Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 52%

 1012155973 Xt7.1-CAAQ6605.5.5 - 7 ESTs
                                                                       .....-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAQ6605.5.5                                                                                                                                                                                          ACAAATGCAGAGACAAACAGAGGAAGAAGTCTACTACGTGGGGATAGATGTGGGAACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACGGTGGTAGACCAAATGGAACAGTCAATCAAAATATGGGAACCTCGGCCTGACCACTATGAGCAATCTTCAGATGACATCTGGGCTGCTTGCTGCCGGGTTACCAAGCAAATTGTACATTCCAAAGACCCTAGATGCATTCGAGGACTTGGTTTTGATGCCACATGTTCTTTAGTGGCACTTGATACACAGTTCCAACCGCTGGCAGTGAATCCAGAAGGCGAGCATATGAGAAACGTCATAATGTGGATGGACCATCGTGCTGGAAGTCAGGTTGATCGTATAAATCGCACAAATCACAAGGTGTTGAGATATGTTGGTGGAGTAATGTCTGTTGAAATGCAGCCTCCCAAGCTCCTTTGGTTAAAGGAAAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGTGAGGGAAACTATGTTAAAATAGGAAATCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCTGCAGCTGCCAAAGACCTTGGCCTTCCAGAAGGACTTGCAGTGGCTGCTTCACTCATTGATGCCCATGCAGGAGGGTTAGGTGTAATTGGAGCCAGTCTGAAGGAATATGGCCTACAAGGCAAACATCATCCAATCACATCCAGGTTAGCTTTGATCTGTGGAACATCTTCATGTCATATGGGGATCAGCGAGAAGCCAATCTTTGTATCTGGAGTTTGGGGACCATACTACTCTGCTATGATTCCAGGTCTCTGGCTGAATGAGGGTGGTCAGAGTGCTACTGGGAAACTGATTGATCATGTTGTACGTGGCCACAGCGCATTTATGGAATTAGAAACTGAGTCTAAGGCCAGGGGCCAACATATATATACATACTTAAACAATCACCTGGATCAAATTAAGAAGTCTGGGCCTGTGGGGTTTTTAGCCGCTGATTTACATGTTTGGCCAGATTTCCATGGGAACCGCTCTCCTTTGGCAGATCTCACAATGAAAAGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGAACAAGGTACATTCTGGAAACAATGCAGACAGCAGGCCATCACATCAGCACTTTACATCTTTGCGGTGGACTGAGCAAGAACCCCCTCTTTGTGCAGATGCATGCAGACATTACGGGCTTACCTGTGGTCTTGTCCAAGGAGGTGGAGTCTGTGTTAGTCGGAGCTGCAATTCTTGGAGCCTGTGCATCTGGAGACTTTCCTTCTATAAAGGAAGCCATGGAGAAAATGTCAAAAGTGGGCAAAATAATTTTTCCTAACTACAAAGACAAAAGCTTTTATGATAAGAAGTATGAGGTGTTCTTAAAATTATCTGCTCACCAGAAGGAGTATCAGGCTATCATGGGAAGTATGTGACTTGGATGCCACATCCTGCAATGTGACAAGAGCTGTAATAGAAGAATGAAGATTAATCAGTAAAGTTTATGAAATGTAATAGAAATGTACTATGAAGCTTGGGAGATTACTGGCACTGTGCTCTCATTCAAACATGAGAACAAGCTGTTAGGCCAAAAGACGAATTGTCTTAAAGGGGAATCGAAATAATGTTAATAATCAATTAACATTCTGTAATTAAGTTACTCTTCACTATCCCTTTCTCAGCAATTTGTCTCTCTACATGCAGGAGTTGGAGTCAGATTTTGATTAACAATTAGGACTGTTTGCGTACTTTTTACATTCAATTATTAGAGAAATATTACACTACATTGTACATGTTGCAGTCAAATTGAAGAAAATGATATACAAGAAAATAAAAAGAAATA
                                                  Xt7.1-CHK-1008267690                                                                                                                                                                                                