Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 217.0    0Xt7.1-XZT68553.5                            2 PI      76       1427     1831                Unknown (protein for IMAGE:5570551) [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012155969 Xt7.1-CABK5411.3.5 - 9 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     3     2     3     2     3     2     3     2     3     2     3
  5   1   2      ests                                 Xt7.1-CABK5411.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTT
                                               BLH ATG     654      60                           
                                               BLH MIN     879     111                           
                                               BLH MPR     630     111                           
                                               BLH OVR     177      31                           
                                               CDS MIN     177     111                           
                                               ORF LNG     177     112                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 1e-064     AAI36213.1 Unknown (protein for MGC:122942) [Xenopus tropicalis] ---------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 3e-072     NP_001024698.1 F52B10.2 [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 1e-075     XP_799088.1 PREDICTED: similar to Heparan sulfate glucosamine 3-O-sulfotransferase 5 (Heparan sulfate D-glucosaminyl 3-O-sulfotransferase 5) (Heparan sulfate 3-O-sulfotransferase 5) [Strongylocentrotus purpuratus] -------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 6e-100     NP_573370.1 CG7890-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 2e-116     XP_899581.1 PREDICTED: heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2 isoform 2 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 2e-125     AAI33197.1 Unknown (protein for IMAGE:5570551) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 3e-126     XP_686347.1 PREDICTED: similar to heparan sulfate D-glucosaminyl 3-O-sulfotransferase 3B1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 7e-129     NP_001009606.2 heparan sulfate (glucosamine) 3-O-sulfotransferase 6 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 6e-130     NP_001012402.1 heparan sulfate 3-O-sulfotransferase 6 [Mus musculus] -----------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 8e-137     XP_425243.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK5411.3.5                                                                           ATG---------------------------------------------------------------------TGA------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TGATAG---------------------------TGA---------------ATG------------------------------------------ATG------------------------------TAG------------------TAG---------------------------------------------------------------------------------------ATG------------TAG------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2      ests                                 Xt7.1-CABK5411.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTT
                                                  Xt7.1-CHK-1008243477                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAAT
  3   1   2      seed Spl1 5g3  in                         CABK5411.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTATACGCAGACACTCTCAAAAACTCCTTCTTTGCCCAGCTTCCAAGCACTTGCCTTTAAAAACACTAGCGGGCCTATCGACACCTCCTGGAGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTTAT
  3   1   2       bld Spl1      in                         CABK9327.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCGCCATTCGCATTGGCATTTATGCCAAGCACCTCGATAACTGGCTGCAATATTTCCCTCTGTCAAAGTTTCTCTTCGTTAGCGGCGAGAGGCTCGTCAGCGACCCCGCGGGGGAAATGGGCCGCGTTCAGGACTTCTTGGGGCTCAAAAGGGTCATTACGGATAAACATTTTTATTTCAATGAAACCAAGGGCTTTCCGTGCCTAAAGAAGCCGGAGGGGAGCAGCAAACCAAGGTGCCTGGGCAAATCCAAAGGACGGCCGCACCCCAACATCGACACCAAAGTCTTGCAGCGCCTTCAAGAGTTCTACAGACCCTACAACCAGAAATTCTACCAGATGACCGGGCAAGACTTTGGTTGGGACTGATAGTGTTTGTGTCTGAAATTGATCAGTTTCTGACTTTCCTCTGGTCTAATGCCCCCCTGTGGAAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAACAATGTATCACCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATAATTTTTTTATAACTT
  3   1   2       add Tbd1 5g3  in                         CBXT2228.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTTGGTTTAAACCCCCCCCCCCCCCCCCCGTGGAGAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGGAATCCGCCCAACACTCAAAAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTTAAAGCACAAAATGAGAAAAAAAAAACCAATGTATCGCCTATGACTTTTACGTTTTATTTGATATATGCAAATAAAAATACATTTTTTATAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA077n17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGGGAAGATTAACCTTCTTTCTTTACACATGAACTCAGCCCTTATCGATATTGCATTGGCCTAGAATCCGCCCAACACTCAATAGACTTTATACATACCCTATGCATTCTCCACTCCCAAGTGGAAATGGCTTTCTATAATTGTGATAACTATTTATATCAGAGAGGACATAATGTATGCTAAGGAGTAGAGACCAATATTAAA
  5   1   2       add TbA       in                   TTbA077n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACACATGAACTCAGCCCTTATCGATATCGCATCGGCCTAGAATCCGCCTCAACACTCAATCAGACTTTCATACATACTCCTATCGCATTTCTCTCACTCCCAAGTCGGAAATGAGCTTTTCTATAATTCGCGATAACTATTTATATCAGAGAGGACATAACGTATCGCTAAGGAGTAGAGACCAATATTTAAAGCAC

In case of problems mail me! (