Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT4238.5                            13 END     3          75       23                (no blast hit)
     2   2.0    0Xt7.1-CAAM6682.5                            4 END     1          25       25                Ppfibp2-prov protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012156110 Xt7.1-CAAN5293.5.5 - 4 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAN5293.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGGACCTGGAGAAGGAACTGGGGGATCAAACACCCGTTGCACAGGAAGAAGCTCCAGTTGGCTCTGCAGTCGCTCGGGTCGGAGGATGAAAGCAACTACGGCAAATTGGACTACAGATGGGTCACCAGGTGGCTGGACGATATCGGGCTCCCCCAGTACAAGACCCAGTTTGACGACGCCAAGATCGATGGGAGGATGCTGCACTATTTGGCCGTGGATGATCTGCTCTCCCTGAAAGTGGTCAGTGTCCTGCACCATCTCAGCATCAAGAGAGCCATTCAGGTTCTGCGCATCAACGACTTCGAAGCCAACTGTCTGCGCCGACGCCCCTCGGATGAGAGTAACATCAGCCCCTCGGAGGTGGCGCAGTGGACCAACCACAGGGTGATGGAGTGGCTGCGCTCGGTGGATCTGGCCGAATACGCCCCCAATTTGCGGGGGAGCGGCGTGCACGGCGGCCTGATGGTTCTTGAGCCTCGATTTAATGTGGAGACAATGGCCCAGTTACTTAATATCCCTAGCAACAAGACCCTCCTGCGCCGGCACCTAGCAACCCACTTCAACCTCCTCATTGGCCAACGGGCCCAGATACAGAAACAGGAAGCCCTGGCGTCCCCGGAATATGTGCTCCTGACTGCCACTGCCAAAGTAAAGCCCAAGAAGCTGACATTCAGTACCTTTGGGACCCTGCGGAAGAGGAAGCAGGAGGAGGCGGAGGAGTACGTGTGCCCGATGGAGTTGGGTCAGACCTCGGGAGACAGTATAATCAAACCCCTGCGGCCGGGGCTGGACCTGCGCATGTTAAACGATGAGGATTTGGACCGACTGGAGCAGATGGAGGATTCGGAGGGGACAGTGAGGCAAATCGGGGCGTTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCCACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCATGATGGGGGTCATTCTATAGAGCGGCAGGGAGCCCCCTATTGGCTGAGATACTCAGTACCACTAAGCTATACATCCCGGGCTGCTCTGCCAATAACCATGGGGTAATTATAGTGCAGAATCTGCACCCCCCCCCACCTTCTGCCCTTGCCAGAAAGTTCCCCCCATACAGGCACCATGCCCCCCCCCCCCCCTAAACTTATTTTGGGGGTATGCCGCTTATTAAAGGGAGT
                                                  Xt7.1-CHK-1008267447                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGGAGAAGGAACTGGGGGATCAAACACCCGTTGCACAGGAAGAAGCTCCAGTTGGCTCTGCAGTCGCTCGGGTCGGAGGATGAAAGCAACTACGGCAAATTGGACTACAGATGGGTCACCAGGTGGCTGGACGATATCGGGCTCCCCCAGTACAAGACCCAGTTTGACGACGCCAAGATCGATGGGAGGATGCTGCACTATTTGGCCGTGGATGATCTGCTCTCCCTGAAAGTGGTCAGTGTCCTGCACCATCTCAGCATCAAGAGAGCCATTCAGGTTCTGCGCATCAACGACTTCGAAGCCAACTGTCTGCGCCGACGCCCCTCGGATGAGAGTAACATCAGCCCCTCGGAGGTGGCGCAGTGGACCAACCACAGGGTGATGGAGTGGCTGCGCTCGGTGGATCTGGCCGAATACGCCCCCAATTTGCGGGGGAGCGGCGTGCACGGCGGCCTGATGGTTCTTGAGCCTCGATTTAATGTGGAGACAATGGCCCAGTTACTTAATATCCCTAGCAACAAGACCCTCCTGCGCCGGCACCTAGCAACCCACTTCAACCTCCTCATTGGCCAACGGGCCCAGATACAGAAACAGGAAGCCCTGGCGTCCCCGGAATATGTGCTCCTGACTGCCACTGCCAAAGTAAAGCCCAAGAAGCTGACATTCAGTACCTTTGGGACCCTGCGGAAGAGGAAGCAGGAGGAGGCGGAGGAGTACGTGTGCCCGATGGAGTTGGGTCAGACCTCGGGAGACAGTATAATCAAACCCCTGCGGCCGGGGCTGGACCTGCGCATGTTAAACGATGAGGATTTGGACCGACTGGAGCAGATGGAGGATTCGGAGGGGACAGTGAGGCAAATCGGGGCGTTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCCACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCATGATGGGGGTCATTCTATAGAGCGGCAGGGAGCCCCCTATTGGCTGAGATACTCAGTACCACTAAGCTATACATCCCGGGCTGCTCTGCCAATAACCATGGGGTAATTATAGTGCAGAATCTGCACCCCCCCCCACCTTCTGCCCTTGCCAGAAAGTTCCCCCCATACAGGCACCATGCCCCCCCCCCCCCCTAAACTTATTTTGGGGGTATGCCGCTTATTAAAGGGAGTAATATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1