GCAGAGACAAACAGAGGAAGAAGTCTACTACGTGGGGATAGATGTGGGAACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACGGTGGTAGACCAAATGGAACAGTCAATCAAAATATGGGAACCTCGGCCTGACCACTATGAGCAATCTTCAGATGACATCTGGGCTGCTTGCTGCCGGGTTACCAAGCAAATTGTACATTCCAAAGACCCTAGATGCATTCGAGGACTTGGTTTTGATGCCACATGTTCTTTAGTGGCACTTGATACACAGTTCCAACCGCTGGCAGTGAATCCAGAAGGCGAGCATATGAGAAACGTCATAATGTGGATGGACCATCGTGCTGGAAGTCAGGTTGATCGTATAAATCGCACAAATCACAAGGTGTTGAGATATGTTGGTGGAGTAATGTCTGTTGAAATGCAGCCTCCCAAGCTCCTTTGGTTAAAGGAAAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGTGAGGGAAACTATGTTAAAATAGGAAATCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCTGCAGCTGCCAAAGACCTTGGCCTTCCAGAAGGACTTGCAGTGGCTGCTTCACTCATTGATGCCCATGCAGGAGGGTTAGGTGTAATTGGAGCCAGTCTGAAGGAATATGGCCTACAAGGCAAACATCATCCAATCACATCCAGGTTAGCTTTGATCTGTGGAACATCTTCATGTCATATGGGGATCAGCGAGAAGCCAATCTTTGTATCTGGAGTTTGGGGACCATACTACTCTGCTATGATTCCAGGTCTCTGGCTGAATGAGGGTGGTCAGAGTGCTACTGGGAAACTGATTGATCATGTTGTACGTGGCCACAGCGCATTTATGGAATTAGAAACTGAGTCTAAGGCCAGGGGCCAACATATATATACATACTTAAACAATCACCTGGATCAAATTAAGAAGTCTGGGCCTGTGGGGTTTTTAGCCGCTGATTTACATGTTTGGCCAGATTTCCATGGGAACCGCTCTCCTTTGGCAGATCTCACAATGAAAAGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGAACAAGGTACATTCTGGAAACAATGCAGACAGCAGGCCATCACATCAGCACTTTACATCTTTGCGGTGGACTGAGCAAGAACCCCCTCTTTGTGCAGATGCATGCAGACATTACGGGCTTACCTGTGGTCTTGTCCAAGGAGGTGGAGTCTGTGTTAGTCGGAGCTGCAATTCTTGGAGCCTGTGCATCTGGAGACTTTCCTTCTATAAAGGAAGCCATGGAGAAAATGTCAAAAGTGGGCAAAATAATTTTTCCTAACTACAAAGACAAAAGCTTTTATGATAAGAAGTATGAGGTGTTCTTAAAATTATCTGCTCACCAGAAGGAGTATCAGGCTATCATGGGAAGTATGTGACTTGGATGCCACATCCTGCAATGTGACAAGAGCTGTAATAGAAGAATGAAGATTAATCAGTAAAGTTTATGAAATGTAATAGAAATGTACTATGAAGCTTGGGAGATTACTGGCACTGTGCTCTCATTCAAACATGAGAACAAGCTGTTAGGCCAAAAGACGAATTGTCTTAAAGGGGAATCGAAATAATGTTAATAATCAATTAACATTCTGTAATTAAGTTACTCTTCACTATCCCTTTCTCAGCAATTTGTCTCTCTACATGCAGGAGTTGGAGTCAGATTTTGATTAACAATTAGGACTGTTTGCGTACTTTTTACATTCAATTATTAGAGAAATATTACACTACATTGTACATGTTGCAGTCAAATTGAAGAAAATGATATACAxxAAAATAAAAAGAAATACTCTCA
                                                      consensus depths                                                                                                                                                                                               2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     2     2     2     2
  5   1   2       e50                                 Xt7.1-CAAQ6605.5                                                                                     CCTCGTGCCGGGCAGGTTAGTCTCCTTATGAAAAGGTCAAATTATACTGTGTGTTTATATTCCAAATAAATGATGACTGTTCGTGGAACTGTAAAAGAGGTACAAATGCAGAGACAAACAGAGGAAGAAGTCTACTACGTGGGGATAGATGTGGGAACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACGGTGGTAGACCAAATGGAACAGTCAATCAAAATATGGGAACCTCGGCCTGACCACTATGAGCAATCTTCAGATGACATCTGGGCTGCTTGCTGCCGGGTTACCAAGCAAATTGTACATTCCAAAGACCCTAGATGCATTCGAGGACTTGGTTTTGATGCCACATGTTCTTTAGTGGCACTTGATACACAGTTCCAACCGCTGGCAGTGAATCCAGAAGGCGAGCATATGAGAAACGTCATAATGTGGATGGACCATCGTGCTGGAAGTCAGGTTGATCGTATAAATCGCACAAATCACAAGGTGTTGAGATATGTTGGTGGAGTAATGTCTGTTGAAATGCAGCCTCCCAAGCTCCTTTGGTTAAAGGAAAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGTGAGGGAAACTATGTTAAAATAGGAAATCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCTGCAGCTGCCAAAGACCTTGGCCTTCCAGAAGGACTTGCAGTGGCTGCTTCACTCATTGATGCCCATGCAGGAGGGTTAGGTGTAATTGGAGCCAGTCTGAAGGAATATGGCCTACAAGGCAAACATCATCCAATCACATCCAGGTTAGCTTTGATCTGTGGAACATCTTCATGTCATATGGGGATCAGCGAGAAGCCAATCTTTGTATCTGGAGTTTGGGGACCATACTACTCTGCTATGATTCCAGGTCTCTGGCTGAATGAGGGTGGTCAGAGTGCTACTGGGAAACTGATTGATCATGTTGTACGTGGCCACAGCGCATTTATGGAATTAGAAACTGAGTCTAAGGCCAGGGGCCAACATATATATACATACTTAAACAATCACCTGGATCAAATTAAGAAGTCTGGGCCTGTGGGGTTTTTAGCCGCTGATTTACATGTTTGGCCAGATTTCCATGGGAACCGCTCTCCTTTGGCAGATCTCACAATGAAAAGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGGACAAGGTACATT
  5   1   2       e50                                 Xt7.1-CABC7323.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTTGGCAGATCTCACATGAAAAGGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGAACAAGGTACATTCTGGAAACAATGCAGACAGCAGGCCATCACATCAGCACTTTACATCTTTGCGGTGGACTGAGCAAGAACCCCCTCTTTGTGCAGATGCATGCAGACATTACGGGCTTACCTGTGGTCTTGTCCAAGGAGGTGGAGTCTGTGTTAGTCGGAGCTGCAATTCTTGGAGCCTGTGCATCTGGAGACTTTCCTTCTATAAAGGAAGCCATGGAGAAAATGTCAAAAGTGGGCAAAATAATTTTTCCTAACTACAAAGACAAAAGCTTTTATGATAAGAAGTATGAGGTGTTCTTAAAATTATCTGCTCACCAGAAGGAGTATCAGGCTATCATGGGAAGTATGTGACTTGGATGCCACATCCTGCAATGTGACAAGAGCTGTAATAGAAGAATGAAGATTAATCAGTAAAGTTTATGAAATGTAATAGAAATGTACTATGAAGCTTGGGAGATTACTGGCACTGTGCTCTCATTCAAACATGAGAACAAGCTGTTAGGCCAAAAGACGAATTGTCTTAAAGGGGAATCGAAATAATGTTAATAATCAATTAACATTCTGTAATTAAGTTACTCTTCACTATCCCTTTCTCAGCAATTTGTCTCTCTACATGCAGGAGTTGGAGTCAGATTTTGATTAACAATTAGGACTGTTTGCGTACTTTTTACATTCAATTATTAGAGAAATATTACACTACATTGTACATGTTGCAGTCAAATTGAAGAAAATGATATACAGAAAAATAAAAAGAAATACTCTCAAAATGTAGTATTTCCATGCAAAAAGACTGGGAATTACTTTTTTGTTTATCAAGCTTAGTTTTACTGAGCATTGATTAAAAAGTGAAAAAAGAAGTGGCCTTGTAAGTTACAAAATGTATTTTTAGTAGCTGAAGCATCTTCTATGCCCCGGTTTTGCCTGCATTCCATACCCAACCCAGAGAGCGTTAGGGGATAATGTAACTACACAATTGAAGCCACAATTCTGAATGATCTGAATATCTCTGTTCTTTTTATATTTTATGACTGCAAAGTTCCAGGGGAAGTGAATTAAAGCTCAGTGATGCTGTAGGATTGTTGCGCTAGGGTCACACAGCAGATTGCTTCAGTAAGTGCATTGTTCTTGCACCTAAAGAGTGTGCCGCAATCCTGACAGCGGAAATTTTCAATACAACAAACATAATTGCCCCTCACAGCCGCATTTATGCTTGGATTATGTGGAAAACTATCAATTCTGAGTAAAAAACAAGGTAATTTGCATCTGAAATTGCACTACATCTACATCTACACAATATTAGCCTTGACATAAGAAGATTTGGCCTAAATTGAGCATTAAATTAAAGAGTAAATATAAAGAATAAAAACATTCACAATATACAAGGCTAGCCAAATACCAGAAATATCATAAAATGCTTTCTAGGCACTCTTGTACCAATCTGAAGTCAAATTCTTCCTAGTTATTAATGGATCTTTAAAGGGG
                                               BLH ATG     337      84                                                                                                                                                                                          
