCCCACTA
  5   1   2      ests                                 Xt7.1-XZG25791.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGCTTTGTAACCGCACTTCTCCGCACACAGACGGCTGCGATCTTATGTGCTGTGGGCGTGGCTACAATACCCACCAGTATACGAAGGTCTGGCAATGCAACTGTAAGTTCCACTGGTGCTGTTTTGTGAAATGCAATACCTGCAGTGAAAGGACAGAGGTTTTCACCTGCAAATAAGGCACTCCGGTGATGGGCATTGGAAAAACACGGACCATTGTGGCGTCATTTTGCACACTTTATAATTTTCTTTGCCATAGAAAATTATGCCTCTTGGTCCCTCCTTAAAAGGGGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGAGAAGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATGAACATTAAAAA
                                                  Xt7.1-CHK-1008243957                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTAACCGCACTTCTCCGCACACAGACGGCTGCGATCTTATGTGCTGTGGGCGTGGCTACAATACCCACCAGTATACGAAGGTCTGGCAATGCAACTGTAAGTTCCACTGGTGCTGTTTTGTGAAATGCAATACCTGCAGTGAAAGGACAGAGGTTTTCACCTGCAAATAAGGCACTCCGGTGATGGGCATTGGAAAAACACGGACCATTGTGGCGTCATTTTGCACACTTTATAATTTTCTTTGCCATAGAAAATTATGCCTCTTGGTCCCTCCTTAAAAGGGGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGAGAAGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATGAACATTAAAAAAAACAA
  3   1   2      seed Gas7 PIPE in                         XZG25791.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGAAGATCAAAAAAGTCCGCAGTACCCAGAAACCCATGGAGACGGACTTGGTCTACATTGAGAGGTCCCCCAACTACTGTGAGGAGGACAGCGCCACCGGAAGTGTGGGGACGCAGGGACGGCTTTGTAACCGCACTTCTCCGCACACAGACGGCTGCGATCTTATGTGCTGTGGGCGTGGCTACAATACCCACCAGTATACGAAGGTCTGGCAATGCAACTGTAAGTTCCACTGGTGCTGTTTTGTGAAATGCAATACCTGCAGTGAAAGGACAGAGGTTTTCACCTGCAAATAAGGCACTCCGGTGATGGGCATTGGAAAAACACGGACCATTGTGGCGTCATTTTGCACACTTTATAATTTTCTTTGCCATAGAAAATTATGCCTCTTGGTCCCTCCTTAAAAGGGGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGAGAAGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATG
  5   1   2       bld Sto1      in                         CABG2762.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGAAGTGTGGGGACGCANNGGGACGGCTTTGTAACCGCACTTCTCCGCACACAGACGGCTGCGATCTTATGTGCTGTGGGCGTGGCTACAATACCCACCAGTATACGAAGGTCTGGCAATGCAACTGTAAGTTCCACTGGTGCTGTTTTGTGAAATGCAATACCTGCAGTGAAAGGACAGAGGTTTTCACCTGCAAATAAGGCACTCCGGTGATGGGCATTGGAAAAACACGGACCATTGTGGCGTCATTTTGCACACTTTATAATTTTCTTTGCCATAGAANATTATGCCTCTTGGTCCCTCCTTAAAAGGNGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCANGCACTGNAGGGGGG
  3   1   2       bld Sto1      in                         CABG2762.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGCACACAGACGGCTGCGATCTTATGTGCTGTGGGCGTGGCTACAATACCCACCAGTATACGAAGGTCTGGCAATGCAACTGTAAGTTCCACTGGTGCTGTTTTGTGAAATGCAATACCTGCAGTGAAAGGACAGAGGTTTTCACCTGCAAATAAGGCACTCCGGTGATGGGCATTGGAAAAACACGGACCATTGTGGCGTCATTTTGCACACTTTATAATTTTCTTTGCCATAGAAAATTATGCCTCTTGGTCCCTCCTTAAAAGGGGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGAGAAGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATGAACATTAAAAAAAACAAAACCAAAC
  5   1   2       bld Fat1      out                        CABC4716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATTATGCCTCTTGGTCCCTCCTTAAAAGGGGTCGCATCCATGGTCCTTGGCCGGTGTCCGAGTTGTAGCGTCTTCATCAGGCGTTGAGTCGAGAACCATTAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGAGAAGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATGAACATTAAAAAAAACAAAAACAAACAAAAAAAACCCCCCCACATAATTATTATTATTTATGTTTTAATAGTATGAACAAATTCTGAGCACTAACGGGTAGGTTGTGTCTTAATTCTGTACTAAATGGAAACTCCTAGATGTCTGGTTTTTATAATGAGCTCTGTTTATTTCTAACAATTTTTATTGCTACTGAGCCCTTTTGTTTTTGAGAATTGGGACTTCAACATTTGTTTCTACATATATTTTTCCCCTAAATTTTTGTTTTTGAGAATTGGGACATCAACATTTGTTTCTACATATATTTTTCCCCTAAATTTTTGTTTTTGAGAATTGAGACGTCAACATTTGTTTCTACATAAATTTTCCCCCTAAATTTTTGTTTTTGAGAATTGNGACGTTAACATTTGTTTCTACATATATTTTTCCCGCTAAATGTTTGAGAATTGGGACGTCAACATTTGTTTCTACATATATTTT
  3   1   2       bld Tbd1      in                         CBXT5491.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCATAAAGCGGAGCATCATCAGGCACTGGAGGGGGGGGAGAAGGACAGTGATTGGCTTTTACTCTCTCAACAACAACAAAAAAGCTACGTGGGTGTTGTAGATATTTTTTTAAATTATAAATATCACAGATGTCCGAATGTAAGAGAAAAACAAAAAAATCTGAAGACGGTGATGGAAGGGACCAAAATGAAGCCTCAACGAGACAAGAAAGAAAATGGATAAGAACAAAAAAACTTGGGTTCCATAAATAAAATTTATCTTATCACTGGAACTATAATAATGAACATTAAAAAAAACAAAAACAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)