Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu093e21.3.5                      203 END     2           2        1                Unknown (protein for MGC:75971) [Silurana tropicalis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     2 197.0    0(repeat)                                    0 REP     84       1161     1520                (no blast hit)

 This cluster: approximate FL confidence score = 35%

 1012159111 Xt7.1-CABD5089.3.5 - 81 ESTs
                                                                       .......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABD5089.3.5                            AGAGGCCGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACGTATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAATAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCGATGCGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008267799                                  CGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACGTATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAATAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCGATGCGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGAxxxxAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                 2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     4     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     4     6     4     6     4     6     4     6     5     7     5     7     5     7     5     8     5     8     5     8     4     8     5     8     4     8     4     7     4     7     4     6     4     6     4     6     3     5     3     5     3     5     3     6     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     8     3     8     3     8     3     8     3     8     3     9     8    10     7    10     6    10     6    10     6    10     6     9     6     9     6     9     6     9     6     9     6     8     6     8     6     8     6     8     6     8     5     7     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     8     7     9     4     9     9     9     9     9     9    10    11    12    11    12    12    13    13    15    13    15    14    15    14    15    16    18    16    18    18    20    18    20    19    21    20    22    20    23    21    23    21    23    22    23    22    23    22    23    22    23    22    23    22    23    22    23    23    24    24    25    24    25    24    25    24    25    23    24    23    24    23    24    22    24    24    26    24    26    25    27    25    27    24    26    24    26    25    28    26    28    26    28    26    28    16    29    16    29    17    30    17    30    17    31    16    29    16    29    15    30    16    30    16    30    16    30    16    30    15    29    15    29    15    29    15    30    16    33    16    33    16    35    17    36    16    36    16    40    16    40    16    37    15    37    15    37    13    33    27    34    28    34    28    34    28    34    27    34    29    34    29    34    28    34    30    33    28    32    29    32    32    33    32    34    33    36    34    36    34    36    34    37    35    36    35    36    34    36    35    36    34    36    37    38    35    37    33    37    34    37    33    37    33    35    34    35    34    35    33    35    34    35    34    35    22    35    22    35    22    35    22    35    22    35    22    35    22    35    21    35    22    35    22    34    22    34    22    34    22    34    22    33    22    33    21    32    21    32    20    32    17    32    19    31    18    31    18    30    18    30    18    29    17    29    17    27    16    24    15    24     6    17     4     7     2     3
  5   1   2       e>1                                Xt7.1-CABI13671.5                            AGAGGCCGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACGTATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAATAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCGATGCGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAAT
  5   1   2       e>1                                 Xt7.1-CABD5089.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGACCGCATCAACGAGCCGATGTGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAAAAAAAAAAA
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACGTTAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----T-------
                                               BLH ATG      14      54                            
                                               BLH MPR       2      45                            
                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 4e-008     NP_001038302.1 hypothetical protein LOC557677 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================
