Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAJ17253.3.5                        15 END     1           1        6                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 276.0    0Xt7.1-TTpA025k03.5                          3 PI      100         1      145                PREDICTED: similar to zinc finger protein 238 [Gallus gallus]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     3   0.0    0Xt7.1-TTpA025k03.5                          3 SPLT    0           0        0                PREDICTED: similar to zinc finger protein 238 [Gallus gallus]

 This cluster: approximate FL confidence score = 97%

 1012159228 Xt7.1-XZG21837.3 - 70 ESTs
                                                                       .......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG21837.3                  AGCGGGATCCCCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCGATTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAAAACAAAAAAAATATATTCCTGGCACTGACTAAACAAATAGAGCTGGG
                                                  Xt7.1-CHK-1008267892                        ATCCCCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCGATTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAAxAxAAAAAAAAxAxAxxCCTGGCACTGACTAAACAAATAGA
                                                      consensus depths                       3     4     4     7     5     9     6    10     6    10     8    10     7    11     7    11     9    12    11    13     9    13    11    13    12    14    12    15    13    16    14    17    14    16    16    18    17    19    18    21    20    27    32    40    37    41    37    41    41    44    42    45    44    46    47    49    48    49    49    51    54    56    56    57    57    58    57    60    57    62    59    62    59    63    60    64    61    65    62    65    63    65    63    65    62    66    64    66    64    66    63    66    64    65    64    65    63    65    66    67    66    67    66    67    66    67    65    66    65    66    63    64    63    64    63    64    62    63    61    62    60    61    60    61    60    61    59    61    59    61    58    60    59    60    59    60    59    60    57    59    55    57    52    56    54    55    51    54    52    53    51    52    48    50    23    45    21    39    20    36    15    32     8    17     2     4     2     2     2     2
                                                                   SNP                                                                                                                  ---------G--
                                                                   SNP                                                                                                                                                      -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                               BLH ATG     279     753                  
                                               BLH MIN     279      91                  
                                               BLH MPR     210      91                  
                                               BLH OVR     279     788                  
                                               CDS MIN     279       8                  
                                               EST CLI     230       8                  
                                               ORF LNG     279      29                  
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Sc ==== 3e-036     NP_010692.1 dissociable subunit of RNA polymerase II; Rpb7p [Saccharomyces cerevisiae] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 9e-078     NP_491093.1 RNA polymerase Rpb7, N-terminal domain and S1 RNA binding domain containingprotein [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Dm ==== 1e-080     NP_731983.1 CG31155-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Sp ==== 5e-091     XP_780458.1 PREDICTED: similar to polymerase (RNA) II (DNA directed) polypeptide G [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 2e-096     NP_080605.1 polymerase (RNA) II (DNA directed) polypeptide G [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 1e-096     NP_002687.1 DNA directed RNA polymerase II polypeptide G; DNA directed RNA polymerase II 19kda polypeptide [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 5e-097     AAI28969.1 Unknown (protein for MGC:160509) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 5e-097     CAJ83494.1 polymerase (RNA) II (DNA directed) polypeptide G [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = ?? ==== 5e-097     NP_001091291.1 hypothetical protein LOC100037112 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Dr ==== 4e-097     XP_702073.1 PREDICTED: hypothetical protein XP_696981 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG21837.3                                       TAG------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------TAA---------------------------------------------------------TGA---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TGA---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Tad5 FL                           XZT7477.FL-MGC                        CGGACGCGTGGGCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas050n16.FL-Sanger                                                                                                                                                                                                                                                                         TGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAAAAAAAAAAAAAAAAAA
  5   1   2       bld HeRe 5g3  in                      EC2CAA3AD10.g1 GGCGCAACGTACTAGACAGCGGGATCCCCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCGATTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCG
  5   1   2       chi Gas7      in                          XZG6433.5p      TTCGCAGCTCGGTTCCTCTCGATTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATGTAAGTCCAGTGTCTGTTTTATTGCTTTGGGCATGAATTATCACAGGCGATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGC
  5   1   2       bld HeRe 5g3  in                     EC2CAA30AE12.g1        GGTACTAGACAGCGGGATCCCCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCGATTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTA
  5   1   2       bld HeRe 5g                          EC2CAA39BD10.g1              GGACAGCGGGATCCCCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCGATTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGA
  5   1   2   10  bld Te1  5g3  in                         CBWN6091.b1 ..................GCGGGATCCCCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCGATTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTC
  5   1   2       bld TbA  5x3  in                   TTbA068a23.p1kSP6                     GCGGGATCCCCGGTAGCCTCTACGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGATGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGACGGGAGACATCACAATCCGCGACCGCGTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCACCAGAAAAAGTGACTGCTGCGGCACGGAATGTTCTACCATATCTCATTGGAACATGAAGTTCTTCTGCACCCTAGATATTTTGGTCCTAACCTTCTCAACACTGTCGAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCTAGTATGGTTTTGTGATTGCAGTGACCACAATCTATAACATTGGTGCTGGGGTGATTCAGCCAGAGAGAGGGTTTGTGCTTTATCCCATCGAGTACAAGGCCATTGACTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAAGTTAAGACGGTTGGATTATTCACTGACATTGGTACAATGTCCTGCTTCATAT
  5   1   2   12  bld Gas7 5g3  in                         XZG21837.5p .......................CAGCGGGATCCCCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATGATCTTGGTCCT
  5   1   2       bld Egg  5g                        TEgg104h07.p1kSP6                               GTGGCCTCTGGGTGGGTGTTCGGTTCCGCGGCTCGGTTCCTCTCGATTCTCTACATTGCAGTGCACTGCGTTGCACACCGGGTCCTCGGATTGCCCGGAGCCGAGCCGGTTCTGCCACGCGTCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTC
  5   1   2       bld Tad5 FL   in                          XZT7477.5p                                   GCGGTAGCCTCTAGGTGGGTGTTCAGTTCCGCAGCTCGGTTCCTCTCTACATTACAGTACACTACATTACACACCGAATCCTCGGATTACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAAGGATCATTTTATGGTGCAGGTCCATGGGCT
  5   1   2       bld Egg  5g3  in                   TEgg065c12.p1kSP6                                             CCGGGGCGGTTCCGCAGCTCGGTTCCTCTCGATTCTCTACATTGCAGTGCACTGCATTGCGCGCCGGGTCCTCGGATTGCCCGGAGCCGAGCCGGTTCTGCCGCACGTCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTA
  5   1   2   12  bld Gas7 5g3  in                          XZG3971.5p .........................................................................................AAGTACACTACATTACACACCGAATCCTCGGATACCCGGAGCCGAGCCGGTTCTGCCACACATCGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCCTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATT
  5   1   2       bld Gas  5g3  in                  TGas089d11.p1kaSP6                                                                                                            CCGAGTCCTCGGATTGCCCGGAGCCGAGCCGGTTCTGCCGCGCGTCGCTGCCTCGCGTCGTTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGA
  3   1   2       bld Gas  5g3  in                    TGas089d11.q1kT7                                                                                                                       GATTGCCCGGAGCCGAGCCGGTTCTGCCGCGCGTCGCTGCCTCGCGTCGTTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTAATAGATAATTTCCAATTGTTTTAATAAAATGTTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg065c12.q1kT7                                                                                                                                                         CGCTGCCTCACGTCATTTCCTGTTGTGTGACGCCAACAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATGTCCNAATTTGTTTTAATAAAATGTTACAAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       out                   TEgg056a12.q1kT7                                                                                                                                                                             AGGACAATTAGCTGGCTTTATCAAGCATTCAGTAGGCACTGGAGAGAGGAAAAGGCATTTATGCATCAGTAACTCCCGGGGCCCGGGGAATCCCCGGGAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCACAATTTGTTTTAATAAAATGTTACAAA
  5   1   2   10  bld Tbd1 5g3  in                         CBXT3457.b1 .........................................................................................................................................................................................CAACAAGCGGGGACCTACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCTAGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAAGAAAAGGGATCATTCTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATT
  3   1   2      seed Gas7 5g3  in                         XZG21837.3p                                                                                                                                                                                             CAAGCGGGGACATACAATCGCGCCGCCTTTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAACC
  3   1   2       bld HeRe 5g3  in                      EC2CAA3AD10.b1                                                                                                                                                                                                                         TTTAAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTACGTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAA
  3   1   2       bld Tad5 FL   in                          XZT7477.3p                                                                                                                                                                                                                            AAACGAGCTTTATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTC
  5   1   2       bld BrSp 5g3  in                     EC2BBA29AF09.g1                                                                                                                                                                                                                                    GGGATTGTTCCCGGAATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAG
  5   1   2   12  bld Gas7 5g3  in                         XZG59019.5p .............................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGTCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCT
  3   1   2       bld Gas7 5g3  in                          XZG3971.3p                                                                                                                                                                                                                                                   ATAGAGCATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCCTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTCAAAAC
  5   1   2       bld Egg  5g3  in                   TEgg068i18.p1kSP6                                                                                                                                                                                                                                                        CCGGGGAATCCCCGGGGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTT
  3   1   2       bld Gas7      in                          XZG6433.3p                                                                                                                                                                                                                                                         TGTTCTACCATGTAAGTCCAGTGTCTGTTTTATTGCTTTGGGCATGAATTATCACAGGCGATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTC
  5   1   2       chi 1030 5x                         IMAGE:7093907.5p                                                                                                                                                                                                                                                         GATATTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACACCCCCGTCTCTGAGGAAGAGTGATGTGCTGTCGGCATCATTGGCTTTGTGCTGCACACATAGAAGGATATTTAGTGCAGTCTGCTGGCCTACCCAGACTATTCATTGTTAAAAGTCAACAAAAAAAAGACCTATTACGCGCCCGGATGCGGCATGTTGCTAAGTCAACACCATCAACTTCGTCTGTCACAGTAGGGATGC
  3   1   2       bld Tbd1 5g3  in                         CBXT3457.g1                                                                                                                                                                                                                                                             TTGGGTACATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACTTTTTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTATTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTTTTTAATGGATGATTATCTTGGTCTGGTGAGGTGATGTGTACCACCCCCTGTTTTTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTCTATGGTGCAGGTCCATGGGCTGTGCTTTCTTACCCCTAT
  3   1   2       bld Egg  5g3  in                    TEgg068i18.q1kT7                                                                                                                                                                                                                                                              AATCCCCGGGGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5g3  in                         XZG58073.3p                                                                                                                                                                                                                                                                 CCACGCGTCCGAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACATGAAAAAG
  3   1   2       bld BrSp 5g3  in                     EC2BBA29AF09.b1                                                                                                                                                                                                                                                                     ATCGTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAA
  5   1   2   32  bld Gas7 5g                              XZG49829.5p .......................................................................................................................................................................................................................................................................GTGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCCGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAA
  5   1   2       bld Egg  5g3  in                   TEgg072g12.p1kSP6                                                                                                                                                                                                                                                                         TGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGAT
  3   1   2       bld Egg  5g3  in                    TEgg072g12.q1kT7                                                                                                                                                                                                                                                                         TGCAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTGTTTAATAAA
  5   1   2       bld Gas  FL                        TGas050n16.p1kSP6                                                                                                                                                                                                                                                                          TGCAGCAAAGAAGTGACTGCGGGGCCACGGNATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTC
  5   1   2       bld Neu  5g                        TNeu047j17.p1kSP6                                                                                                                                                                                                                                                                          TGCAGCAAAGAAGTGACTGCGGGGCCACGGNATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTANGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTC
  5   1   2       bld Egg  5g                        TEgg139k05.p1kSP6                                                                                                                                                                                                                                                                           CAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAA
  3  -1   2       bld Neu       in                    TNeu089b12.q1kT7                                                                                                                                                                                                                                                                           CCGGGAAAGAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAA
  3   1   2       bld Neu  5g3  in                    TNeu126o19.q1kT7                                                                                                                                                                                                                                                                           CAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTGTTTTAATAAAATGTTACAAAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 5g3  in                         XZG58073.5p ...........................................................................................................................................................................................................................................................................AGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTT
  5   1   2       bld Neu  5g3  in                   TNeu126o19.p1cSP6                                                                                                                                                                                                                                                                             CAGCAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCACCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCA
  3   1   2       bld Tbd1 5g3  in                        CBXT20184.g1                                                                                                                                                                                                                                                                             CAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAAAAAAAAAAAAAAA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT20184.b1 .............................................................................................................................................................................................................................................................................CAAAGAAAGTGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAAAAAAAAAAAAAAA
  5   1   2       bld Gas8 5g3  in                         st102i21.5p                                                                                                                                                                                                                                                                                       TGACTGCGGGGCCACGGAATGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTG
  3   1   2       bld Gas8 5g3  in                         st102i21.3p                                                                                                                                                                                                                                                                                                          TGTTCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTACCCCTAT
  5   1   2       bld Ova1      in                         CABE2941.5p                                                                                                                                                                                                                                                                                                             TCTACCATATCTCATTGGAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACATGCCCCTTGTATATTCCTGGCACTGACTAAACAAATAGAGCTGGGTG
  5   1   2       bld Neu                            TNeu007e19.p1kSP6                                                                                                                                                                                                                                                                                                                 CCCCGGGCTCATTGGAACATGAAATTCTTCTGCACCCTAGATTTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTANGAAAAGGGATCATTTTATGGTGCANGTCCATGGGCTGTGCTCTTACCCCTATGTACATAAT
  5   1   2       bld Ovi1      in                          CABI862.5p                                                                                                                                                                                                                                                                                                                              GAACATGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas0      in                         dad28g10.y1                                                                                                                                                                                                                                                                                                                                   TGAAATTCTTCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCT
  3   1   2       bld Gas7      out                        XZG29351.3p                                                                                                                                                                                                                                                                                                                                            TCTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAAC
  3   1   2       bld Ovi1      in                          CABI862.3p                                                                                                                                                                                                                                                                                                                                             CTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAAC
  3   1   2       bld Te1  5g3  in                         CBWN6091.g1                                                                                                                                                                                                                                                                                                                                             CTGCACCCTAGATATTTTGGCCCTAACCTTCTCAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACATAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas011o18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                          TCAACACTGTGCAAACAGGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCNAGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTANATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTATGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGAGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTG
  3   1   2       bld Gas7 5g3  in                         XZG59019.3p                                                                                                                                                                                                                                                                                                                                                                             CAACACTGTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAACCTT
  5  -1   2       bld Neu       in                   TNeu089b12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                    GTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAA
  5   1   2       bld Tbd1      in                         CBXT2733.b1                                                                                                                                                                                                                                                                                                                                                                                    GTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTCTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGCTACAAAACAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT2733.g1                                                                                                                                                                                                                                                                                                                                                                                    GTCAAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATCGGTCCAATGTCCTGCTTCATATCGAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTCTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGCTACAAAACAAAAAAAAAAAAAAA
