Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 09 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 217.0    0Xt7.1-XZT68553.5                            2 PI      76       1427     1831                Unknown (protein for IMAGE:5570551) [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012155969 Xt7.1-CABK5411.3.5 - 9 ESTs
                                                                       ......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABK5411.3.5                           CTTCCCTCTGGCCATGATCCATCCCTCAGCCGGGCAGCCCAGGGCACCATGCGGGCTCCCAGGGAAGCAGTGACCGACAGCCACCTTGTCTCCCTGCTTGTTACTGGGCTCCGGGGGGTTTGAGCAGAGCCGCAGTGCAATGAGTGCCCCCTTCCAACTTGGTCCCCGACCCCACTCATGGGATGTGGCATCCTAACGCTTCGGATTGGCTCTGGGCACCTGGGGGCACTGAGGGCTCAGCCCAAAGTCTCCCTCCTGCTGACTATGATCTTCCTATTCACCTACTTCTTCTACTGCCTGACCGGCTCCTGCTGTGACTCTCAGCCGGGCGTCGGCTCTTTGCGCTCCCGGTATCCTGTCAGCTCGGCGGGGTCGGTTCCCATGGGGACCGGGGTGCTGGGGGCGCAGGAGTCTCTGCGCTCAGACTTTACACCCAGGAACTCTCTGCTCTTGGATTCTATTCTTAGTGACTCTTTGCGCCCTGACTCTGCACTGAGGGAAGCCCTGCGCTCTGGCTCTGCGTCTGGGGATTCTCTGCGCTTTGGCGCTGCGTCAAGGGACCCTGGGAGTTCGGTCTCTGAACTTAGGAGCCCGGAATCTGTATTGAGGGACTCTCCTGCTCTTTGGAGCTCTCTCAGCTCTGGATCTAGTCTGATGGACAGGTTGCGCCCCAGTATTTCCAAAAGGGACCCCTCAAGTTTGGGAGCTGCTGAGGAGAACACAGTGGGACCTGTTTCTGACCCAAAGGACACTTTGCACTGGCAGGAAGCCTCCAAGGATCCTCTGAGCTCCGGCTTTGCCCTGAAGGAATCCCCACACTCAGACTGGCGGCCCCCCGGTTATGTCCCACTTAACTCCCTGCGCTCTGACTCGGACCCTTTGCGCTCTGCGCCAGTAGGAAGGACGCACATATTGGCCGCTGAGGATACCCGGCAAGCCGACTCATCCGACTCGCTAGAGAGTCAGTATAAAGGCATACCGGGTCACACAAGGGCACAGAATGGGACAAACCCCTATCCAGCTCCCAGTCCTGGGGCGATCTCCATCCACAACAGTTTTGGGACTAAAAGGTTCCCCCAGGCGATCATAGTGGGGGTGAAGAAAGGGGGGACCCGGGCCCTGCTGGAATTCCTGAGAGTGCACCCTGACGTCAGGGCATTGGGGGCCGAACCCCACTTTTTTGACAGGTGTTATGACAAGGGACTGGAGTGGTACAGGAACTTGATGCCAAGGACCTTTGAAGGTCAGATCACCATGGAGAAAACCCCAAGTTATTTTGTTACCATGGAAGCTCCAAAGCGAATTTACAACATGTCCAGTGATACCAAGCTCATCGTGGTGGTGAGGAATCCAGTTACCCGGGCAATCTCCGACTATACGCAGACACTCTCAAAAACTCCTTCTTTGCCCAGCTTCCAAGCACTTGCCTTTAAAAACACTAGCGGGCCTATCGACACCTCCTGGAGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTT
                                                  Xt7.1-CHK-1008266859                                 TCTGGCCATGATCCATCCCTCAGCCGGGCAGCCCAGGGCACCATGCGGGCTCCCAGGGAAGCAGTGACCGACAGCCACCTTGTCTCCCTGCTTGTTACTGGGCTCCGGGGGGTTTGAGCAGAGCCGCAGTGCAATGAGTGCCCCCTTCCAACTTGGTCCCCGACCCCACTCATGGGATGTGGCATCCTAACGCTTCGGATTGGCTCTGGGCACCTGGGGGCACTGAGGGCTCAGCCCAAAGTCTCCCTCCTGCTGACTATGATCTTCCTATTCACCTACTTCTTCTACTGCCTGACCGGCTCCTGCTGTGACTCTCAGCCGGGCGTCGGCTCTTTGCGCTCCCGGTATCCTGTCAGCTCGGCGGGGTCGGTTCCCATGGGGACCGGGGTGCTGGGGGCGCAGGAGTCTCTGCGCTCAGACTTTACACCCAGGAACTCTCTGCTCTTGGATTCTATTCTTAGTGACTCTTTGCGCCCTGACTCTGCACTGAGGGAAGCCCTGCGCTCTGGCTCTGCGTCTGGGGATTCTCTGCGCTTTGGCGCTGCGTCAAGGGACCCTGGGAGTTCGGTCTCTGAACTTAGGAGCCCGGAATCTGTATTGAGGGACTCTCCTGCTCTTTGGAGCTCTCTCAGCTCTGGATCTAGTCTGATGGACAGGTTGCGCCCCAGTATTTCCAAAAGGGACCCCTCAAGTTTGGGAGCTGCTGAGGAGAACACAGTGGGACCTGTTTCTGACCCAAAGGACACTTTGCACTGGCAGGAAGCCTCCAAGGATCCTCTGAGCTCCGGCTTTGCCCTGAAGGAATCCCCACACTCAGACTGGCGGCCCCCCGGTTATGTCCCACTTAACTCCCTGCGCTCTGACTCGGACCCTTTGCGCTCTGCGCCAGTAGGAAGGACGCACATATTGGCCGCTGAGGATACCCGGCAAGCCGACTCATCCGACTCGCTAGAGAGTCAGTATAAAGGCATACCGGGTCACACAAGGGCACAGAATGGGACAAACCCCTATCCAGCTCCCAGTCCTGGGGCGATCTCCATCCACAACAGTTTTGGGACTAAAAGGTTCCCCCAGGCGATCATAGTGGGGGTGAAGAAAGGGGGGACCCGGGCCCTGCTGGAATTCCTGAGAGTGCACCCTGACGTCAGGGCATTGGGGGCCGAACCCCACTTTTTTGACAGGTGTTATGACAAGGGACTGGAGTGGTACAGGAACTTGATGCCAAGGACCTTTGAAGGTCAGATCACCATGGAGAAAACCCCAAGTTATTTTGTTACCATGGAAGCTCCAAAGCGAATTTACAACATGTCCAGTGATACCAAGCTCATCGTGGTGGTGAGGAATCCAGTTACCCGGGCAATCTCCGACTATACGCAGACACTCTCAAAAACTCCTTCTTTGCCCAGCTTCCAAGCACTTGCCTTTAAAAACACTAGCGGGCCTATCGACACCTCCTGGAGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAAT
                                                      consensus depths                                2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     3     2     3     2     3     2     3     2     3     2     3
  5   1   2      ests                                 Xt7.1-CABK5411.5 GTGCGACTGTGTGCAACTCAGACAGACTTCCCTCTGGCCATGATCCATCCCTCAGCCGGGCAGCCCAGGGCACCATGCGGGCTCCCAGGGAAGCAGTGACCGACAGCCACCTTGTCTCCCTGCTTGTTACTGGGCTCCGGGGGGTTTGAGCAGAGCCGCAGTGCAATGAGTGCCCCCTTCCAACTTGGTCCCCGACCCCACTCATGGGATGTGGCATCCTAACGCTTCGGATTGGCTCTGGGCACCTGGGGGCACTGAGGGCTCAGCCCAAAGTCTCCCTCCTGCTGACTATGATCTTCCTATTCACCTACTTCTTCTACTGCCTGACCGGCTCCTGCTGTGACTCTCAGCCGGGCGTCGGCTCTTTGCGCTCCCGGTATCCTGTCAGCTCGGCGGGGTCGGTTCCCATGGGGACCGGGGTGCTGGGGGCGCAGGAGTCTCTGCGCTCAGACTTTACACCCAGGAACTCTCTGCTCTTGGATTCTATTCTTAGTGACTCTTTGCGCCCTGACTCTGCACTGAGGGAAGCCCTGCGCTCTGGCTCTGCGTCTGGGGATTCTCTGCGCTTTGGCGCTGCGTCAAGGGACCCTGGGAGTTCGGTCTCTGAACTTAGGAGCCCGGAATCTGTATTGAGGGACTCTCCTGCTCTTTGGAGCTCTCTCAGCTCTGGATCTAGTCTGATGGACAGGTTGCGCCCCAGTATTTCCAAAAGGGACCCCTCAAGTTTGGGAGCTGCTGAGGAGAACACAGTGGGACCTGTTTCTGACCCAAAGGACACTTTGCACTGGCAGGAAGCCTCCAAGGATCCTCTGAGCTCCGGCTTTGCCCTGAAGGAATCCCCACACTCAGACTGGCGGCCCCCCGGTTATGTCCCACTTAACTCCCTGCGCTCTGACTCGGACCCTTTGCGCTCTGCGCCAGTAGGAAGGACGCACATATTGGCCGCTGAGGATACCCGGCAAGCCGACTCATCCGACTCGCTAGAGAGTCAGTATAAAGGCATACCGGGTCACACAAGGGCACAGAATGGGACAAACCCCTATCCAGCTCCCAGTCCTGGGGCGATCTCCATCCACAACAGTTTTGGGACTAAAAGGTTCCCCCAGGCGATCATAGTGGGGGTGAAGAAAGGGGGGACCCGGGCCCTGCTGGAATTCCTGAGAGTGCACCCTGACGTCAGGGCATTGGGGGCCGAACCCCACTTTTTTGACAGGTGTTATGACAAGGGACTGGAGTGGTACAGGAACTTGATGCCAAGGACCTTTGAAGGTCAGATCACCATGGAGAAAACCCCAAGTTATTTTGTTACCATGGAAGCTCCAAAGCGAATTTACAACATGTCCAGTGATACCAAGCTCATCGTGGTGGTGAGGAATCCAGTTACCCGGGCAATCTCCGACTATACGCAGACACTCTCAAAAACTCCTTCTTTGCCCAGCTTCCAAGCACTTTGCTTTAAAAACA
  5   1   2      ests                                 Xt7.1-CABK5411.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTT
                                               BLH ATG     654      60                           
                                               BLH MIN     879     111                           
                                               BLH MPR     630     111                           
                                               BLH OVR     177      31                           
                                               CDS MIN     177     111                           
                                               ORF LNG     177     112                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 1e-064     AAI36213.1 Unknown (protein for MGC:122942) [Xenopus tropicalis] ---------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 3e-072     NP_001024698.1 F52B10.2 [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 1e-075     XP_799088.1 PREDICTED: similar to Heparan sulfate glucosamine 3-O-sulfotransferase 5 (Heparan sulfate D-glucosaminyl 3-O-sulfotransferase 5) (Heparan sulfate 3-O-sulfotransferase 5) [Strongylocentrotus purpuratus] -------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 6e-100     NP_573370.1 CG7890-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 2e-116     XP_899581.1 PREDICTED: heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2 isoform 