                                                                                                                                                                         PREDICTED = Gg ==== 2e-017     XP_417541.2 PREDICTED: similar to C1orf174 protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PROTEIN === Mm ==== 7e-024     NP_780496.1 RIKEN cDNA A430005L14 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PREDICTED = Hs ==== 2e-026     NP_997239.1 hypothetical protein LOC339448 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PROTEIN === Xl ==== 2e-085     AAI06028.1 MGC115548 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                PROTEIN === ?? ==== 4e-129     A0JM83.2 RecName: Full=UPF0688 protein C1orf174 homolog [(unknown)]  =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                    PROTEIN === Xt ==== 4e-132     AAI25778.1 LOC779604 protein [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABD5089.3.5                                          ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------TAA---------ATG------------------------------------------TAA---------------------------------ATGTAA------ATG------------------------------------------TAA---------------------TGA---------------------------------------------------TAA---------------------------------------------------------------------------------------------------------TAGTAA------------------------------------------------------------------------------------------------------------TGA------ATG---------------------TGA---------------------------------------------------TAA------------------------------------------------------------------------------------------------ATG---------------TGA------TAA---------------------------TAG---------------------------------------------------------------------------------------------------------ATG------------------------------------TAA------------------------------------TGA------------TAA------------------------------------------------------------------------------TGA------------TAG---------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------ATGTAA------------------------------------TAA---------------------------------TAG------------------------------------------------------------------TGA---------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------TAG---------------------------------TGA---------------------TAA------------------------TAA------------------------------------------------------TGA---------------------------------------TAA---TAA---------------------------------------------------------------------------------------------ATG------TGA------------------------------------------------------------------------------TAA---------------------TGA------------------------------------------------------------TAG------------ATG------------------TGA------------------------------------------------------------------------------TGATAAATG------ATG---------------------------------------------------------------------------ATG------------------------------------TGATGA------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------TGA------------TGA------TAA
                                                                   ORF                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   1           TpA  FL                     TTpA029o09.FL-Sanger TTTTTTAGTTTAGACAGGTACCGGGTAAGAGGCCGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACATATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAATAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCGATGCGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCTGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAAACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTCGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAAAAAAAAAA
  0   1   1           Ovi1 FL                         CABI13671.FL-MGC                            AGAGGCCGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACGTATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATGCATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAATAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCAATGCGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATGTTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAAAAA
  5   1   2       e>1                                Xt7.1-CABI13671.5                            AGAGGCCGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACGTATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAATAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCGATGCGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAAT
                                                  Xt7.1-CHK-1008233019                                  CGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACGTATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAATAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCGATGCGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTG
  5   1   2      seed TpA  FL   in                   TTpA029o09.p1kSP6 TTTTTTAGTTTAGACAGGTACCGGGTAAGAGGCCGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACATATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAG
  5   1   2   10  bld Ovi1 FL   in                        CABI13671.5p ...........................AGAGGCCGTTCCACATGAGAAAGAGAAAGTTATCAGATGGAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACGTATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTTCATTAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAAATCAGACACT
  5   1   2       bld Hrt1      in                         CAAQ4531.5p                                                                   GAGTGCGCTGCTCAGCACGCCAGAAGAATAGGAGTTGCTCGGGTGCCCAGTCCTCAACTGACCATGAAGCTGACACGTATGGACCTAAAAAGAAGGCAGCTTCCAGCAATAACACAGAGAAAGAGTCTTCAAAAAAGTTGAGAAAGGATGAAAAGGGTCCAGTGGAAGCTGATGAAAACGAACTATTAAACAAAATCGATAATGCAGCTTCCAATGAAAGCAGCAATGTAAATGATTCACAGCAGTCTGAGAAAAGTATAACAAATACAAAAGATAATGGCACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATCCCATGGCAGAGGTTCATTCAGTGCTGTAGATAGAGGATGATTCTTACTTGGCAAGAAAACATCCTTCTGAAGTACAAGACGATTAAGCTTCTG
  3   1   2       bld Neu       in                    TNeu117i02.q1kT7                                                                                                                                                                                                                                                                                                                                                           CACAAGGTGCTCAAAATTAAGGGCAAATACACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu117i02.p1cSP6                                                                                                                                                                                                                                                                                                                                                             ACAAGGTGCTCAAAATTAAGGGCAAATCACGCCTTCCCTCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTACAAACCTGCATTTTATAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTTAGGTTTATGCATAGCCAGGCTGAATGCTGGTGGGGAGTGCATAACTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATG
  3   1   2       chi Hrt1      in                         CAAQ4531.3p                                                                                                                                                                                                                                                                                                                                                                                                   TCATCCCCAGTTTCTGATCTGAATGAAGTTTCATGTAACGGCTTAACAGATGACAGTGGGGATGGAACAGGGTTTATTCACAAAACATGCTCTGAGCCCTCTAAATTAAGAGAGATTTATCTGAATGGCAGTCCGTTTGTGGATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATCCCATGGCAGAGGTTCATTCAGTGCTGTAGATAGAGGATGATTCTTACTTGGCAAGAAAACCATCCTTCTGAAGTACAAAGACGATTAAGCTTCTGTTCCGTTCGATCAAAGTAACAGCCATTGTATTTCACAGCTCTCAGCTCATCGTACATGGCATCAATGATCCTCTTGTATTCATCTCTTGTCACTGGTTCTACACTATCAGTGTGGCTTTGCACCTTAAAGAAAAAAGGGCACTTCAAAAGAACACACATTACCTTGATATTAAGTTGTTCTACAGAAATTGCACCTTTTTAAATTATATATATTTTATTGGAAGCCAGCAGAGATCACAGCGTAATCATGGTTCAAGACGAATATTATTTAAGATAATAAAAAACATTTATTTGTAAAA
  5   1   2       bld Gas7      in                         XZG57301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGAAGACAGCAATCAGCCAATGCCACTGGGGCTCTTCTTTGAAAATGCTGATCTTATGCAGGACCTGCCACCAGCTGTGCCTTCTTGTGCTTCAATGAGCAGGAGAGAGCTTAGAAACCTGCATTTTAGAGCAAAGGAAGAGGATGAGGATGATGATGACTATGTTGATGGCTTGGCTAACGAAGGAAATATTTAAGTAAGGTTTATGCAGAGCCAGGCTGAATGCTGGTGGGGAGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAA
  3   1   2       bld Gas7      in                         XZG57301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTGCAGAAGTATCAATAATTGTCCCAAATTAAGTGTTTTAACTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGacctacgggtgggcgatatcggggagcgtgtaggtaaaaaaaaaataatttgatcgtttggccctggggtcaaacaatcgaattatattggcggcaatggggcagtcggttcggggaccgcatcaacgagccgatgcggtcccgatccgactgaattttctaacctggccgatcgatatctgggcaattttaggccagatattggtcggacaggcccctcgtttctgcccctacatgggccgataagctgccaaatcggtccaagggaccgatatcggcagctactatcggcccgtgtatggggacctttacttgTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAGG
  5   1   2       bld Tad0      in                     NISC_no08b05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGacctacgggtgggcgatatcggggagcgtgtaggtaaaaaaaaaataatttgatcgtttggccctggggtcaaacaatcgaattatattggcggcaatgg
  5   1   2       bld Tbd1                                 CBXT4768.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGACTCATGTAAGAAGACATGAAGAACGATGTTGATTCATTAAAGAGTCTTTTAATATTAACATAATATTTTATATTAAACTCAAAATGAGCTAGGCTATTGCAGCCTAATATTTTCCCTCCTTTGAATCAAGACACTCCCTAACTCAACCCAACAACTTGCAATGGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCAACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAAAAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCAATGCGGTCCCGATCCGACTGAATTTTCTAACCTG
