Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA028c13.5.5                       89 END     1           2        1                Hypothetical protein MGC76279 [Xenopus tropicalis]
     2   1.0    0Xt7.1-XZG64007.5                           10 END     7          16       70                smad interaction protein 1 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     3   0.0    0Xt7.1-CABK4743.3                           12 SPLT    0           0        0                85702065

 This cluster: approximate FL confidence score = 0%

 1012159306 Xt7.1-TNeu077c14.3 - 43 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu077c14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCCTACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCACTCGGGTTCATACAGTTCCCACATAAGCAGCAAAAAATGCATTGGCCTAATCTCAGTAAATGGCAGAATGAGAAACAACATAAAGACAGGTTCGTCCCCCAATTCAGTATCTTCCTCTCCCACCAATTCAGCCATAACACAACTACGGCACAAGCTGGAGAACGGCAAACCACTGGGCATGTCTGAACCATCAGGCTTACTGAAAATCAAAACAGAAACATTAGATTACAACGATTATAAACTTTTTATGGCCGCCACACATGGATTTAATGGGCCGCATCCATTCATGAATGGTGGTCTTGGTGCAACCAGCCCACTGGGAATCCATTCCTCAGCTCCAAGTCCAATGCAGCACTTAGGTGTAGGGATAGAATCATCGCTACTTGGGTACCCTTCCATTGCTAGTAACTTAAGTGAGGTGCAGAAAGTTCTAGAAATTGTGGACAATACGGTTTCTAGGCAGAAAATGGAATACAAGTCTGATGAAATTACAAAGCTGAAGGGCTATCATATGAAGGACGCAGGACCTCAACCAGAGGATCAAGGAGTTACGTCTCCTGGTATCCCACCAGTAGGTCTTCCTGTAGTTAGTCATAATGGTGCCACTAAAAGTATTATTGACTATACTTTAGAGAAGGTTAATGAAGCCAAAGCATGTTTGCAAAGCTTGACGACGGATTCAAGGAGGCAGATTAGTAATATTAAGAAAGAAAAGTTACGTACGTTGATAGACCTTGTAAGTGAAGAGAAGATGTTAGAGAGCCATAATATATCCACTCCATTTTCGTGCCAGTTTTGTAAGGAAAGTTTCCCTGGTCCAATTCCTTTACACCAACATGAAAGATACTTATGTAAGATGAATGAAGAAATTAAAGCAGTTCTCCAGCCCAATGAAAATCTAATTCTCAACAAACAAGCGATGTTCGCTGAGAAACAAGCACTCCTGTTGTCATCGGTACTTTCTGAGAAAGGAATGACAGGCCCCATCAACCCATACAAGGACCACATGTCTGTACTAAAAGCATATTATGCTATGAATATGGAGCCCAACTCTGACGAACTACTGAAAATTTCCATAGCTGTCGGCCTTCCTCAGGAATTTGTGAAGGAATGGTTTGAACAAAGAAAAGTTTATCAATATGCAAACTCCAGGTCACCATCTCTGGAAAGGACCAGTGCAGAGGTGGCTCTGGCTACCACCCTAAATACTCCCACTAAAGACTCAGCCAGATCTCCAATAAAATCTGTGGACTCTATAACTTCACCATCTATAGCAGAACTTCATAACCGGGTATCAAATTGTGATACGCCTCTCAGGCTAACAAAATCGAATCATTTTGCTAGTATGAAACCAGTTGTTGACAAATTGGACCACTCCAGGAGCAACACTCCTTCTCCTTTGAATCTTTCTTCCACATCTTCTAAAAACTCCCACAGCAGTTCTTACACTCCAAACAGTTTCTCGTCGGAGGAACTTCAAGCTGAGCCCTTGGACTTATCTGTACCAAAACTAATGAAGGAATCCAAAACTATTATTGCCACAAAGAACAAATCTAAGCCCAACAACATCACAATTGACCACAATAGTATTTCTTTACCGTCTGAAACTGTAGATGAGCCACTGAATTTAACATACATAAAGAAGGAATTTTGTAATGCTAATATGGACAAAAGCACTAACCCACTATTCGGTATAAACCCATTTAGTGGTAAACCTTTGTACACAGCGCTTCCTCCACAAAGCGCATTCCCACCAGCCACATTTATGCCCCCAGTACAGACCGGAATTCCTGGACTACGACATTACCCAGGACTTGATCAGATGAGCTTCCTACCACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTCTGACTCCTGTCTGTCCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAAC
                                                  Xt7.1-CHK-1008267970                