  5   1   2      2ovr                                 Xt7.1-CBSW1740.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGGACCTGGAGAAGGAACTGGGGGATCAAACACCCGTTGCACAGGAAGAAGCTCCAGTTGGCTCTGCAGTCGCTCGGGTCGGAGGATGAAAGCAACTACGGCAAATTGGACTACAGATGGGTCACCAGGTGGCTGGACGATATCGGGCTCCCCCAGTACAAGACCCAGTTTGACGACGCCAAGATCGATGGGAGGATGCTGCACTATTTGGCCGTGGATGATCTGCTCTCCCTGAAAGTGGTCAGTGTCCTGCACCATCTCAGCATCAAGAGAGCCATTCAGGTTCTGCGCATCAACGACTTCGAAGCCAACTGTCTGCGCCGACGCCCCTCGGATGAGAGTAACATCAGCCCCTCGGAGGTGGCGCAGTGGACCAACCACAGGGTGATGGAGTGGCTGCGCTCGGTGGATCTGGCCGAATACGCCCCCAATTTGCGGGGGAGCGGCGTGCACGGCGGCCTGATGGTTCTTGAGCCTCGATTTAATGTGGAGACAATGGCCCAGTTACTTAATATCCCTAGCAACAAGACCCTCCTGCGCCGGCACCTAGCAACCCACTTCAACCTCCTCATTGGCCAACGGGCCCAGATACAGAAACAGGAAGCCCTGGCGTCCCCGGAATATGTGCTCCTGACTGCCACTGCCAAAGTAAAGCCCAAGAAGCTGACATTCAGTACCTTTGGGACCCTGCGGAAGAGGAAGCAGGAGGAGGCGGAGGAGTACGTGTGCCCGATGGAGTTGGGTCAGACCTCGGGAGACAGTATAATCAAACCCCTGCGGCCGGGGCTGGACCTGCGCATGTTAAACGATGAGGATTTGGACCGACTGGAGCAGATGGAGGATTCGGAGGGGACAGTGAGGCAAATCGGGGCGTTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCTACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCAAAA
  5   1   2      2ovr                                 Xt7.1-CAAN5293.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCCACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCATGATGGGGGTCATTCTATAGAGCGGCAGGGAGCCCCCTATTGGCTGAGATACTCAGTACCACTAAGCTATACATCCCGGGCTGCTCTGCCAATAACCATGGGGTAATTATAGTGCAGAATCTGCACCCCCCCCCACCTTCTGCCCTTGCCAGAAAGTTCCCCCCATACAGGCACCATGCCCCCCCCCCCCCCTAAACTTATTTTGGGGGTATGCCGCTTATTAAAGGGAGT
                                               BLH MIN      15     129                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ce ---- 3e-045     NP_510311.2 T21H8.1 [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-056     NP_648661.1 CG10743-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 4e-094     XP_001179194.1 PREDICTED: similar to PTPRF interacting protein binding protein 1, partial [Strongylocentrotus purpuratus] ---=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 3e-094     CAJ82529.1 novel protein similar to PTPRF interacting protein, binding protein 2 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 1e-136     NP_001038435.1 hypothetical protein LOC561961 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-157     NP_003613.2 PTPRF interacting protein binding protein 1 isoform 1; liprin-beta 1; liprinrelated protein; protein-tyrosine phosphatase receptor-type fpolypeptide-interacting protein-binding protein 1 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 5e-158     XP_925922.1 PREDICTED: similar to PTPRF interacting protein, binding protein 1 (liprin beta 1) isoform 5 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-159     NP_001025942.1 PTPRF interacting protein binding protein 1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 6e-173     AAH78009.1 Ppfibp2-prov protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 6e-173     NP_001087118.1 PTPRF interacting protein, binding protein 2 (liprin beta 2) [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAN5293.