  5  -1   0       add AbdN                               IMAGE:7006251                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGGGAATAATTTTTGAGGTGAGGGCTTTATACAGGGGCTTTAATTTTGGTTAACACAGGGGCACATAACAAAATGAATTCCCCTCCTTGGGTAATTCAAATCTCCTTGTGCCACGGGGTTTTCTACCAACTATCCAGTTGGTGGCTTTGGCCACCTTAAAGGAAAAAAAGGGGCACACAATTGCCTGGGATATTAAGTTGTTTCTACAGAAAATTGCACCTTTTTAAATAATATATATTTTATTGGAAGCCAGCAGAGATCACAGCGTAATCATGGTTCAAGACGAATATTATTTAAGATAATAAAAAACATTTATTTGTATACAGTCTGTTCTACCTGAATATTATGTTGAAAACACATTCTCTTGAACATAGGGAGTCTTAAGCTGGCTTTACATTGACCAATACAAACTGCCGCCTCAAGTCATTCTAGATCAAGTCAGCAGCCTATAGACCTGCCCAACCAATAAATTAATACTGGCCATATATCTATTGGACGGGTTAGACAATTGCATTTGATAAAGTCAGTATGTGCTTGTTTATGCAGTCTCTCCCAACAGGTCTGCATTACACATAAGGATCCAATTGTTGGTTCTTAGGCCAGATAATGACTGGCCAAAACACAAAACGCAACCCGGACAATCCAGCAAAGAAAAGCCTGGGTTGTAAAAAAACTGAATCATAAAGAGTACATTCAGTATTCATCAGGATATGCACGTAATGTTTTCTGTATACTCAATGGTTTAGCTCTTTCAAGAGCCTTCATCACGAAACAAACACTACATACCCTAACACCAAATATATATATTCAAAGGGCATCAAAACCCACTTTGGTCATAATGTCATAACCTTACTTTAGTTATATAAAATATGTAAGTAAATATCTGTAAGTAAATGTAAAGCATA
  3   1   2       bld Tad0      in                     NISC_no08b05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTTGTTTTTACAAGGTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGacctacgggtgggcgatatcggggagcgtgtaggtaaaaaaaaaataatttgatcgtttggccctggggtcaaacaatcgaattatattggcggcaatggggcagtcggttcggggaccgcatcaacgagccgatgcggtcccgatccgactgaattttctaacctggccgatcgatatctgggcaattttaggccagatattggtcggacaggcccctcgtttctgcccctacatgggccgataagctgccaaatcggtccaagggaccgatatcggcagctactatcggcccgtgtatggggaccttTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAG
  3   1   1       add Te1                                 CBWN11175.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTATTTGGCTGGAGTTGTACAAACCAAAGTTTTTGGAGCTGGGGAGGGATCTGTGGCATTTTGAAGGATAGTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGACCTACGGGTGGGCGATATCGGGGAGCGTGTAGGTAAAAAAAAAATAATTTGATCGTTTGGCCCTGGGGTCAAACAATCGAATTATATTGGCGGCAATGGGGCAGTCGGTTCGGGGACCGCATCAACGAGCCGATGCGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAA
  5   1   1       add Tad5      ?                          XZT49868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAATATACCTTTATTAGGGTAAGTGTACTTCTATTGCAAGTGGTTCTTACATATGCATTAGAATTTAAGCCTAACTTTTTTTTTTTTTACTATAAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGacctacgggtgggcgatatcggggagcgtgtaggtaaaaaaaaaataatttgatcgtttggccctggggtcaaacaatcgaattatattggcggcaatggggcagtcggttcggggaccgcatcaacgagccaatgcggtcccgatccgactgaattttctaacctggccgatcgatatctgggcaattttaggccagatattggtcggacaggcccctcgtttctgcccctacatgggccgataagctgccaaatcggtccaagggaccgatatcggcagctactatcggcccgtgtatggggacctttacttgTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       e>1                                 Xt7.1-CABD5089.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGACCGCATCAACGAGCCGATGTGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008224532                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCATCAACGAGCCGATGTGGTCCCGATCCGACTGAATTTTCTAACCTGGCCGATCGATATCTGGGCAATTTTAGGCCAGATATTGGTCGGACAGGCCCCTCGTTTCTGCCCCTACATGGGCCGATAAGCTGCCAAATCGGTCCAAGGGACCGATATCGGCAGCTACTATCGGCCCGTGTATGGGGACCTTTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGxxAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAATAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3  -1   2       bld TbA       in                    TTbA022i17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCGCTTTTTTTTTTTTTTTTTTTACTATAAACATACAGGTGTTGAATTAATATGAAAAAAGGTCCCTATACAAGTTGAGATTCGCTCTCTCGGCGacctacgggcgggcgatatcggggagcgcgtaggtaaaaaaaaataatttgatcgttcggccccggggtcaaacaatcgaattatatcggcggcaatggggcagtcggttcggggaccgcatcaacgagccgatgtggtcccgatccgactgaattttctaacctggccgatcgatatctgggcaattttaggccagatattggtcggacaggcccctcgtttctgcccctacatgggccgataagctgccaaatcggtccaagggaccgatatcggcagctactatcggcccgtgtatggggaccttTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAAACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAAAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTANAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATATAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACCAAATTCA
  3  -1   2       bld Gas       in                    TGas106p14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTTTTTTTTTTCTATAACATACAGTGTTGAATTAATATGAAAAAAGGTCCCCATACATGTTGAGATTCGCTCTCTTGGCGacctacgggtgggcgatatcggggagcgtgtaggtaaaaaaaaaaataatttgatcgtttggccctggggtcaaacaatcgaattatattggcggcaatggggcagtcggttcggggaccgcatcaacgagccaatgcggtcccgatccgactgaattttctaacctggccgatcgatatctgggcaattttaggccagatattggtcggacaggcccctcgtttctgcccctacatgggccgataagctgccaaatcggtccaagggaccgatatcggcagctactatcggcccgtgtatggggaccttTACTTGTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTA
  5   1   2       bld Gas7      in                         XZG36768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  gtcggttcggggaccgcatcaacgagccgatgtggtcccgatccgactgaattttctaacctggccgatcgatatctgggcaattttaggccagatattggtcggacaggcccctcgtttctgcccctacatgggccgataagctgccaaatcggtccaagggaccgatatcggcagctactatcggcccgtgtatggggacctttacttgTGTAAATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAAACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATATAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAAATTTTTCTTTATTGGCAGTTTGGCAATTGGTTTTTATTT
  5   1   2       bld Tad5      in                         XZT43497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGACGCGTGGGTTTTCAGGAAATAATTTGACGCTTAAAAAAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTGTTGCT
  5   1   2       bld Spl2      in                        CBSS8375.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATTATGTTTTCAGGAAATAATTTGACGTTAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAAACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATATAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAG
  5   1   2       bld TbA       in                   TTbA013l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAATTTGACGTTAAAAAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAAATCTGAAGCTGGA
  5   1   2       bld Gas       in                   TGas117m10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATTTGACGTTAAAAAAAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGATTTTGACCCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTT
  5   1   2       bld TpA       in                   TTpA026g09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTTGACGTTAAAAAAAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCT
  5   1   2       bld HdA       in                  THdA039o08.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATTTGACGTTAAAAAAAAAAAAAAAGAAGCTTTATTCTGAACTGACACCAAATAAAACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATATAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAA
  5   1   2       bld HdA                           THdA010p08.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCTTTATTCTGAACTGACACCAAATAAAACTGTTGGACATTGACCCTTAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTATCGTATCGAGCATGAACACAAGTAACAGAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACGCTATAATATAAGTGCAATTATTCTCGCTTGTGTGAGAGAGTAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTT
  3  -1   2       bld Int1      in                         CAAP7368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGAACTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGT
  5   1   2       bld Mus1      in                         CABH4538.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGACACCAAATAAGACTGTTGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactatAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACA
  3   1   2       bld TpA  FL   in                    TTpA029o09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGACATTGACGCAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTCGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ski1      in                        CABJ10168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAAGTTACATTTTGGACAGCTCTGTAGAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATATAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctggggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactatAAAAAAAAAATAAT
  5   1   2       bld In62                            IMAGE:8955923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTTTTTTGGACAAGCTCTGTATTAAACAGTGGTGCCATATTAGCGTATCAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAGAGATGCAATATTCAATAACTATAAAAAAAAAAATATATGAGACAGTTGCAAGTTTCTAGGATAGGACTTCCATGACAATAAGTACGTAAGTGATCACATTTATGTAACTGAATCTCTCATCGTTCCAACCAGTACTGTTTGTCTACTGTTCCAACGGCAGAAAACATAC
  3   1   2       bld TbA                             TTbA024i17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGAAAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAAT
  3   1   2       bld HdA       ?                     THdA030p22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG36768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAACATGAACACAAGTAACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATATAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactatAAAAAAGAAAAAAAAGG
  5   1   2       bld Gas7                                 XZG12915.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACATAGCAACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATATAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactatAAAAAAAAAATAATAATGAAGACCAGTTGCAAGTTTCTAGGNAATAGACATTCTATGACCTATTAAAAGTAACGTAAAGGTGAATCACCCCATTTATGTAACCTGAGATCTCTCTACTCCC
  5   1   2       bld Gas                            TGas129c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGACTGCATGAACAGTGTTTGTATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAAGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAAGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaagtctccagttttgaatttcagcagctatcgttgctaaggtcttgtttacc
  5   1   2       bld Tad5                                 XZT24396.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATATAATTCCTTTTCTTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcaccccATTATGTTAACCTGAGATCTCTCTACTCCCCTTCAAAACACAGTACTGTT