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCACTCGGGTTCATACAGTTCCCACATAAGCAGCAAAAAATGCATTGGCCTAATCTCAGTAAATGGCAGAATGAGAAACAACATAAAGACAGGTTCGTCCCCCAATTCAGTATCTTCCTCTCCCACCAATTCAGCCATAACACAACTACGGCACAAGCTGGAGAACGGCAAACCACTGGGCATGTCTGAACCATCAGGCTTACTGAAAATCAAAACAGAAACATTAGATTACAACGATTATAAACTTTTTATGGCCGCCACACATGGATTTAATGGGCCGCATCCATTCATGAATGGTGGTCTTGGTGCAACCAGCCCACTGGGAATCCATTCCTCAGCTCCAAGTCCAATGCAGCACTTAGGTGTAGGGATAGAATCATCGCTACTTGGGTACCCTTCCATTGCTAGTAACTTAAGTGAGGTGCAGAAAGTTCTAGAAATTGTGGACAATACGGTTTCTAGGCAGAAAATGGAATACAAGTCTGATGAAATTACAAAGCTGAAGGGCTATCATATGAAGGACGCAGGACCTCAACCAGAGGATCAAGGAGTTACGTCTCCTGGTATCCCACCAGTAGGTCTTCCTGTAGTTAGTCATAATGGTGCCACTAAAAGTATTATTGACTATACTTTAGAGAAGGTTAATGAAGCCAAAGCATGTTTGCAAAGCTTGACGACGGATTCAAGGAGGCAGATTAGTAATATTAAGAAAGAAAAGTTACGTACGTTGATAGACCTTGTAAGTGAAGAGAAGATGTTAGAGAGCCATAATATATCCACTCCATTTTCGTGCCAGTTTTGTAAGGAAAGTTTCCCTGGTCCAATTCCTTTACACCAACATGAAAGATACTTATGTAAGATGAATGAAGAAATTAAAGCAGTTCTCCAGCCCAATGAAAATCTAATTCTCAACAAACAAGCGATGTTCGCTGAGAAACAAGCACTCCTGTTGTCATCGGTACTTTCTGAGAAAGGAATGACAGGCCCCATCAACCCATACAAGGACCACATGTCTGTACTAAAAGCATATTATGCTATGAATATGGAGCCCAACTCTGACGAACTACTGAAAATTTCCATAGCTGTCGGCCTTCCTCAGGAATTTGTGAAGGAATGGTTTGAACAAAGAAAAGTTTATCAATATGCAAACTCCAGGTCACCATCTCTGGAAAGGACCAGTGCAGAGGTGGCTCTGGCTACCACCCTAAATACTCCCACTAAAGACTCAGCCAGATCTCCAATAAAATCTGTGGACTCTATAACTTCACCATCTATAGCAGAACTTCATAACCGGGTATCAAATTGTGATACGCCTCTCAGGCTAACAAAATCGAATCATTTTGCTAGTATGAAACCAGTTGTTGACAAATTGGACCACTCCAGGAGCAACACTCCTTCTCCTTTGAATCTTTCTTCCACATCTTCTAAAAACTCCCACAGCAGTTCTTACACTCCAAACAGTTTCTCGTCGGAGGAACTTCAAGCTGAGCCCTTGGACTTATCTGTACCAAAACTAATGAAGGAATCCAAAACTATTATTGCCACAAAGAACAAATCTAAGCCCAACAACATCACAATTGACCACAATAGTATTTCTTTACCGTCTGAAACTGTAGATGAGCCACTGAATTTAACATACATAAAGAAGGAATTTTGTAATGCTAATATGGACAAAAGCACTAACCCACTATTCGGTATAAACCCATTTAGTGGTAAACCTTTGTACACAGCGCTTCCTCCACAAAGCGCATTCCCACCAGCCACATTTATGCCCCCAGTACAGACCGGAATTCCTGGACTACGACATTACCCAGGACTTGATCAGATGAGCTTCCTACCACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTCTGACTCCTGTCTGTCCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     4     5     5     6     5     6     5     6     5     6     5     6     4     6     4     6     3     6     3     6     3     6     3     6     3     4     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     4     6     4     6     4     6     4     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     8     9    10    10    11    11    12    12    12    12    12    12    12    12    13    13    14    14    15    15    15    15    18    18    22    22    22    22    23    23    26    26    26    26    26    26    27    27    27    27    29    29    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    29    30    28    30    28    30    26    28    26    27    25    27    26    28    26    28    26    28    26    28    26    27    26    26    26    26    26    26    25    25    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    16    21    16    21    16    21    14    19
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 3e-015     NP_012479.1 Zinc-regulated DNA binding protein involved in zinc ion homeostasis; Zap1p[Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bf ---- 5e-019     CAB92782.1 Krox protein [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 3e-038     NP_733402.1 CG1322-PA, isoform A [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-041     NP_500424.3 Zinc finger plus homeodomain, Axon Guidance family member (zag-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 2e-044     BAE06801.1 zinc finger protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 8e-052     XP_799337.1 PREDICTED: similar to Zinc finger homeobox protein 1b (Smad interacting protein 1) [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dr ---- 2e-115     NP_571784.1 