2 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 2e-125     AAI33197.1 Unknown (protein for IMAGE:5570551) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 3e-126     XP_686347.1 PREDICTED: similar to heparan sulfate D-glucosaminyl 3-O-sulfotransferase 3B1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 7e-129     NP_001009606.2 heparan sulfate (glucosamine) 3-O-sulfotransferase 6 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 6e-130     NP_001012402.1 heparan sulfate 3-O-sulfotransferase 6 [Mus musculus] -----------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 8e-137     XP_425243.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK5411.3.5                                                                           ATG---------------------------------------------------------------------TGA------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TGATAG---------------------------TGA---------------ATG------------------------------------------ATG------------------------------TAG------------------TAG---------------------------------------------------------------------------------------ATG------------TAG------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2      ests                                 Xt7.1-CABK5411.5 GTGCGACTGTGTGCAACTCAGACAGACTTCCCTCTGGCCATGATCCATCCCTCAGCCGGGCAGCCCAGGGCACCATGCGGGCTCCCAGGGAAGCAGTGACCGACAGCCACCTTGTCTCCCTGCTTGTTACTGGGCTCCGGGGGGTTTGAGCAGAGCCGCAGTGCAATGAGTGCCCCCTTCCAACTTGGTCCCCGACCCCACTCATGGGATGTGGCATCCTAACGCTTCGGATTGGCTCTGGGCACCTGGGGGCACTGAGGGCTCAGCCCAAAGTCTCCCTCCTGCTGACTATGATCTTCCTATTCACCTACTTCTTCTACTGCCTGACCGGCTCCTGCTGTGACTCTCAGCCGGGCGTCGGCTCTTTGCGCTCCCGGTATCCTGTCAGCTCGGCGGGGTCGGTTCCCATGGGGACCGGGGTGCTGGGGGCGCAGGAGTCTCTGCGCTCAGACTTTACACCCAGGAACTCTCTGCTCTTGGATTCTATTCTTAGTGACTCTTTGCGCCCTGACTCTGCACTGAGGGAAGCCCTGCGCTCTGGCTCTGCGTCTGGGGATTCTCTGCGCTTTGGCGCTGCGTCAAGGGACCCTGGGAGTTCGGTCTCTGAACTTAGGAGCCCGGAATCTGTATTGAGGGACTCTCCTGCTCTTTGGAGCTCTCTCAGCTCTGGATCTAGTCTGATGGACAGGTTGCGCCCCAGTATTTCCAAAAGGGACCCCTCAAGTTTGGGAGCTGCTGAGGAGAACACAGTGGGACCTGTTTCTGACCCAAAGGACACTTTGCACTGGCAGGAAGCCTCCAAGGATCCTCTGAGCTCCGGCTTTGCCCTGAAGGAATCCCCACACTCAGACTGGCGGCCCCCCGGTTATGTCCCACTTAACTCCCTGCGCTCTGACTCGGACCCTTTGCGCTCTGCGCCAGTAGGAAGGACGCACATATTGGCCGCTGAGGATACCCGGCAAGCCGACTCATCCGACTCGCTAGAGAGTCAGTATAAAGGCATACCGGGTCACACAAGGGCACAGAATGGGACAAACCCCTATCCAGCTCCCAGTCCTGGGGCGATCTCCATCCACAACAGTTTTGGGACTAAAAGGTTCCCCCAGGCGATCATAGTGGGGGTGAAGAAAGGGGGGACCCGGGCCCTGCTGGAATTCCTGAGAGTGCACCCTGACGTCAGGGCATTGGGGGCCGAACCCCACTTTTTTGACAGGTGTTATGACAAGGGACTGGAGTGGTACAGGAACTTGATGCCAAGGACCTTTGAAGGTCAGATCACCATGGAGAAAACCCCAAGTTATTTTGTTACCATGGAAGCTCCAAAGCGAATTTACAACATGTCCAGTGATACCAAGCTCATCGTGGTGGTGAGGAATCCAGTTACCCGGGCAATCTCCGACTATACGCAGACACTCTCAAAAACTCCTTCTTTGCCCAGCTTCCAAGCACTTTGCTTTAAAAACA
                                                  Xt7.1-CHK-1008246549       CTGTGTGCAACTCAGACAGACTTCCCTCTGGCCATGATCCATCCCTCAGCCGGGCAGCCCAGGGCACCATGCGGGCTCCCAGGGAAGCAGTGACCGACAGCCACCTTGTCTCCCTGCTTGTTACTGGGCTCCGGGGGGTTTGAGCAGAGCCGCAGTGCAATGAGTGCCCCCTTCCAACTTGGTCCCCGACCCCACTCATGGGATGTGGCATCCTAACGCTTCGGATTGGCTCTGGGCACCTGGGGGCACTGAGGGCTCAGCCCAAAGTCTCCCTCCTGCTGACTATGATCTTCCTATTCACCTACTTCTTCTACTGCCTGACCGGCTCCTGCTGTGACTCTCAGCCGGGCGTCGGCTCTTTGCGCTCCCGGTATCCTGTCAGCTCGGCGGGGTCGGTTCCCATGGGGACCGGGGTGCTGGGGGCGCAGGAGTCTCTGCGCTCAGACTTTACACCCAGGAACTCTCTGCTCTTGGATTCTATTCTTAGTGACTCTTTGCGCCCTGACTCTGCACTGAGGGAAGCCCTGCGCTCTGGCTCTGCGTCTGGGGATTCTCTGCGCTTTGGCGCTGCGTCAAGGGACCCTGGGAGTTCGGTCTCTGAACTTAGGAGCCCGGAATCTGTATTGAGGGACTCTCCTGCTCTTTGGAGCTCTCTCAGCTCTGGATCTAGTCTGATGGACAGGTTGCGCCCCAGTATTTCCAAAAGGGACCCCTCAAGTTTGGGAGCTGCTGAGGAGAACACAGTGGGACCTGTTTCTGACCCAAAGGACACTTTGCACTGGCAGGAAGCCTCCAAGGATCCTCTGAGCTCCGGCTTTGCCCTGAAGGAATCCCCACACTCAGACTGGCGGCCCCCCGGTTATGTCCCACTTAACTCCCTGCGCTCTGACTCGGACCCTTTGCGCTCTGCGCCAGTAGGAAGGACGCACATATTGGCCGCTGAGGATACCCGGCAAGCCGACTCATCCGACTCGCTAGAGAGTCAGTATAAAGGCATACCGGGTCACACAAGGGCACAGAATGGGACAAACCCCTATCCAGCTCCCAGTCCTGGGGCGATCTCCATCCACAACAGTTTTGGGACTAAAAGGTTCCCCCAGGCGATCATAGTGGGGGTGAAGAAAGGGGGGACCCGGGCCCTGCTGGAATTCCTGAGAGTGCACCCTGACGTCAGGGCATTGGGGGCCGAACCCCACTTTTTTGACAGGTGTTATGACAAGGGACTGGAGTGGTACAGGAACTTGATGCCAAGGACCTTTGAAGGTCAGATCACCATGGAGAAAACCCCAAGTTATTTTGTTACCATGGAAGCTCCAAAGCGAATTTACAACATGTCCAGTGATACCAAGCTCATCGTGGTGGTGAGGAATCCAGTTACCCGGGCAATCTCCGACTATACGCAGACACTCTCAAAAACTCCTTCTTTGCCCAGCTTCCAAGCACTTTGCTTTA
  5   1   2   22  bld Tad5 5g                               XZT6462.5p GTGCGACTGTGTGCAACTCAGACAGACTTCCCTCTGGCCATGATCCATCCCTCAGCCGGGCAGCCCAGGGCACCATGCGGGCTCCCAGGGAAGCAGTGACCGACAGCCACCTTGTCTCCCTGCTTGTTACTGGGCTCCGGGGGGTTTGAGCAGAGCCGCAGTGCAATGAGTGCCCCCTTCCAACTTGGTCCCCGACCCCACTCATGGGATGTGGCATCCTAACGCTTCGGATTGGCTCTGGGCACCTGGGGGCACTGAGGGCTCAGCCCAAAGTCTCCCTCCTGCTGACTATGATCTTCCTATTCACCTACTTCTTCTACTGCCTGACCGGCTCCTGCTGTGACTCTCAGCCGGGCGTCGGCTCTTTGCGCTCCCGGTATCCTGTCAGCTCGGCGGGGTCGGTTCCCATGGGGACCGGGGTGCTGGGGGCGCAAGAGTCTCTGCGCTCAGACTTTACAT