  3   1   2       bld Gas       in                    TGas117m10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTATAATACACTAGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG43462.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACGCGTCCGGAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTCGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactatAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas7      in                         XZG43462.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATATAAGTGCAATTATTCTCACTTGTATAATAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTCGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactatAAAAAAAAAAAAAAAGG
  5   1   2       bld Lun1      in                         CABD5089.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCAAATATAATTGATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTT
  5   1   2       bld Gas                            TGas017f10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTCAACATTTCTAAAAGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCTGGGACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaataggaggaggccagaatagataaaaagtaacagtaaccataaaattgtaagtttacaaagcagtaggttttttttttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGT
  5   1   2       bld Te1                                 CBWN16492.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAACAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTTGTTCAGCAGGTCTCCAGTTTTGAATTTCAGCAGCTATCGTTGCTAGGGTCTTGTTTACCTTAGCAACCAGGAAGTGGTCTGAATAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAATAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAGCGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAAATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGT
  5   1   2       bld HeRe      in                     EC2CAA40DF10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGGCATATTTTCATCATCTAAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaataggaggaggccagaatagataaaaagtaacagtaaccataaaattgtaagtttacaaagcagtaggttttttttttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGT
  3   1   2       bld HdA       ?                    THdA037m14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATGTAAAATATTAAAACGCTGATTGCTAATTGCGTTAATTGGAAAGCATTTAAAAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtttgaataggaggaggccagaatagataaaaagtaacagtaaccataaaattgtaagtttacaaagcagtaggtttttttttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactTAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas117a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGTGCCTGGAAATCTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaataggaggaggccagaatagataaaaagtaacagtaaccataaaattgtaagtttacaaagcagtaggtttttttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGG
  3  -1   2       bld Lun1      ?                         CABD13130.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTATAGGGCGAGAGGTTCTGTGCGCCATTGGCCTTAAGATGAACGAAAGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaatAGGAGGAGGCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAACATG
  5  -1   2       bld Gas       in                   TGas106p14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTCATTTAGAAATGTCATGTAGAAATTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaataggaggaggccagaatagataaaaagtaacagtaaccataaaattgtaagtttacaaagcagtaggttttttttttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGG
  3  -1   2       bld Egg       in                    TEgg014i04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTTTTTCTTTATTGGCAGTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTCGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaataggaggaggccagaatagataaaaagtaacagtaaccataaaattgtaagtttacaaagcagtaggtttttttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGG
  3  -1   2       bld Gas       in                    TGas104k07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTGCAATTGGTTTTTATTTGTGGTCAGTAATTTAGTTTTTTTgttcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaataggaggaggccagaatagataaaaagtaacagtaaccataaaattgtaagtttacaaagcagtaggttttttttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAAATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGC
  3  -1   2       bld Neu       in                    TNeu124g10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTcagcaggtctccagttttgaatttcagcagctatcgttgctagggtcttgtttaccttagcaaccaggaagtggtctgaataggaggaggccagaatagataaaaagtaacagtaaccataaaattgtaagtttacaaagcagtaggttttttttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAA
  5   1   2       chi Tbd1      in                         CBXT6244.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAATAACCAAAGATATACAGACTTGCTTGAGTACTGAAGGAGGTTTAGTTAAGCAAGGAATAGGAGCTACAGTTGAAATTTTCCAAATGTAATTGATTTCAACATTTCTAAAGGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCAGGGCAACAGTGCATTGTATTTTTAATACTTTAGGGCTCTTTCGTTTTTTGGTGTTACTGTTCCTTTGACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAGCGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACTTGCCCTACATTGCTGGTACAGTTCATTTCTTGT