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------TGA---------------------------------------------------------TAG------ATG---------------------TAA------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2      2ovr                                 Xt7.1-CBSW1740.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGGACCTGGAGAAGGAACTGGGGGATCAAACACCCGTTGCACAGGAAGAAGCTCCAGTTGGCTCTGCAGTCGCTCGGGTCGGAGGATGAAAGCAACTACGGCAAATTGGACTACAGATGGGTCACCAGGTGGCTGGACGATATCGGGCTCCCCCAGTACAAGACCCAGTTTGACGACGCCAAGATCGATGGGAGGATGCTGCACTATTTGGCCGTGGATGATCTGCTCTCCCTGAAAGTGGTCAGTGTCCTGCACCATCTCAGCATCAAGAGAGCCATTCAGGTTCTGCGCATCAACGACTTCGAAGCCAACTGTCTGCGCCGACGCCCCTCGGATGAGAGTAACATCAGCCCCTCGGAGGTGGCGCAGTGGACCAACCACAGGGTGATGGAGTGGCTGCGCTCGGTGGATCTGGCCGAATACGCCCCCAATTTGCGGGGGAGCGGCGTGCACGGCGGCCTGATGGTTCTTGAGCCTCGATTTAATGTGGAGACAATGGCCCAGTTACTTAATATCCCTAGCAACAAGACCCTCCTGCGCCGGCACCTAGCAACCCACTTCAACCTCCTCATTGGCCAACGGGCCCAGATACAGAAACAGGAAGCCCTGGCGTCCCCGGAATATGTGCTCCTGACTGCCACTGCCAAAGTAAAGCCCAAGAAGCTGACATTCAGTACCTTTGGGACCCTGCGGAAGAGGAAGCAGGAGGAGGCGGAGGAGTACGTGTGCCCGATGGAGTTGGGTCAGACCTCGGGAGACAGTATAATCAAACCCCTGCGGCCGGGGCTGGACCTGCGCATGTTAAACGATGAGGATTTGGACCGACTGGAGCAGATGGAGGATTCGGAGGGGACAGTGAGGCAAATCGGGGCGTTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCTACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCAAAA
                                                  Xt7.1-CHK-1008251915                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTGGAGAAGGAACTGGGGGATCAAACACCCGTTGCACAGGAAGAAGCTCCAGTTGGCTCTGCAGTCGCTCGGGTCGGAGGATGAAAGCAACTACGGCAAATTGGACTACAGATGGGTCACCAGGTGGCTGGACGATATCGGGCTCCCCCAGTACAAGACCCAGTTTGACGACGCCAAGATCGATGGGAGGATGCTGCACTATTTGGCCGTGGATGATCTGCTCTCCCTGAAAGTGGTCAGTGTCCTGCACCATCTCAGCATCAAGAGAGCCATTCAGGTTCTGCGCATCAACGACTTCGAAGCCAACTGTCTGCGCCGACGCCCCTCGGATGAGAGTAACATCAGCCCCTCGGAGGTGGCGCAGTGGACCAACCACAGGGTGATGGAGTGGCTGCGCTCGGTGGATCTGGCCGAATACGCCCCCAATTTGCGGGGGAGCGGCGTGCACGGCGGCCTGATGGTTCTTGAGCCTCGATTTAATGTGGAGACAATGGCCCAGTTACTTAATATCCCTAGCAACAAGACCCTCCTGCGCCGGCACCTAGCAACCCACTTCAACCTCCTCATTGGCCAACGGGCCCAGATACAGAAACAGGAAGCCCTGGCGTCCCCGGAATATGTGCTCCTGACTGCCACTGCCAAAGTAAAGCCCAAGAAGCTGACATTCAGTACCTTTGGGACCCTGCGGAAGAGGAAGCAGGAGGAGGCGGAGGAGTACGTGTGCCCGATGGAGTTGGGTCAGACCTCGGGAGACAGTATAATCAAACCCCTGCGGCCGGGGCTGGACCTGCGCATGTTAAACGATGAGGATTTGGACCGACTGGAGCAGATGGAGGATTCGGAGGGGACAGTGAGGCAAATCGGGGCGTTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCTACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCAAAAAAAAAA
  5   1   2       bld Brn2      out                       