zinc finger homeobox 1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 3e-140     NP_001015808.1 MGC97552 protein [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Mm ---- 0          NP_056568.2 zinc finger homeobox 1b [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Hs ---- 0          NP_055610.1 zinc finger homeobox 1b; Smad-interacting protein 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_422151.2 PREDICTED: similar to KIAA0569 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PREDICTED - ?? ---- 0          NP_001092145.1 hypothetical protein LOC100049718 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Xl ---- 0          BAA94081.1 smad interaction protein 1 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu077c14.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------ATG------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------ATG---------------------------------------ATG---------------------------------------------------------------------ATG---------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------ATG------------------------------ATG---------ATGTAA---------------TAA---------------------------------------------------TAA------------------TGA---------------------------------------------------------------------------------------ATG---------------------------------------------------------------TAATAG------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Te4                                  CAAN5529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGAAAGAGCACATCAAATACCGCCACGAGAAGAACGAGGAGAACTTTTCGTGCCCCCTGTGCAGCTACACGTTCGCCTACCGCACCCAGCTTGAACGGCATATGGTGACTCACAAGCCAGGCAGAGATCAGCACCAAATGTTGACCCAAGGTGCTGGCAATCGCAAGTTCAAATGCACAGAGTGTGGTAAAGCTTTCAAGTATAAACACCATCTGAAGGAGCACCTGCGAATTCACAGTGGTGAGAAGCCCTACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCACTCGGGTTCATACAGTTCCCACATAAGCAGCAAAAAATGCATTGGCCTAATCTCAGTAAATGGCAGAATGAGAAACAACATAAAGACAGGTTCGTCCCCCAATTCAGTATCTTCCTCTCCCACCAATTCAGCCATAACACAACTACGGCACAAGCTGGAGAACGGCAAACCACTGGGCATGTCTGAACCATCAGGCTTACTGAAAATCAAAACAGAAACATTAGATTACAACGATTATAAACTTTTTATGGCCGCCACACATGGATTTAATGGGCCGCATCCATTCATGAATGGTGGTCTTGGTGCAACCAGCCCACTGGGAATCCATTCCTCAGCTCCAAGTCCAATGCAGCACTTAGGTGTAGGGATAGAATCATCGCTACTTGGGTACCCTTCCATTGCTAGTAACTTAAGTGAGGTGCAGAAAGTTCTAGAAATTGTGGACAATACGGTTTCTAGGCAGAAAATGGAATACAAGTCTGATGAAATTACAAAGCTGAAGGGCTATCATATGAAGGGACGCAGGA
  5   1   2       bld Tad5      in                            XZT90.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGGTGCGAATTCCAGTGGTGAGAAGCCCTACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCACTCGGGTTCATACAGTTCCCACATAAGCAGCAAAAAATGCATTGGCCTAATCTCAGTAAATGGCAGAATGAGAAACAACATAAAGACAGGTTCGTCCCCCAATTCAGTATCTTCCTCTCCCACCAATTCAGCCATAACACAACTACGGCACAAGCTGGAGAACGGCAAACCACTGGGTATGTCTGAACCATCAGGCTTACTGAAAATCAAAACAGAAACATTAGATTACAATGATTATAAACTTTTTATGGCCGCCACACATGGATTTAATGGGCCGCATCCATTCATGAATGGTGGTCTTGGTGCAACCAGCCCACTGGGAATCCATTCCTCAGCTCCAAGTCCAATGCAGCACTTAGGTGTAGGGATAGAATCATCGCTACTTGGGTACCCTTCCATTGCTAGTAACTTAAGTGAGGTGCAGAAAGTTCTAGAAATTGTGGACAATACGGTTTCTAGGCAGAAAATGGAATACAAGTCTGATGAAATTACAAAGCTGAAGGGCTATCATATGAAGGACGCAGGACCTCAACCAGAGGATCAAGGAGTTACGTCTCCTGGTATCCCACCAGTAGGTCTTCCTGTAGTTAGTCATAATGGTGCCACTAAAAGTATTATTGACTATACTTTAGAGAAGGTTAATGAAGCCAAAGCATGTTTGCAAAGCTTGACGACGGATTCAAGGAGGCAGATTAGTAAATATTA