  3   1   2      seed Lun1      in                         CABD5089.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCAGAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAA
  5  -1   2       bld Int1      in                         CAAP7368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGNGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTG
  5   1   2       bld Bone      ?                          CBTC603.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAATAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAAATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGCCCCAAAGGGCACATATAATTTATGTTACT
  5   1   2       bld Tbd1      in                        CBXT21582.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATAGATAAAAAGTAACAGTAACCATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATAACTATAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATGTTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAAAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAAATAAATCA
  3   1   2       bld TbA       in                    TTbA013l17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCACGTGTTTGTTACATAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TbA  5g3  out                   TTbA057b21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAATTGTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTC
  3   1   2       bld TbA  5g3  out                   TTbA057c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTAAGTTTACAAAGCAGTAGGTTTTTTTTTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTC
  5  -1   2       bld TbA       in                   TTbA022i17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGTAGGTTTTTTTTTGTTGCTGCCAGATTCAGTGACTCAATCTGAAAGCTGGAAAGATGTAGAAGAGAATGGCAAATAATTCAATANCTATAAAAAAAAAAAtaataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccATTTATGTTAACCTGAGATCTCTCTATTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTTTCTGCAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Mus1      in                         CABH4538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCACGTGTTTGTTACATTATTTTGAAAAAA
  3   1   2       bld Ski1      in                        CABJ10168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ttttgttgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaataataatgaagaccagttgcaagtttctaggaataggacattctatgacatattaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAA
  3   1   2       bld Tad5      in                         XZT43497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCACGTGTTTGTTACATTAAAAAAAAAAAAAAAGG
  3   1   2       bld TpA       in                    TTpA026g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagcccagttgcaagtttctaggaataggacattttatgacatgttaaaagttaacgtaaaggtgaatcacccATTTATGTTAACCTGAGATCTTTTTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGTTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGGGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATTTTGTAATTGGTATAAAAGGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTTTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1 FL   in                        CABI13671.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTgctgccagattcagtgactcaatctgaaagctggaaagatgtagaagagaatggcaaataattcaataactataaaaaaaaaaataatgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccatttATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCGC
  3   1   2       chi Tbd1      in                         CBXT6244.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTAAAGGAAATCATACATTCTTAAAAATGGCTTTACAAAATTCAGGAACCCAGAAGCTAGTATTTCAATAGTGCAGGGCAACAGTGCATTGTATTTTTAATACTTTAGGGCTCTTTCGTTTTTTGGTGTTACTGTTCCTTTGACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAGCGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACTTGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA40DF10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCAAATAATTCAATAACTATAAAAAAAAAATAATgaagaccagttgcaagtttctaggaataggacattctatgacatgttaaaagttaacgtaaaggtgaatcacccATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACACGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACGGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGC
  5   1   2       bld Tbd1      in                         CBXT3896.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAATAATTCAATAACTATAAAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATGTTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACTTGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCAAAA
  3   1   2       bld Tbd1      in                         CBXT3896.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTATAAAAAAAAAAAAAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATGTTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACTTGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS8375.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATAAAAAAAAAATAATAATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAAATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGC
  3   1   2       bld Tbd1      in                        CBXT21582.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATGAAGACCAGTTGCAAGTTTCTAGGAATAGGACATTCTATGACATGTTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas117a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAATAGGACATTCTATGACATATTAAAAGTTAACGTAAAGGTGAATCACCCATTTATGTTAACCTGAGATCTCTCTACTCCCTTCCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTGTGTGACCAAAATAAATATTGTGTTTCTCAAAAAAAAAAAAAAAAA
  5  -1   2       bld Egg                            TEgg129j22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA039o08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTTGTTCTGCAAAAAAAAAAAAAAAAAAAAAAGCG
  5  -1   2       bld Neu       in                   TNeu124g10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAACCACAGTACTGTTTGTCCTACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCACGTGTTTGT
  3   1   2       bld TbA                             TTbA066e06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGACCGGCACGAGATGGAGCACACCACCCCTCGCTTTGCTGCTCTGTTGTTTGGGGATAGGTAGGGCCCCGTATGGAAGATTCCATTCTTACATGACTTCTTCCAGTTTGGATTTTTGTAATCGTATTAACTGTATTGTATTATCTATCTACACACTTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGGGAATAGTAAGATTTATAGCACAATAATAATGTTTGTTGATGAAAATTATAAACATGCACAAATTTGTTGAGGAAGGATCCTTCCTGCGTACTGACAAATAAGTCAGGTATTTTGTAATCGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCATACATCGTTGGTACAGTTCATTTTTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTAGAGAAATTGACAACACGCTTGTGACCAAAATAAATATTGTGTTTCTGCAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas8      out                        st112p13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTTCCCAAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGNGATCNTTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCNCNCCNCCCCTGCTTTGCTGCTCTGTTGCNTGGGGATAGGTAGGGCCCCGTATGGAAGATTCCNTTNTTACNTGACTTCCTCCAGTTTTTTTTTTTNTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATGACAACACGCTTGGACCAAAA
  3   1   2       bld HeRe                             EC2CAA35BA08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACGGCAGAGAAGCACAGCGGGGCCTTAAGGGCATAGAGATCATTTGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTTTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACACGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACG
  3   1   2       bld Int1                                CAAP12730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGGCATAGAGATCATTNGAAGTGAAGATTGAGCGGCACGAGATGGAGCACACCACCCCTGCTNTGCTGCTCTGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGAGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAGCCTCTCGCCCTATA
  5  -1   2       bld Gas       in                   TGas104k07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTTGCTTGGGGATAGGTAGGGCACAGTATGGAAAATTCCATTCTTACATGACTTCCTCCAGTTTTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCCACACAATTAGATATAATAATCTCTTGATAAACGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAACACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATCGCACAATAATAATGTTTGCTGATGAAAATTATACACACGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACACGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTCACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCT
  5  -1   2       bld TpA       out                  TTpA076k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTGTTACATGACTTCCTCCAGTTCTGATTTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGGTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCGTACATTGCTGGTACAGTTCATTTCTGGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTAGTTACCAAAATAAATATTGTGTGTTCTGCACGTGTTTGTTACATTATTTTGATATTTGGCATTGGTGCGTTTTATCACATTATTGTAGTGTACGTTATTGTCATGGACCCACCAGGGAATTGAATCACTTAAGAGGGTGGGCATTTACTATAGCTTGTTCTTATTTTCAGTTCA
  5  -1   2       bld Egg       in                   TEgg014i04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTTGGGGATAGGTAGGGCACAGTATGGAAGATTCCATTCTTACATGACTTTTCCTCCAGTTTTGATTTTGTAATCGTATTAACTGTATTCTATTATCTATCTACACAATTAGATATAATAATATCCTGATAAATGCAGAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tad5                                 XZT69805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGGTTTTAGATCGCGAGCGGCCGCCCtttttttttttttttttttttttttttttttttttttttttttttttttttttttttCACATTAAGCAAATGTTTTTATTTGAAGTGCTGTAAAAGTATGGGGGACTCCTTTCCCAGTCTTAAAATACACTGGAATATAAGGGGAGCGAATAGTAAGATTTATAGCACAATAATAATGTTTGCTGATGAAAATTATAAACATGCACAAATTTGTTGATGAAGGATCCGTCCTGTGTACTGACAAATAAGTCAGGTATCTTGTAATTGGTATAAAAGGGTGTTTTTGTTGAATACTGTATCAGTGGTTAGGACATGCCCTACATTGCTGGTACAGTTCATTTCTTGTAGAGGCCCAAAGGGCACATATAATTTATGTTACTATGGAAATTGACAACACGCTTTGTGACCAAAATAAATATTGTGTGTTCTGCAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)