  5   1   2   10 seed Spl1 5g3  in                         CABK5411.5p ..........................CTTCCCTCTGGCCATGATCCATCCCTCAGCCGGGCAGCCCAGGGCACCATGCGGGCTCCCAGGGAAGCAGTGACCGACAGCCACCTTGTCTCCCTGCTTGTTACTGGTCTCCGGGGGGTTTGAGCAGAGCCGCAGTGCAATGAGTGCCCCCTTCCAACTTGGTCCCCGACCCCACTCATGGGATGTGGCATCCTAACGCTTCGGATTGGCTCTGGGCACCTGGGGGCACTGAGGGCTCAGCCCAAAGTCTCCCTCCTGCTGACTATGATCTTCCTATTCACCTACTTCTTCTACTGCCTGACCGGCTCCTGCTGTGACTCTCAGCCGGGCGTCGGCTCTTTGCGCTCCCGGTATCCTGTCAGCTCGGCGGGGTCGGTTCCCATGGGGACCGGGGTGCTGGGGGCGCAGGAGTCTCTGCGCTCAGACTTTACACCCAGGAACTCTCTGCTCTTGGATTCTATTCTTAGTGACTCTTTGCGCCCTGACTCTGCACTGAGGGAAGCCCTGCGCTCTGGCTCTGCGTCTGGGGATTCTCTGCGCTTTGGCGCTGCGTCAAGGGACCCTGGGAGTTCGGTCTCTGAACTTAGGAGCCCGGAATCTGTATTGAGGGACTCTCCTGCTCTTTGGAGCTCTCTCAGCTCTGGATCTAGTCTGATGGACAGGTTGCGCCCCAGTATTTCCAAAAGGGACCCCTCAAGTTTGGGAGCTGCTGAGGAGAACACAGTGGGACCTGTTTCTGACCCAAAGGACACTTTGCACTGGCAGGAAGCCTCCAAGGATCCTCTGAGCTCCGGCTTTGCCCTGAAGGAATCCCCACACTCAGACTGGCGGCCCCCCGGTTAT
  5   1   2   10  bld Tbd1 5g3  in                         CBXT2228.b1 ...............................CTCTGGCCATGATCCATCCCTCAGCCGGGCAGCCCAGGGCACCATGCGGGCTCCCAGGGAAGCAGTGACCGACAGCCACCTTGTCTCCCTGCTTGTTACTGGGCTCCGGGGGGTTTGAGCAGAGCCGCAGTGCAATGAGTGCCCCCTTCCAACTTGGTCCCCGACCCCACTCATGGGATGTGGCATCCTAACGCTTCGGATTGGCTCTGGGCACCTGGGGGCACTGAGGGCTCAGCCCAAAGTCTCCCTCCTGCTGACTATGATCTTCCTATTCACCTATTTCTTCTACTGCCTGACCGGCTCCTGCTGTGACTCTCAGCCGGGCATCGGCTCTTTGCGCTCCCGGTATCCTGTCAGCTCGGCGGGGTCGGTTCCCATGGGGACCGGGGTGCTGGGGGCGCAGGAGTCTCTGCGCTCAGACTTTACACCGAGGAACTCTCTGCTCTTGGATTCTATTCTTAGTGACTCTTTGCGCCCTGACTCTGCACTGAGGGAAGCCCTGCGCTCTGGCTCTGCGTCTGGGGATTCTCTGCGCTTTGGCGCTGCGTCAAGGGACCCTGGGAGTTCGGTCTCTGAACTTAGGAGCCCGGAATCTGTATTGAGGGACTCTCCTGCTCTTTGGAGCTCTCTCAGCTCTGGATCTAGTCTGATGGACAGGTTGCGCCCCAGTATTTCCAAAAGGGACCCCTCAAGTTTGGGAGCTGCTGAGGAGAACACGGTGGGACCTGTTTCTGACCCAAAGGACACTTTGCACTGGCAGGAAGCCTCCAAGGATCCTCTGAGCTCCGGCTTTGCCCTGAAGGA