                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 4e-009     AAI35304.1 Unknown (protein for MGC:121305) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                             PREDICTED - Sc ---- 1e-105     NP_010394.1 Hypothetical ORF; Ydr109cp [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PREDICTED - Mm ==== 1e-147     NP_083623.1 hypothetical protein LOC75578 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN --- Dm ==== 3e-148     NP_728918.1 CG11594-PA, isoform A [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 1e-166     NP_998446.1 zgc:85818 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 8e-173     XP_791044.1 PREDICTED: similar to CG11594-PA, isoform A [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Hs ==== 0          NP_060761.2 hypothetical protein FLJ10986 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 0          XP_001235529.1 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAH78117.1 MGC83632 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                    Xt7.1-CAAQ6605.5.5                                                                                                                                                                                              ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---ATG---------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------ATG------ATGTGA---------------------------------------------ATG------------TAA------TGA------------ATG---------------------------------------------------------------------------------------------------TAA---TAATAA---------------TAA---------------------------------------------------------------------TGA------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       e50                                 Xt7.1-CAAQ6605.5                                                                                     CCTCGTGCCGGGCAGGTTAGTCTCCTTATGAAAAGGTCAAATTATACTGTGTGTTTATATTCCAAATAAATGATGACTGTTCGTGGAACTGTAAAAGAGGTACAAATGCAGAGACAAACAGAGGAAGAAGTCTACTACGTGGGGATAGATGTGGGAACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACGGTGGTAGACCAAATGGAACAGTCAATCAAAATATGGGAACCTCGGCCTGACCACTATGAGCAATCTTCAGATGACATCTGGGCTGCTTGCTGCCGGGTTACCAAGCAAATTGTACATTCCAAAGACCCTAGATGCATTCGAGGACTTGGTTTTGATGCCACATGTTCTTTAGTGGCACTTGATACACAGTTCCAACCGCTGGCAGTGAATCCAGAAGGCGAGCATATGAGAAACGTCATAATGTGGATGGACCATCGTGCTGGAAGTCAGGTTGATCGTATAAATCGCACAAATCACAAGGTGTTGAGATATGTTGGTGGAGTAATGTCTGTTGAAATGCAGCCTCCCAAGCTCCTTTGGTTAAAGGAAAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGTGAGGGAAACTATGTTAAAATAGGAAATCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCTGCAGCTGCCAAAGACCTTGGCCTTCCAGAAGGACTTGCAGTGGCTGCTTCACTCATTGATGCCCATGCAGGAGGGTTAGGTGTAATTGGAGCCAGTCTGAAGGAATATGGCCTACAAGGCAAACATCATCCAATCACATCCAGGTTAGCTTTGATCTGTGGAACATCTTCATGTCATATGGGGATCAGCGAGAAGCCAATCTTTGTATCTGGAGTTTGGGGACCATACTACTCTGCTATGATTCCAGGTCTCTGGCTGAATGAGGGTGGTCAGAGTGCTACTGGGAAACTGATTGATCATGTTGTACGTGGCCACAGCGCATTTATGGAATTAGAAACTGAGTCTAAGGCCAGGGGCCAACATATATATACATACTTAAACAATCACCTGGATCAAATTAAGAAGTCTGGGCCTGTGGGGTTTTTAGCCGCTGATTTACATGTTTGGCCAGATTTCCATGGGAACCGCTCTCCTTTGGCAGATCTCACAATGAAAAGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGGACAAGGTACATT
                                                  Xt7.1-CHK-1008244760                                                                                           GCCGGGCAGGTTAGTCTCCTTATGAAAAGGTCAAATTATACTGTGTGTTTATATTCCAAATAAATGATGACTGTTCGTGGAACTGTAAAAGAGGTACAAATGCAGAGACAAACAGAGGAAGAAGTCTACTACGTGGGGATAGATGTGGGAACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACGGTGGTAGACCAAATGGAACAGTCAATCAAAATATGGGAACCTCGGCCTGACCACTATGAGCAATCTTCAGATGACATCTGGGCTGCTTGCTGCCGGGTTACCAAGCAAATTGTACATTCCAAAGACCCTAGATGCATTCGAGGACTTGGTTTTGATGCCACATGTTCTTTAGTGGCACTTGATACACAGTTCCAACCGCTGGCAGTGAATCCAGAAGGCGAGCATATGAGAAACGTCATAATGTGGATGGACCATCGTGCTGGAAGTCAGGTTGATCGTATAAATCGCACAAATCACAAGGTGTTGAGATATGTTGGTGGAGTAATGTCTGTTGAAATGCAGCCTCCCAAGCTCCTTTGGTTAAAGGAAAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGTGAGGGAAACTATGTTAAAATAGGAAATCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCTGCAGCTGCCAAAGACCTTGGCCTTCCAGAAGGACTTGCAGTGGCTGCTTCACTCATTGATGCCCATGCAGGAGGGTTAGGTGTAATTGGAGCCAGTCTGAAGGAATATGGCCTACAAGGCAAACATCATCCAATCACATCCAGGTTAGCTTTGATCTGTGGAACATCTTCATGTCATATGGGGATCAGCGAGAAGCCAATCTTTGTATCTGGAGTTTGGGGACCATACTACTCTGCTATGATTCCAGGTCTCTGGCTGAATGAGGGTGGTCAGAGTGCTACTGGGAAACTGATTGATCATGTTGTACGTGGCCACAGCGCATTTATGGAATTAGAAACTGAGTCTAAGGCCAGGGGCCAACATATATATACATACTTAAACAATCACCTGGATCAAATTAAGAAGTCTGGGCCTGTGGGGTTTTTAGCCGCTGATTTACATGTTTGGCCAGATTTCCATGGGAACCGCTCTCCTTTGGCAGATCTCACAATGAAAAGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGGACAAGG
  5   1   2   11  bld Fat1 5g3  in                         CABC7323.5p ....................................................................................CCTCGTGCCGGGCAGGTTAGTCTCCTTATGAAAAGGTCAAATTATACTGTGTGTTTATATTCCAAATAAATGATGACTGTTCGTGGAACTGTAAAAGAGGTACAAATGCAGAGACAAACAGAGGAAGAAGTCTACTACGTGGGGATAGATGTGGGAACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACGGTGGTAGACCAAATGGAACAGTCAATCAAAATATGGGAACCTCGGCCTGACCACTATGAGCAATCTTCAGATGACATCTGGGCTGCTTGCTGCCGGGTTACCAAGCAAATTGTACATTCCAAAGACCCTAGATGCATTCGAGGACTTGGTTTTGATGCCACATGTTCTTTAGTGGCACTTGATACACAGTTCCAACCGCTGGCAGTGAATCCAGAAGGCGAGCATATGAGAAACGTCATAATGTGGATGGACCATCGTGCTGGAAGTCAGGTTGATCGTATAAATCGCACAAATCACAAGGTGTTGAGATATGTTGGTGGAGTAATGTCTGTTGAAATGCAGCCTCCCAAGCTCCTTTGGTTAAAGGAAAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGAAATTGGCTATTGAAAGTAGAACAGGTCACCTGGAAAAAGAATCTGCAACAGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGNGTTGGAGGATATTTGT
  5   1   2   10 seed Hrt1 PIPE in                         CAAQ6605.5p .................................................................................................................................................................CGTAATCTTTCAGTAAAAGCAAGTACAAATGCAGAGACAAACAGAGGAAGAAGTCTACTACGTGGGGATAGATGTGGGAACAGCAAGTGTGCGTGTGGCTTTGGTAGACCAGTTTGGAACGGTGGTAGACCAAATGGAACAGTCAATCAAAATATGGGAACCTCGGCCTGACCACTATGAGCAATCTTCAGATGACATCTGGGCTGCTTGCTGCCGGGTTACCAAGCAAATTGTACATTCCAAAGACCCTAGATGCATTCGAGGACTTGGTTTTGATGCCACATGTTCTTTAGTGGCACTTGATACACAGTTCCAACCGCTGGCAGTGAATCCAGAAGGCGAGCATATGAGAAACGTCATAATGTGGATGGACCATCGTGCTGGAAGTCAGGTTGATCGTATAAATCGCACAAATCACAAGGTGTTGAGATATGTTGGTGGAGTAATGTCTGTTGAAATGCAGCCTCCCAAGCTCCTTTGGTTAAAGGAAAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGTGAGGGAAACTATGTTAAAATAGGAAATCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCTGCAGCTGCCAAAGACCTTGGCCTTCCAGAAGGACTTGCAGTGGCTGCTTCACTCATTGATGCCCATG
  5   1   2       bld Abd0                               IMAGE:7017172                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCTAACTCATGATGGAAGCATACGTTGAGAAACCAGAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGAAATTGGCTATTGAAAGTAGAACAGGTCACCTGGAAAAAGAATCTGCAACAGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGTGAGGGAAACTATGTTAAAATAGGAAATCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCTGCAGCTGCCAAAGACCTTGGCCTTCCAGAAGGACTTGCAGTGGCTGCTTCACTCATTGATGCCCATGCAGGAGGGTTAGGTGTAATTGGAGCCAGTCTGAAGGAATATGGCCTACAAGGCAAACATCATCCAATCACATCCAGGTTAGCTTTGATCTGTGGAACATCTTCATGTCATATGGGGATCAGCGAGAAGCCAATCTTTGTATCTGGAGTTTGGGGACCATACTACTCTGCTATGATTCCAGGTCTCTGGCTGAATGAGGGTGGTCAGAGTGCTACTGGGAAACTGATTGATCATGTTGTACGTGGCCACAGCGCATTTATGGAATTAGAAACTGAGTCTAAGGCCAGG
  5   1   2      skin AbdN                               IMAGE:7022948                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAAACTTGCTTGAAGAGTGTTGGAATAAATCAGGGCAATTCTTTGATCTACCAGACTTCTTAACTTGGAAAGCAACTGGAGACACCACAAGGTCATTTTGTACACTGGTATGCAAATGGACATATTCTTTAGATCACGGATGGGATGATAGTTTTTGGAAGGAGATTGGGTTGGAGGATATTTGTGAGGGAAACTATGTTAAAATAGGAAATCAAGTCATGTCTCCAGGAGCTTCCATAGGGAATTGTCTAACTGCTGCAGCTGCCAAAGACCTTGGCCTTCCAGAAGGACTTGCAGTGGCTGCTTCACTCATTGATGCCCATGCAGGAGGGTTAGGTGTAATTGGAGCCAGTCTGAAGGAATATGGCCTACAAGGCAAACATCATCCAATCACATCCAGGTTAGCTTTGATCTGTGGAACATCTTCATGTCATATGGGGATCAGCGAGAAGCCAATCTTTGTATCTGGAGTTTGGGGACCATACTACTCTGCTATGATTCCAGGTCTCTGGCTGAATGAGGGTGGTCAGAGTGCTACTGGGAAACTGATTGATCATGTTGTACGTGGCCACAGCGCATTTATGGAATTAGAAACTGAGTCTAAGGCCAGGGGCCAACATATATATACATACTTAAACAATCACCTGGATCAAATTAAGAAGTCTGGGCCTGTGGGGTTTTTAGCCGCTGATTTACATGTTTGGCCAGATTTCCATGGGAACCGCTCTCCTTTGGCAGATCTCACAATGAAAAGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGGACAAGGTACATTCTGGA
  5   1   2       e50                                 Xt7.1-CABC7323.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTTGGCAGATCTCACATGAAAAGGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGAACAAGGTACATTCTGGAAACAATGCAGACAGCAGGCCATCACATCAGCACTTTACATCTTTGCGGTGGACTGAGCAAGAACCCCCTCTTTGTGCAGATGCATGCAGACATTACGGGCTTACCTGTGGTCTTGTCCAAGGAGGTGGAGTCTGTGTTAGTCGGAGCTGCAATTCTTGGAGCCTGTGCATCTGGAGACTTTCCTTCTATAAAGGAAGCCATGGAGAAAATGTCAAAAGTGGGCAAAATAATTTTTCCTAACTACAAAGACAAAAGCTTTTATGATAAGAAGTATGAGGTGTTCTTAAAATTATCTGCTCACCAGAAGGAGTATCAGGCTATCATGGGAAGTATGTGACTTGGATGCCACATCCTGCAATGTGACAAGAGCTGTAATAGAAGAATGAAGATTAATCAGTAAAGTTTATGAAATGTAATAGAAATGTACTATGAAGCTTGGGAGATTACTGGCACTGTGCTCTCATTCAAACATGAGAACAAGCTGTTAGGCCAAAAGACGAATTGTCTTAAAGGGGAATCGAAATAATGTTAATAATCAATTAACATTCTGTAATTAAGTTACTCTTCACTATCCCTTTCTCAGCAATTTGTCTCTCTACATGCAGGAGTTGGAGTCAGATTTTGATTAACAATTAGGACTGTTTGCGTACTTTTTACATTCAATTATTAGAGAAATATTACACTACATTGTACATGTTGCAGTCAAATTGAAGAAAATGATATACAGAAAAATAAAAAGAAATACTCTCAAAATGTAGTATTTCCATGCAAAAAGACTGGGAATTACTTTTTTGTTTATCAAGCTTAGTTTTACTGAGCATTGATTAAAAAGTGAAAAAAGAAGTGGCCTTGTAAGTTACAAAATGTATTTTTAGTAGCTGAAGCATCTTCTATGCCCCGGTTTTGCCTGCATTCCATACCCAACCCAGAGAGCGTTAGGGGATAATGTAACTACACAATTGAAGCCACAATTCTGAATGATCTGAATATCTCTGTTCTTTTTATATTTTATGACTGCAAAGTTCCAGGGGAAGTGAATTAAAGCTCAGTGATGCTGTAGGATTGTTGCGCTAGGGTCACACAGCAGATTGCTTCAGTAAGTGCATTGTTCTTGCACCTAAAGAGTGTGCCGCAATCCTGACAGCGGAAATTTTCAATACAACAAACATAATTGCCCCTCACAGCCGCATTTATGCTTGGATTATGTGGAAAACTATCAATTCTGAGTAAAAAACAAGGTAATTTGCATCTGAAATTGCACTACATCTACATCTACACAATATTAGCCTTGACATAAGAAGATTTGGCCTAAATTGAGCATTAAATTAAAGAGTAAATATAAAGAATAAAAACATTCACAATATACAAGGCTAGCCAAATACCAGAAATATCATAAAATGCTTTCTAGGCACTCTTGTACCAATCTGAAGTCAAATTCTTCCTAGTTATTAATGGATCTTTAAAGGGG
                                                  Xt7.1-CHK-1008249562                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGATCTCACATGAAAAGGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGAACAAGGTACATTCTGGAAACAATGCAGACAGCAGGCCATCACATCAGCACTTTACATCTTTGCGGTGGACTGAGCAAGAACCCCCTCTTTGTGCAGATGCATGCAGACATTACGGGCTTACCTGTGGTCTTGTCCAAGGAGGTGGAGTCTGTGTTAGTCGGAGCTGCAATTCTTGGAGCCTGTGCATCTGGAGACTTTCCTTCTATAAAGGAAGCCATGGAGAAAATGTCAAAAGTGGGCAAAATAATTTTTCCTAACTACAAAGACAAAAGCTTTTATGATAAGAAGTATGAGGTGTTCTTAAAATTATCTGCTCACCAGAAGGAGTATCAGGCTATCATGGGAAGTATGTGACTTGGATGCCACATCCTGCAATGTGACAAGAGCTGTAATAGAAGAATGAAGATTAATCAGTAAAGTTTATGAAATGTAATAGAAATGTACTATGAAGCTTGGGAGATTACTGGCACTGTGCTCTCATTCAAACATGAGAACAAGCTGTTAGGCCAAAAGACGAATTGTCTTAAAGGGGAATCGAAATAATGTTAATAATCAATTAACATTCTGTAATTAAGTTACTCTTCACTATCCCTTTCTCAGCAATTTGTCTCTCTACATGCAGGAGTTGGAGTCAGATTTTGATTAACAATTAGGACTGTTTGCGTACTTTTTACATTCAATTATTAGAGAAATATTACACTACATTGTACATGTTGCAGTCAAATTGAAGAAAATGATATACAxxAAAATAAAAAGAAATACTCTCAAAATGTAGTATTTCCATGCAAAAAGACTGGGAATTACTTTTTTGTTTATCAAGCTTAGTTTTACTGAGCATTGATTAAAAAGTGAAAAAAGAAGTGGCCTTGTAAGTTACAAAATGTATTTTTAGTAGCTGAAGCATCTTCTATGCCCCGGTTTTGCCTGCATTCCATACCCAACCCAGAGAGCGTTAGGGGATAATGTAACTACACAATTGAAGCCACAATTCTGAATGATCTGAATATCTCTGTTCTTTTTATATTTTATGACTGCAAAGTTCCAGGGGAAGTGAATTAAAGCTCAGTGATGCTGTAGGATTGTTGCGCTAGGGTCACACAGCAGATTGCTTCAGTAAGTGCATTGTTCTTGCACCTAAAGAGTGTGCCGCAATCCTGACAGCGGAAATTTTCAATACAACAAACATAATTGCCCCTCACAGCCGCATTTATGCTTGGATTATGTGGAAAACTATCAATTCTGAGTAAAAAACAAGGTAATTTGCATCTGAAATTGCACTACATCTACATCTACACAATATTAGCCTTGACATAAGAAGATTTGGCCTAAATTGAGCATTAAATTAAAGAGTAAATATAAAGAATAAAAACATTCACAATATACAAGGCTAGCCAAATACCAGAAATATCATAAAATGCTTTCTAGGCACTCTTGTACCAATCTGAAGTCAAATTCTTCCTAGTTATTAATGGATCTTTAAAGGGGAACCCA