  5   1   2       bld Brn3      in                        CAAK12660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAAGCTGGAGAACGGCAAACCACTGGGCATGTCTGAACCATCAGGCTTACTGAAAATCAAAACAGAAACATTAGATTACAACGATTATAAACTTTTTATGGCCGCCACACATGGATTTAATGGGCCGCATCCATTCATGAATGGTGGTCTTGGTGCAACCAGCCCACTGGGAATCCATTCCTCAGCTCCAAGTCCAATGCAGCACTTAGGTGTAGGGATAGAATCATCGCTACTTGGGTACCCTTCCATTGCTAGTAACTTAAGTGAGGTGCAGAAAGTTCTAGAAATTGTGGACAATACGGTTTCTAGGCAGAAAATGGAATACAAGTCTGATGAAATTACAAAGCTGAAGGGCTATCATATGAAGGACGCAGGACCTCAACCAGAGGATCAAGGAGTTACGTCTCCTGGTATCCCACCAGTAGGTCTTCCTGTAGTTAGTCATAATGGTGCCACTAAAAGTATTATTGACTATACTTTAGAGAAGGTTAATGAAGCCAAAGCATGTTTGCAAAGCTTGACGACGGATTCAAGGAGGCAGATTAGTAATATTAAGAAAGAAAAGTTACGTACGTTGATAGACCTTGTAAGTGAAGAGAAGATGTTAGAGAGCCATAATATATCCACTCCATTTTCGTGCCAGTTTTGTAAGGAAAGTTTCCCTGGTCCAATTCCTTTACACCAACATGAAAGATACTTATGTAAGATGAATGAAGAAATTAAAGCAGTTCTCCAGCCCA
  5   1   2       bld Lun1      in                        CABD10670.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAATGCAGCACTTAGGTGTAGGGATAGAATCATCGCTACTTGGGTACCCTTCCATTGCTAGTAACTTAAGTGAGGTGCAGAAAGTTCTAGAAATTGTGGACAATACGGTTTCTAGGCAGAAAATGGAATACAAGTCTGATGAAATTACAAAGCTGAAGGGCTATCATATGAAGGACGCAGGACCTCAACCAGAGGATCAAGGAGTTACGTCTCCTGGTATCCCACCAGTAGGTCTTCCTGTAGTTAGTCATAATGGTGCCACTAAAAGTATTATTGACTATACTTTAGAGAAGGTTAATGAAGCCAAAGCATGTTTGCAAAGCTTGACGACGGATTCAAGGAGGCAGATTAGTAATATTAAGAAAGAAAAGTTACGTACGTTGATAGACCTTGTAAGTGAAGAGAAGATGTTAGAGAGCCATAATATATCCACTCCATTTTCGTGCCAGTTTTGTAAGGAAAGTTTCCCTGGTCCAATTCCTTTACACCAACATGAAAGATACTTATGTAAGATGAATGAAGAAATTAAAGCAGTTCTCCAGCCCAATGAAAATCTAATTCTCAACAAACAAGCGATGTTCGCTGAGAAACAAGCACTCCTGTTGTCATCGGTACTTTCTGAGAAAGGAATGACAGGCCCCATCAACCCATACAAGGACCACATGTCTGTACTAAAAGCATATTATGCTATGAATATGGAGCCCAACTCTGACGAACTACTGAAAATTTCCATAGCTGTCGGCCTTCCTCAGGAATTTGTGAAGGAATGGTTTGAACAAAGAAAAGTTTATCAATATGCAAACTCCAGGTCACCATCTCTGGAAGGACCAGTGCAGAGGTGGCTCTGGCTACCACCCTAAATACTCCCACTAAAGACTCAGCCAGATC
  5   1   2       bld AbdN                               IMAGE:7024365                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTAGGTGTAGGGATAGAATCATCGCTACTTGGGTACCCTTCCATTGCTAGTAACTTAAGTGAGGTGCAGAAAGTTCTAGAAATTGTGGACAATACGGTTTCTAGGCAGAAAATGGAATACAAGTCTGATGAAATTACAAAGCTGAAGGGCTATCATATGAAGGACGCAGGACCTCAACCAGAGGATCAAGGAGTTACGTCTCCTGGTATCCCACCAGTAGGTCTTCCTGTAGTTAGTCATAATGGTGCCACTAAAAGTATTATTGACTATACTTTAGAGAAGGTTAATGAAGCCAAAGCATGTTTGCAAAGCTTGACGACGGATTCAAGGAGGCAGATTAGTAATATTAAGAAAGAAAAGTTACGTACGTTGATAGACCTTGTAAGTGAAGAGAAGATGTTAGAGAGCCATAATATATCCACTCCATTTTCGTGCCAGTTTTGTAAGGAAAGTTTCCCTGGTCCAATTCCTTTACACCAACATGAAAGATACTTATGTAAGATGAATGAAGAAATTAAAGCAGTTCTCCAGCCCAATGAAAATCTAATTCTCAACAAACAAGCGATGTTCGCTGAGAAACAAGCACTCCTGTTGTCATCGGTACTTTCTGAGAAAGGAATGACAGGCCCCATCAACCCATACAAGGACCACATGTCTGTACTAAAAGCATATTATGCTATGAATATGGAGCCCAACTCTGACGAACTACTGAAAATTTTCATAGCTGTCGGCCTTCCTCAAGATTTTGTGAAGGAATGGTTTGAACAAAGAAAAGTTTATCAATATGCAAACTCCAGGGCAACATCTCTGGAAAAGGACAGTGCAAAAGGTGGCTCTGGGCTCCACCCCTAAATACTCCCCCCTAAAAGACTCAGCCC