  5   1   2       bld Spl1      in                         CABK9327.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTGAACTTAGGAGCCCGGAATCTGTATTGAGGGACTCTCCTGCTCTTTGGAGCTCTCTCAGCTCTGGATCTAGTCTGATGGACAGGTTGCGCCCCAGTATTTCCAAAAGGGACCCCTCAAGTTTGGGAGCTGCTGAGGAGAACACAGTGGGACCTGTTTCTGACCCAAAGGACACTTTGCACTGGCAGGAAGCCTCCAAGGATCCTCTGAGCTCCGGCTTTGCCCTGAAGGAATCCCCACACTCAGACTGGCGGCCCCCCGGTTATGTCCCACTTAACTCCCTGCGCTCTGACTCGGACCCTTTGCGCTCTGCGCCAGTAGGAAGGACGCACATATTGGCCGCTGAGGATACCCGGCAAGCCGACTCATCCGACTCGCTAGAGAGTCAGTATAAAGGCATACCGGGTCACACAAGGGCACAGAATGGGACAAACCCCTATCCAGCTCCCAGTCCTGGGGCGATCTCCATCCACAACAGTTTTGGGACTAAAAGGTTCCCCCAGGCGATCATAGTGGGGGTGAAGAAAGGGGGGACCCGGGCCCTGCTGGAATTCCTGAGAGTGCACCCTGACGTCAGGGCATTGGGGGCCGAACCCCACTTTTTTGACAGGTGTTATGACAAGGGACTGGAGTGGTACAGGAACTTGATGCCAAGGACCTTTGAAGGTCAGATCACCATGGAGAAAACCCCAAGTTATTTTGTTACCATGGAAGCTCCAAAGCGAATTTACAACATGTCCAGTGATACCAAGCTCATCGTGGTGGTGAGGAATCCAGTTACCCGGGCAATCTCCGACTATACGCAGACACTCTCAAAAACTCCTTCTTTGCCCAGCTTCCAAGCACTTTGCTTTAAAAACACTA
  5   1   2      ests                                 Xt7.1-CABK5411.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTT
                                                  Xt7.1-CHK-1008243477                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAAT
  3   1   2      seed Spl1 5g3  in                         CABK5411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTATACGCAGACACTCTCAAAAACTCCTTCTTTGCCCAGCTTCCAAGCACTTGCCTTTAAAAACACTAGCGGGCCTATCGACACCTCCTGGAGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTTAT
  3   1   2       bld Spl1      in                         CABK9327.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTTATAACTT
  3   1   2       add Tbd1 5g3  in                         CBXT2228.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTTGGTTTAAACCCCCCCCCCCCCCCCCCGTGGAGAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGGAATCCGCCCAACACTCAAAAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAAAACCAATGTATCGCCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATACATTTTTTATAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA077n17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTAAA
  5   1   2       add TbA       in                   TTbA077n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACACATGAACTCAGCCCTTATCGATATCGCATCGGCCTAGAATCCGCCTCAACACTCAATCAGACTTTCATACATACTCCTATCGCATTTCTCTCACTCCCAAGTCGGAAATGAGCTTTTCTATAATTCGCGATAACTATTTATATCAGAGAGGACATAACGTATCGCTAAGGAGTAGAGACCAATATTTAAAGCAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)