  3   1   2       bld Gas0      in                         dad28g10.x1                                                                                                                                                                                                                                                                                                                                                                                       AAACAGAAACTCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAAAAAAA
  3   1   2       bld Gas7      in                         XZG22832.3p                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGCTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTTCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTCCAAACC
  5   1   2       bld Gas7      in                         XZG22832.5p                                                                                                                                                                                                                                                                                                                                                                                                  CTTCACTGAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTTCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAA
  3   1   2       bld HeRe 5g3  in                     EC2CAA30AE12.b1                                                                                                                                                                                                                                                                                                                                                                                                         GAGGTAGAGGGAACATGTACTGGCAAGTATGGTTTTGTGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTAATTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAAT
  3   1   2       bld Gas7      in                         XZG42088.3p                                                                                                                                                                                                                                                                                                                                                                                                                        CCACGCGTCCGCCCACGCGTCCGGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTCCAAAAC
  5   1   2       bld Gas7                                 XZG48976.5p                                                                                                                                                                                                                                                                                                                                                                                                                          AAAACAAATTGGACATTATGTACATAGGGGTAAGAGCACAGCCCATGGACCTGCACCATAAAATGATCCCTTTTCCTACTGTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGAT
  5   1   2       bld Gas7      in                         XZG42088.5p                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCACGCGTCCGGATTGCAGTGACCACAATCGATAACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAAAAAAAAAAAAAAAAAAAGG
  3   1   2       chi TbA  5x3  in                    TTbA068a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCAACTTTTAATTATAATGTGTGGGAATTGTGTTACCTGGAGACAGCAAGTAAGGCAACAGGTAGCAGGTGTTGGCTGTCACCTTCTGTGCTATAAACACTGCACTCTAGCCTTGGCACCATGCATTTTAGATGCATGCAAAATTGGCTGCAGGGTGGGGGACAGCTTGGTCATGATTAGGTTGAGATGTGGTGCTATGCATAGTTGCTCCCTAGATGTTTCTAGAAGCCAGAGGGCCAGTTACAGTGAGATGGGGTAAACACGGATCCTGCTCAAATTATTCCAGAACTAGGGAAATGTTTTTCATTTTATATTTAAGGCTGTAGCGAACAGATCAGCATATTGGTTTCACTCCCTAATTCAATGTTTCTTTTGCTGCAGGTTTGGTGAGCTGATGTGTACCACCCCCTGTTTTTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCTTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGTTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAAAGTTACAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  5   1   2       bld Gas                            TGas055e24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGACCACATCGATACATTGGTGCTGGGGTGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTC
  3   1   2       bld Gas8      in                          st73j21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAAAGGGGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTA
  5   1   2       bld Gas8      in                          st73j21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGATTCAGCCAGGGAGAGGGTTTGTGCTTTATCCCGTCAAGTACAAGGCCATTGTCTTCCGTCCTTTCAAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACATGAAAAAAAAAA
  5   1   2       bld Egg                            TEgg011d17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCATTGTCTTCCGTCCTTTCAGGGTGAGGTGGTAGATGCCGTGGTGACCCAGGTTAATAAGGTTGGATTATTCACTGAAATTGGTCCAATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACC
  3   1   2       bld Te3       in                         CAAM1235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAAC
  5   1   2       bld Te3       in                         CAAM1235.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACAAAAAAAAAAAAAAAA
  3   1   2       chi Ova1      in                         CABE2941.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTCCTGCTTCATATCAAGACATTCAATCCCATCTGAGATGGAATTTGACCCAAATTCCAATCCACCATGTTATAAGACCGTAGATGAGGATGTTGTCATTCAACAGGATGATGAGATCCGGCTCAAAATTGTTGGGACCAGAGTGGACAAAAATGACATATTTGCGATTGGCTCTCTAATGGATGATTATCTTGGTCTGGTGAGCTGATGTGTACCACCCCCTGTCTCTGAAGGAAGATGTGATGTGCTGTCTGGGCATCCATTGTGCTTTTGGTGCCTGGCACACAGTAGGAAAAGGGATCATTTTATGGTGCAGGTCCATGGGCTGTGCTCTTACCCCTATGTACATAATTTCCAATTTGTTTTAATAAAATGTTACAAAACATGCCCCTTGTATATTCCTGGCACTGACTAAACAAATAGAGCTGGGTGAAAACCAAACTCTGCTCGCATCATGGCCATTCTAAAGGTGTAGTGCATTGAATGTGGCTGTCGGGGAAGGTTGGGAGTCTAATTCAAAGAAGGTTTAGGATAGGACATCAGTTACACATCATCATTTAATAAAGCAGCCCACTTCAGCACACACTATTTACATTACATTACattaacatttatttataaagcgccaacatattccgcagcgctgtacaataagtAGACAGCTCACGTATATCAAACTGTGGCCCTGAATTAACATAATCATTAAATAGCACTCCTATGAGGGTCTGCTTCCAACTCCTTGAGCTTGGTACCCAAAGCCTTTATCCTGTGTTCATTTCTTGTGTAGCACTTGGCTTTGGTTTGCTGTGTTCGCCCAATGCTGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)