  5   1   2       bld AbdN                               IMAGE:7004351                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGGTGTAGGGAGAGAATCATCGCTACTTGGGTACCCTTCCATTGCTAGTAACTTAAGGGAGGGGCAAAAAGTTCTAGAAATTGTGGACAATACCGTTTGTAGGCAGAAAATGGAGTGACAAGTCTGATGAAATTACAAAGCTGAAGGGCTATCAGATGAAGGACGCACGGCCTCGACCAGAGGATCAAGGAGTTACGTCTCCTGGTATCCCGCCAGTAGGTCTTCCTGGAGTTAGTCATAATGGTGCCACTAAAAGTATTATTGACTATACTTTAGAGAAGGTTAATGAAGCCAAAGCATGTTTGCAAAGCTTGACGACGGATTCAAGGAGGCAGATTAGTAATATTAAGAAAGAAAAGTTACGTACGTTGATAGACCTTGTAAGTGAAGAGAAGATGTTAGAGAGCCATAATATATCCACTCCATTTTCGTGCCAGTTTTGTAAGGAAAGTTTCCCTGGTCCAATTCCTTTACACCAACATGAAAGATACTTATGTAAGATGAATGAAGAAATTAAAGCAGTTCTCCAGCCCAATGAAAATCTAATTCTCAACAAACAAGCGATGTTCGCTGAGAAACAAGCACTCCTGTTGTCATCGGTACTTTCTGAGAAAGGAATGACAGGCCCCATCAACCCATACAAGGACCACATGTCTGTACTAAAAGCATATTATGCTATGAATATGGAGCCCAACTCTGACGAACTACTGAAAATTTCCATAGCTGTCGGCCTTTCCTCANGAAATTTTGTGAAGAAAGGGTTTTGAACCAAGAAAAATTTTATCAAATAATGCAAACTTCCAGGGTCCACCCATCTTCTTGGNAAAGGAACCAAGGGCAAGAAGGTGGGGCTCCTTGGGCCTTACCACCCCCTTAAAATTACTTCCCCCCCCTAAN
  5   1   2       bld Tbd1      in                         CBXT1614.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAAAGAAAAGTTACGTACGTTGATAGACCTTGTAAGTGAAGAGAAGATGTTAGAGAGCCATAATATATCCACTCCATTTTCGTGCCAGTTTTGTAAGGAAAGTTTCCCTGGTCCAATTCCTTTACACCAACATGAAAGATACTTATGTAAGATGAATGAAGAAATTAAAGCAGTTCTCCAGCCCAATGAAAATCTAATTCTCAACAAACAAGCCATGTTCGCTGAGAAACAAGCACTCCTGTTGTCATCGGTACTTTCTGAGAAAGGAATGACAGGCCCCATCAACCCATACAAGGACCACATGTCTGTACTAAAAGCATATTATGCTATGAATATGGAGCCCAACTCTGACGAACTACTGAAAATTTCTATAGCTGTCGGCCTTCCTCAGGAATTTGTGAAGGAATGGTTTGAACAAAGAAAAGTTTATCAATATGCAAACTCCAGGTCACCATCTCTGGAAAGGACCAGTGCAGAGGTGGCTCTGGCTACCACCCTAAATACTCCCACTAAAGACTCAGCCAGATCTCCAATAAAATCTGTGGACTCTATAACTTCACCATCTATAGCAGAACTTCATAACCGGGTATCAAATTGTGATACGCCTCTCAGGCTAACAAAATCGAATCATTTTGCTAGTATGAAACCAGTTGTTGACAAATTGGACCACTCCAGGAGCAACACTCCTTCTCCTTTGAATCTTTCTTCC
  5   1   2       bld Spl1      in                         CABK7263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATGTTAGAGAGCCATAATATATCCACTCCATTTTCGTGCCAGTTTTGTAAGGAAAGTTTCCCTGGTCCAATTCCTTTACACCAACATGAAAGATACTTATGTAAGATGAATGAAGAAATTAAAGCAGTTCTCCAGCCCAATGAAAATCTAATTCTCAACAAACAAGCGATGTTCGCTGAGAAACAAGCACTCCTGTTGTCATCGGTACTTTCTGAGAAAGGAATGACAGGCCCCATCAACCCATACAAGGACCACATGTCTGTACTAAAAGCATATTATGCTATGAATATGGAGCCCAACTCTGACGAACTACTGAAAATTTCCATAGCTGTCGGCCTTCCTCAGGAATTTGTGAAGGAATGGTTTGAACAAAGAAAAGTTTATCAATATGCAAACTCCAGGTCACCATCTCTGGAAAGGACCAGTGCAGAGGTGGCTCTGGCTACCACCCTAAATACTCCCACTAAAGACTCAGCCAGATCTCCAATAAAATCTGTGGACTCTATAACTTCACCATCTATAGCAGAACTTCATAACCGGGTATCAAATTGTGATACGCCTCTCAGGCTAACAAAATCGAATCATTTTGCTAGTATGAAACCAGTTGTTGACAAATTGGACCACTCCAGGAGCAACACTCCTTCTCCTTTGAATCTTTCTTCCACATCTTCTAAAAACTCCCACAGCAGTTCTTACACTCCAAACAGTTTCTCGTCGGAGGAACTTCAAGCTGAGCCCTTGGACTTATCTGTACCAAAACTAATGAAGGAATCCAAAACTATTATTGCCACAAAGAACAAATCTAAGCCCAACAACATCACAATTGACCACAATAGTATTTCTTTACCGTCTGAAACTGTAGATGAGCCACTGAATTTNACATACATAAAGAAGGAATTTTGTAA
  3   1   2       chi Gas7 5g3  out                          XZG195.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTGTGAAGGAATGGTTTGAACAAAGAAAAGTTTATCAATATGCAAATTCCAGGTCACCATCTCTGGAAAGGACCAGTGCAGAGGTGGCTCTGGCTACCACCCTAAATACTCCCACTAAAGACTCAGCCAGATCTCCAATAAAATCTGTGGACTCTATAACTTCACCATCTATAGCAGAACTTCATAACCGGGTATCAAATTGTGATACGCCTCTCAGGCTAACAAAATCGAATCATTTTGCTAGTATGAAACCAGTTGTTGACAAATTGGACCACTCCAGGAGCAACACTCCTTCTCCTTTGAATCTTTCTTCCACATCTTCTAAAAACTCCCACAGCAGTTCTTACACTCCAAACAGTTTCTCGTCAGAGGAACTTCAAGCTGAGCCCTTGGACTTATCTGTACCAAAACTAATGAAGGAATCCAAAACTATTATTGCCACAAAGAACAAATTTTACGTAAAGAGAAGAGCATTTATTGTGTTTTGGAACATTAATTGTGAAATTATGCGATTTTTTTTTTCCGATTTTATTATTTTATTTTGTTTTAGTTTTTTTTTTTTTTTCCAATTACTGGAAATTCCAAATTTGGGAACTTTTGATACGATCTTGTGAAAACACTGTATTTTCGACTGAAAATTCCAATTTCTTCATCTT