  3   1   2      seed Fat1 5g3  in                         CABC7323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTTGGCAGATCTCACATGAAAAGGCATGGTTGTTGGACTAACTTTGTCTAAAAGCTTGGATGATTTGGCTACTCTTTACTTGGCCACAATACAAGCCATTGCGTTGGGAACAAGGTACATTCTGGAAACAATGCAGACAGCAGGCCATCACATCAGCACTTTACATCTTTGCGGTGGACTGAGCAAGAACCCCCTCTTTGTGCAGATGCATGCAGACATTACGGGCTTACCTGTGGTCTTGTCCAAGGAGGTGGAGTCTGTGTTAGTCGGAGCTGCAATTCTTGGAGCCTGTGCATCTGGAGACTTTCCTTCTATAAAGGAAGCCATGGAGAAAATGTCAAAAGTGGGCAAAATAATTTTTCCTAACTACAAAGACAAAAGCTTTTATGATAAGAAGTATGAGGTGTTCTTAAAATTATCTGCTCACCAGAAGGAGTATCAGGCTATCATGGGAAGTATGTGACTTGGATGCCACATCCTGCAATGTGACAAGAGCTGTAATAGAAGAATGAAGATTAATCAGTAAAGTTTATGAAATGTAATAGAAATGTACTATGAAGCTTGGGAGATTACTGGCACTGTGCTCTCATTCAAACATGAGAACAAGCTGTTAGGCCAAAAGACGAATTGTCTTAAAGGGGAATCGAAATAATGTTAATAATCAATTAACATTCTGTAATTAAGTTACTCTTCACTATCCCTTTCTCAGCAATTTGTCTCTCTACATGCAGGAGTTGGAGTCAGATTTTGATTAACAATTAGGACTGTTTGCGTACTTTTTACATTCAATTATTAGAGAAATATTACACTACATTGTACATGTTGCAGTCAAATTGAAGAAAATGATATC
  3   1   2       bld Hrt1 PIPE in                         CAAQ6605.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAATACAAGCCATTGCGTTGGGAACAAGGTACATTCTGGAAACAATGCAGACAGCAGGCCATCACATCAGCACTTTACATCTTTGCGGTGGACTGAGCAAGAACCCCCTCTTTGTGCAGATGCATGCAGACATTACGGGCTTACCTGTGGTCTTGTCCAAGGAGGTGGAGTCTGTGTTAGTCGGAGCTGCAATTCTTGGAGCCTGTGCATCTGGAGACTTTCCTTCTATAAAGGAAGCCATGGAGAAAATGTCAAAAGTGGGCAAAATAATTTTTCCTAACTACAAAGACAAAAGCTTTTATGATAAGAAGTATGAGGTGTTCTTAAAATTATCTGCTCACCAGAAGGAGTATCAGGCTATCATGGGAAGTATGTGACTTGGATGCCACATCCTGCAATGTGACAAGAGCTGTAATAGAAGAATGAAGATTAATCAGTAAAGTTTATGAAATGTAATAGAAATGTACTATGAAGCTTGGGAGATTACTGGCACTGTGCTCTCATTCAAACATGAGAACAAGCTGTTAGGCCAAAAGACGAATTGTCTTAAAGGGGAATCGAAATAATGTTAATAATCAATTAACATTCTGTAATTAAGTTACTCTTCACTATCCCTTTCTCAGCAATTTGTCTCTCTACATGCAGGAGTTGGAGTCAGATTTTGATTAACAATTAGGACTGTTTGCGTACTTTTTACATTCAATTATTAGAGAAATATTACACTACATTGTACATGTTGCAGTCAAATTGAAGAAAATGATATACAAGAAAATAAAAAGAAATACTCTCAAAAAA
  3   1   2       bld Brn2      out                       CAAJ13183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTACATTGTACATGTTGCAGTCAAATTGAAGAAAATGATATNCAGAAAAATAAAAAGAAATACTCTCAAAATGTAGTATTTCCATGCAAAAAGACTGGGAATTACTTTTTTGTTTATCAAGCTTAGTTTTACTGAGCATTGATTAAAAAGTGAAAAAAGAAGTGGCCTTGTAAGTTACAAAATGTATTTTTAGTAGCTGAAGCATCTTCTATGCCCCGGTTTTGCCTGCATTCCATACCCAACCCAGAGAGCGTTAGGGGATAATGTAACTACACAATTGAAGCCACAATTCTGAATGATCTGAATATCTCTGTTCTTTTTATATTTTATGACTGCAAAGTTCCAGGGGAAGTGAATTAAAGCTCAGTGATGCTGTAGGATTGTTGCGCTAGGGTCACACAGCAGATTGCTTCAGTAAGTGCATTGTTCTTGCACCTAAAGAGTGTGCCGCAATCCTGACAGCGGAAATTTTCAATACAACAAACATAATTGCCCCTCACAGCCGCATTTATGCTTGGATTATGTGGAAAACTATCAATTCTGAGTAAAAAACAAGGTAATTTGCATCTGAAATTGCACTACATCTACATCTACACAATATTAGCCTTGACATAAGAAGATTTGGCCTAAATTGAGCATTAAATTAAAGAGTAAATATAAAGAATAAAAACATTCACAATATACAAGGCTAGCCAAATACCAGAAATATCATAAAATGCTTTCTAGGCACTCTTGTACCAATCTGAAGTCAAATTCTTCCTAGTTATTAATGGATCTTTAAAGGGGAACCCAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)