CAAJ11383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGGACCTGGAGAAGGAACTGGGGGATCAAACACCCGTTGCACAGGAAGAAGCTCCAGTTGGCTCTGCAGTCGCTCGGGTCGGAGGATGAAAGCAACTACGGCAAATTGGACTACAGATGGGTCACCAGGTGGCTGGACGATATCGGGCTCCCCCAGTACAAGACCCAGTTTGACGACGCCAAGATCGATGGGAGGATGCTGCACTATTTGGCCGTGGATGATCTGCTCTCCCTGAAAGTGGTCAGTGTCCTGCACCATCTCAGCATCAAGAGAGCCATTCAGGTTCTGCGCATCAACGACTTCGAAGCCAACTGTCTGCGCCGACGCCCCTCGGATGAGAGTAACATCAGCCCCTCGGAGGTGGCGCAGTGGACCAACCACAGGGTGATGGAGTGGCTGCGCTCGGTGGATCTGGCCGAATACGCCCCCAATTTGCGGGGGAGCGGCGTGCACGGCGGCCTGATGGTTCTTGAGCCTCGATTTAATGTGGAGACAATGGCCCAGTTACTTAATATCCCTAGCAACAAGACCCTCCTGCGCCGGCACCTAGCAACCCACTTCAACCTCCTCATTGGCCAACGGGCCCAGATACAGAAACAGGAAGCCCTGGCGTCCCCGGAATATGTGCTCCTGACTGCCACAGCCAAAGTAAAGCCCAAGAAGCTGACATTCAGTACCTTTGGGACCCTGCGGAAGAGGAAGCAGGAGGAGGCGGAGGAGTACGTGTGCCCGATGGAGTTGGGTCAGACCTCGGGAGACAGTATAATCAAACCCCTGCGGCCGGNGCTGGACCTGCGCATGTTAAACGATGAGGATTTGGACCGACTGNAGCAGATGGA
  3   1   2      seed Tail      out                        CBSW1740.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTGGACCAACCACAGGGTGATGGAGTGGCTGCGCTCGGTGGATCTGGCCGAATACGCCCCCAATTTGCGGGGGAGCGGCGTGCACGGCGGCCTGATGGTTCTTGAGCCTCGATTTAATGTGGAGACAATGGCCCAGTTACTTAATATCCCTAGCAACAAGACCCTCCTGCGCAGGCACCTAGCAACCCACTTCAACCTCCTCATTGGCCAACGGGCCCAGATACAGAAACAGGAAGCCCTGGCGTCCCCGGAATATGTGCTCCTGACTGCCACTGCCAAAGTAAAGCCCAAGAAGCTGACATTCAGTACCTTTGGGACCCTGCGGAAGAGGAAGCAGGAGGAGGCGGAGGAGTACGTGTGCCCGATGGAGTTGGGTCAGACCTCGGGAGACAGTATAATCAAACCCCTGCGGCCGGGGCTGGACCTGCGCATGTTAAACGATGAGGATTTGGACCGACTGGAGCAGATGGAGGATTCGGAGGGGACAGTGAGGCAAATCGGGGCGTTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCTACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCAAAAAAAAAAAAAAA
  5   1   2      2ovr                                 Xt7.1-CAAN5293.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCCACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCATGATGGGGGTCATTCTATAGAGCGGCAGGGAGCCCCCTATTGGCTGAGATACTCAGTACCACTAAGCTATACATCCCGGGCTGCTCTGCCAATAACCATGGGGTAATTATAGTGCAGAATCTGCACCCCCCCCCACCTTCTGCCCTTGCCAGAAAGTTCCCCCCATACAGGCACCATGCCCCCCCCCCCCCCTAAACTTATTTTGGGGGTATGCCGCTTATTAAAGGGAGT
                                                  Xt7.1-CHK-1008255991                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCCACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCATGATGGGGGTCATTCTATAGAGCGGCAGGGAGCCCCCTATTGGCTGAGATACTCAGTACCACTAAGCTATACATCCCGGGCTGCTCTGCCAATAACCATGGGGTAATTATAGTGCAGAATCTGCACCCCCCCCCACCTTCTGCCCTTGCCAGAAAGTTCCCCCCATACAGGCACCATGCCCCCCCCCCCCCCTAAACTTATTTTGGGGGTATGCCGCTTATTAAAGGGAGTAATATG
  5   1   2      seed Te4       out                        CAAN5293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTCTGAAGGAATAAACAACCTGACACACATGCTGAAGGAGGACGACATGTTCAAGGATTACGCCGCCCGGTCGCCGAGCGCCAGCGGGACAGACGAGGATTCCAACGTGTGATGCCCCGCCCCCCGCGCCCCTCGTACCCTCCCACCTCCGGGTGTTAATGGGTTCGAGTAGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCATGATGGGGGTCATTCTATAGAGCGGCAGGGAGCCCCCTATTGGCTGAGATACTCAGTACCACTAAGCTATACATCCCGGGCTGCTCTGCCAATAACCATGGGGTAATTATAGTGCAGAATCTGCACCCCCCCCCACCTTCTGCCCTTGCCAGAAAGTTCCCCCCATACAGGCACCATGCCCCCCCCCCCCCCTAAACTTATTTTGGGGGTATGCCGCTTATTAAAGGGAGTAATATGGTGTA
  5   1   2       bld Gas       out                  TGas051n15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGAGAGGATGTGCCTTTTGGTTCAGTTGCAATAAAGTAGAATCTGGGGGCCATGATGGGGGTCATTCTATAGAGCGGCAGGGCGCCCCCTATTGGCTGAGATACTCAGTACCACTAAGCTATACATCCCGGGCTGCTCTGCCAATAACCATGGGGTAATTATAGTGCAGAATCTGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)