  3  -1   2       bld Spl1      in                        CABK10065.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGAACTTCATAACCGGGTATCAAATTGTGATACGCCTCTCAGGCTAACAAAATCGAATCATTTTGCTAGTATGAAACCAGTTGTTGACAAATTGGACCACTCCAGGAGCAACACTCCTTCTCCTTTGAATCTTTCTTCCACATCTTCTAAAAACTCCCACAGCAGTTCTTACACTCCAAACAGTTTCTCGTCGGAGGAACTTCAAGCTGAGCCCTTGGACTTATCTGTACCAAAACTAATGAAGGAATCCAAAACTATTATTGCCACAAAGAACAAATCTAAGCCCAACAACATCACAATTGACCACAATAGTATTTCTTTACCGTCTGAAACTGTAGATGAGCCACTGAATTTAACATACATAAAGAAGGAATTTTGTAATGCTAATATGGACAAAAGCACTAACCCACTATTCGGTATAAACCCATTTAGTGGTAAACCTTTGTACACAGCGCTTCCTCCACAAAGCGCATTCCCACCAGCCACATTTATGCCCCCAGTACAGACCGGAATTCCTGGACTACGACATTACCCAGGACTTGATCAGATGAGCTTCCTACCACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTTTGACTCCTGTCTGTCCCGGANAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAGGCCACACCA
  5   1   2       bld Gas                            TGas133c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAAATTGTGATACGCCTCTCAGGCTAACAAAATCGAATCATTTTGCTAGTATGAAACCAGTTGTTGACAAATTGGACCACTCCAGGAGCAACACTCCTTCTCCTTTGAATCTTTCTTCCACATCTTCTAAAAACTCCCACAGCAGTTCTTACACTCCAAACAGTTTCTCGTCGGAGGAACTTCAAGCTGAGCCCTTGGACTTATCTGTACCAAAACTAATGAAGGAATCCAAAACTATTATTGCCACAAAGAACAAATCTAAGCCCAACAACATCACAATTGACCACAATAGTATTTCTTTACCGTCTGAAACTGTAGATGAGCCACTGAATTTAACATACATAAAGAAGGAATTTTGTAATGCTAATATGGACAAAAGCACTAACCCACTATTCGGTATAAACCCATTTAGTGGTAAACCTTTGTACACAGCGCTTCCTCCACAAAGCGCATTCCCACCAGCCACATTTATGCCCCCAGTACAGACCGGAATTCCTGGACTACGACATTACCCAGGACTTGATCAGATGAGCTTCCTACCACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTC
  5   1   2       bld Spl1      in                         CABK3515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGGAGCAACACTCCTTCTCCTTTGAATCTTTCTTCCACATCTTCTAAAAACTCCCACAGCAGTTCTTACACTCCAAACAGTTTCTCGTCGGAGGAACTTCAAGCTGAGCCCTTGGACTTATCTGTACCAAAACTAATGAAGGAATCCAAAACTATTATTGCCACAAAGAACAAATCTAAGCCCAACAACATCACAATTGACCACAATAGTATTTCTTTACCGTCTGAAACTGTAGATGAGCCACTGAATTTAACATACATAAAGAAGGAATTTTGTAATGCTAATATGGACAAAAGCACTAACCCACTATTCGGTATAAACCCATTTAGTGGTAAACCTTTGTACACAGCGCTTCCTCCACAAAGCGCATTCCCACCAGCCACATTTATGCCCCCAGTACAGACCGGAATTCCTGGACTACGACATTACCCAGGACTTGATCAGATGAGCTTCCTACCACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTCTGACTCCTGTCTGTCCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAG
  5   1   2       bld Spl1      in                         CABK2970.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATCGATTCGCCACTATTCGGTATAAACCCATTTAGTGGTAAACNCTTTGTACACANGCGCTTCCTCCACAAAGCGCATTCCCACCAGCCACATTTATGCCCCCAGTACAGACCGGAATTCCTGGACTACGACATTACCCAGGACTTGATCAGATGAGCTTCCTACCACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTCTGACTCCTGTCTGTCCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGA
  5   1   2       bld Tad5      in                         XZT31548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAGCACTAACCCACTATTCGGTATAAACCCATTTAGTGGTAAACCTTTGTACACAGCGCTTCCTCCACAGAGCGCATTCCCACCAGCCACATTTATGCCCCCAGTACAGACCGGAATTCCTGGACTACGACATTACCCAGGACTTGATCAGATGAGCTTCCTACCACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTCTGACTCCTGTCTGTCCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCCAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGA
  5   1   2       bld Gas7      in                         XZG32370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAGGACTTGATCAGATGAGCTTCCTACCACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTCTGACTCCTGTCTGTCCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGA
  5   1   2       bld Gas7      in                         XZG40088.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACACATGGCCTATACTTATCCAACTGGAGCTGCCACGTTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTCTGACTCCTGTCTGTCCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCA
  5   1   2       bld Te3       in                         CAAM5623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGCAGAAATGCAGCAACGGAGAAAGTATCAGCGCAAACAAGGATTTCAGGGTGACTTGCTCGACGGTACACCGGATTACATGTCAGGTCTCGATGATATGACAGATTCTGACTCCTGTCTGTCCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACAAATCAGAACATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCT
  5   1   2       bld Neu       in                   TNeu077c14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGAAAAAGATTAAGAAGACAGAAAGTGGCATGTACGCTTGTGACTTATGTGATAAGACATTCCAGAAAAGCAGCTCTCTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAGGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGA
  5   1   2       bld Neu       in                   TNeu066p01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTCTTAGACACAAATATGAACATACAGGAAAAAGGCCACACCAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATC
  3   1   2       bld Te4       out                        CAAN8399.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTATTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTG
  3   1   2       bld Spl1      in                         CABK7263.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAATGTCAGATCTGTAAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTAC
  3   1   2       bld Lun1      in                        CABD10670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGTCAGATCTGTAAAAAGCCTTCAAACACAAACACCATNTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTAAAAA
  3   1   2      seed Neu       in                    TNeu077c14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAAAGCCTTCAAACACAAACACCATTTGATAGAACATTCGCGACTGCACTCTGGCGAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK3515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATTTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Te3       out                        CAAM6731.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCCGTACCAATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTC
  5  -1   2       bld Spl1      in                        CABK10065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTGACAAATGCGGCAAACGCTTCTCCCATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  5   1   2       bld Neu       in                   TNeu099o23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGGCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAAGGAAAGAGAAAGTGTGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAAGATGAGGAAGAGAATG
  3   1   2       bld Brn3      in                        CAAK12660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTCTGGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Spl1      in                         CABK2970.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Gas7                                 XZG21508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Te3       in                         CAAM5623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Tad5      in                         XZT31548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Neu       in                    TNeu066p01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTTTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTCCAAACTTAAAAAAAAAAAAAAAAAAAGAAGATATTTCTAATTTATATTAATACATTTTAAAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG40088.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCAGCACATGAATCATAGGTATTCCTACTGTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Gas7 PIPE out                        XZG31672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACTGTAAGAGGGAGTCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Brn3 5g3  out                       CAAK11913.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Brn3      out                       CAAK11245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGAGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTATTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTTAAAAAAAAAAAAAAAAAAAGAAGATATTTCTAATTTATATTAATACATTTTTAAAAGAATT
  3   1   2       bld Gas7 5g3  out                        XZG64007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGGGGAGGCGGAGGAACGGGAAGCGGCAGAGAGGGAAGCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCATCCCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTTAAAAAAAAAAAAAAAAAAAGAAGATATTTCTAATTTATATTAATACATTTTTAAAAG
  3   1   2       bld Tbd1      in                         CBXT1614.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCACGTGAGAAGGGTCATTTGGAACCCACGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTTAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG32370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGGAGCTACTGATGAATAGAGCGTATTNGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTT
  3   1   2       bld Tad5      in                            XZT90.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGAGCTACTGATGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAAATAGTTCATTGTACGAATTGCACTAAACTTATATATCCACTACAAACT
  3   1   2       bld Neu       in                    TNeu099o23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAATAGAGCGTATTTGCAAAGCATAACTCCTCAGGGCTATTTCTGACTCAGAGGAAAGAGAAAGTATGCCAAGAGACAGAGGAAGAGAATTGGAGCATGAAAAGGAAGGGGAAGACGTTTATGACAAATTGAGGAGACAAGTTGGTGACGAAGAGTTTGAGGAAGAGGAAGAGGAGAGTGAAAATAAAAGCATGGACACAGATCCGGACACGATTAGAGATGAGGAAGAGAATGGTGACCATTCAATGGACGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTACTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAAATAGTTCATTGTACGAATTGCACTCTACTTATATATCACTACAAACTTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5x3  out                   TTpA028c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAGGAGAGGGAAAATAAAAGCATGGACACAGATCCGGACGCGATTAGAGATGAGGAAGAGAATGCTGACCATTCAATGGAGGATAGTTCGGAAGACGGCAAAATGGAAACCAAATCAGACCATGAAGAAGAGATAATGGAGGATGGCATGTAATTAACTATTGCATTTTAAGCTTCCTACGTTTCCAGTAGTATTGTTACTTGCTTGAAAACACTGCTGTGTTAAGCTGTTTATGCACGTGCCTGATGCTTCCAGGAAGCCTGTATAGATGAACTGAAGGGGGGCGGTTCTGCCAAAAGTCAAATAAAGTTGGTTACCGTGAAGAACTGCATTATGCAAACTTTTTGTACAGTATTAAGGCCTAAAAACTGTGTGGTTCGAGAGACTAAACCCTGTGTTTAATAGCATTTATACTTTTAAGCACAAAAAAAAATAGTTCATTTAACGAATTGCACTCTACTTATATTCACTACAACTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)