Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC11006.3.5                        71 END     1           2        1                Unknown (protein for MGC:121919) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 284.0    0Xt7.1-TGas086o02.3.5                       56 PI      100      1340     1488                Novel protein containing G-patch domain [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     3   0.0    0Xt7.1-TGas086o02.3.5                       56 SPLT    0           0        0                Novel protein containing G-patch domain [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 16%

 1012159340 Xt7.1-CAAP9170.3 - 37 ESTs
                                                                       -470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAP9170.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGTTTAGCTTGGGCCTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTTAAAAAT
                                                  Xt7.1-CHK-1008268004                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGCTTGGGCCTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTTAAAAAxAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            4     6     7     8     8     9    13    14    14    15    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    17    18    18    19    19    19    19    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    20    19    20    19    20    19    19    19    19    18    19    19    19    18    19    19    19    19    19    19    19    18    18    18    19    18    19    19    19    18    18    18    18    18    18    18    18    18    18    18    19    18    19    18    19    19    20    19    20    19    23    19    23    19    24    20    24    22    25    20    25    21    25    21    26    21    26    22    27    23    27    21    27    19    26    21    27    21    27    19    27    21    29    19    26    17    23    18    24    17    22    16    21    15    21    16    20    16    18    16    18    16    18    15    17    14    17    15    17    15    17    15    17    15    17    14    17    14    16    14    16    14    16    14    16    14    16    14    16    13    16    14    16    14    16    14    16    14    16    11    16    14    16    16    16    16    16    14    15    14    16    15    16    16    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    16    16    16    16    15    16    15    16    15    15    13    14    12    13    11    11    11    11     4     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGGCACTAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTAGGCAGTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T----
                                               BLH ATG     -17      22                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Sc ==== 1e-044     NP_014199.1 Hypothetical ORF; similarity to human TGR-CL10C, thyroidal receptor forN-acetylglucosamine; Ynl200cp [Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PREDICTED - Ce ---- 2e-055     NP_493241.1 predicted CDS, apolipoprotein A-I binding protein like (1N400) [Caenorhabditiselegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 2e-061     XP_424208.1 PREDICTED: similar to apoA-I binding protein, partial [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 7e-073     NP_572604.1 CG2974-PA [Drosophila melanogaster] --------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 6e-086     XP_793166.1 PREDICTED: similar to apolipoprotein A-I binding protein [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dr ---- 2e-101     NP_001002618.1 zgc:92263 [Danio rerio] -----------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---= 8e-107     NP_658985.2 apolipoprotein A-I binding protein precursor [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---= 1e-108     NP_659146.1 apolipoprotein A-I binding protein; apolipoprotein A-I interacting protein;apoA-I binding protein; EST AA087124 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 8e-150     AAH87311.1 LOC496142 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAP9170.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------TAG------------------------TGA---------TGA---------------TAG---------------------------------------------------TAG------------------ATG---TAG------TGA---------------------------------------------------------------------------ATG------------TAA---------------------------------------------------------TGA---------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TAA------------TAA------------------------------------------------------------------------------ATG---------TAA---ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       chi Fat1      in                         CABC1532.5p CGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGGTAACCACTAGGGGACTGGGGGGAACCCAAACATAGTCATTGGGAAGTCTGCTCCACCTGGCATAACCAACATAGGAATTAAATGGGAATAAAACTTCAAGTATTTAAAAAAGTTTCTCATATTTACTTTTACTATAATCTTGGAAATAGAATCACTGGGTGAAGTTGCCCTTTAATGAGCACTGCTAAGATGCAGTAGCATAACTAAGCCCAAACCACTGAGCAATAGGTAGGAGTTCTGCCTTCTCTGATTAGGATTAAGgcagtggttcccaacctccctaatgccgcgaccctttaatacagtccctcatgttgtggtgacccccaaccataaaattattcctaaggccattggaaatatgtgttttccgatggtcttgggcgacccctgtgaaagggtcgtttgaccccctaaggggtcccgacccacaggttgagaaccgctggattaagtaaaagcaaaaaaaaacctggggagtagtacacaaactataaaaggagaaggaaaggcaaaatctatgaagcacactattaaatagtactactattgtCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGAACAATGGAGGAGATGGTCTGGTCTGTGCC
  5   1   2       bld Spl2      in                        CBSS1811.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGGCTCCGCACTCTGTTTAGCTTGGGCCTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGAC
  5   1   2       bld TpA                            TTpA078l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTCCGCACTCTGTTTAGCTTGGGCCTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGNGTGGNAAAGATTGTCCNAAAGGCACTAGAGAAAAAGTACAGTCTCAAATCTCCACATACCCTGNGGACTGAATGTGTCCAGAAGCTGCC
  5   1   2       bld In54                            IMAGE:8945364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCCGCACTCTGTTTAGCTTGGGCCTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACACTTCTGGGTGGAAGATTTGTCCCAAAGGCAACTAGAGAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGATGTGTCAGAAGCTGCTAAACAAGAGTGTGCCTTAGGGGAAGGTGAATTCAGTTAGGCAGTGGACTGAAGATTGTACATC
  5   1   2       bld Egg                            TEgg137l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCACTCTGTTTAGCTTGGGCCTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGC
  5   1   2       bld In62                            IMAGE:8955793.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTTGTTTTAGCTTGGGCCTTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACGGGACGATACCACTTCCTGGGTGAGATTTGTCCCAAAGGCACTAGAGAAAAGTACAGTCTCATCTTCCCACCATACCCTGGGACTGATGTGTCAGAGCTGCTTAAACAGGGTGCCTAGGAGGTGAATCAGTAGCATGACTGGAAATGATTACAATAAGAATAGGTCAACTTTTTGGTT
  5   1   2       bld Te1       in                         CBWN1485.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTGGGCCTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGATATGAACCAGCCATACATTACCCGAAGCGTCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCAGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCCGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCTCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCCACCATACCCTGGGACTGGATG
  5   1   2       bld Mus1      in                        CABH11560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGGGCCTGCTGGTTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCANAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTANACCAAAGAGTGTGCTTAGG
  5   1   2       bld Brn4      in                        CAAL10637.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGGGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCC
  5   1   2       bld Liv1      in                        CAAR12501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAACTGCCTTAAA
  5   1   2       bld AbdN      in                       IMAGE:7007015                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGGGGGAAGATTTGTCCCAAAGGCACTAGAGGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGGACTGAATGGTGTCCAGGAAGCTGCCTTTAAACCAAAGAAGTGGGG
  5   1   2       bld Spl2      in                        CBSS1874.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGG
  5   1   2       bld Int1      in                         CAAP9170.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCGCCTTGGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGT
  5   1   2       bld TbA                            TTbA062j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTTGGAGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGACCGCTGGGGCAGGGGCTGGTAACAGAAGGAAGCTCCCAGTGCAAGCAAATCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAACTCGAGAAGAAGCACAGGCTGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGGTGATCAGCTTATGGAACTAGCTGGACTTATCTGCGCTGTCGCTATTACCAACGCTTAACCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAAGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGAGACCTTAAGCTTTTTGGGTATGATACAGCCATACATTACCCGAAGCGCCCCAACATGACGCTATTTGAGAACCTATCAACGCAGTGTCAGAAAAT
  3  -1   2       bld Int1      in                        CAAP14159.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCGCTAGGGTAGCGCAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCANAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACATACCCTGNGACTGAATGTGTCCAGAAGCTGCCTTAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATCAGTAGGCAGTGACTGAAAAATGAAATTACAAATTAG
  3  -1   2       bld Lun1      in                         CABD4700.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCAGGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCANAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTANACCAAAGAGTGTGCTTAGGGGAGGGTGGAA
  5   1   2       bld Int1      in                         CAAP9207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGTTGGAGCCCTTGGCGGGACGTGTCCGCTGGGGCAGGGGCTGGTAGCAGACGGAAACTCCCAGTGCAAGCAATTCAGAACTGGGGCAGCCATGGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAAC
  5   1   2       bld BrSp      in                     EC2BBA22AG06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAACGGGGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGATATGAACCAGCCATACATTACCCGAAGCGTCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCAGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCCGTGCACTTCACCGGACGATACC
  3   1   2       bld Int1      in                         CAAP9170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACTGAGATACCTAAGTCAGGAAGAAGCACAGGCAGTGGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTAGCCTCTCGCCCT
  3  -1   2       bld Int1      out                        CAAP6071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACGAAGAGCTATTCAATGAATACAGGTTCAGCGTTGATCAGCTTATGGAACTAGCTGGACTTAGCTGCGCTGTCGCTATTACCAAGGCTTATCCAGTTAGTTCATTCACATCCAACTTGCCAACGGTATTGGTGGTCTGTGGTCCAGGGAACAATGGAGGAGATGGTCTGGTCTGTGCCCGACACCTTAAGCTTTTTGGGTATGAACCAGCCATACATTACCCGAAGCGCCCAAACAAGACGCTATTTGAGAACCTAACAACGCAGTGTCAGAAAATGGACATTCCATTTGTCTCAGAGTTTCCAAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGANAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCA
  5   1   2       bld Thy1      in                        CBST5433.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACATTCCATTTGTCTCAGAGTTTCCAGTGAGCCTGAAGTAATTGACGGAGCCTACAACCTGGTAGTGGATGCCGTTTTTGGATTCAGCTTTAAAGGAGCTGTACGTGAACCCTTTGGCAATATTCTGAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCA
  3   1   2       bld AbdN      in                       IMAGE:7007015                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTACGTGACCCCTTTTGGCAATATTTCTGAGTACGTTAAAGCGCGTCACTGTCCCCCATTGCAGGTGTGGCCATCCCATCCAGGATGGGACGTGGAGAAAGGGACCCCCAGAGGGGATACAGCCCGGACATGCTTATTTCTTTGACCGCTCCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGCCCTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTCACCTTTTTTAA
  5  -1   2       bld Int1      in                        CAAP14159.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTACGTTAAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGAtattattattaacatgtatttataaagccccaacatattccacagcgctgCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTA
  5  -1   2       bld Lun1      in                         CABD4700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGCGCGTCACTGTACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGAtattattattaacatgtatttataaagccccaacatattccacagcgctgCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCCTCGTGCCGA
  3   1   2       bld AbdN                               IMAGE:6997965                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTCCCATGCAAGTGTGACATCCCATCAGGATGCGACGTGAGAAGGGAAACCCAGAGGGGATACAGCCGGACATGTTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGAAAGATCTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTAATATCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCTTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATATGTTTTAAAGCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCCTTTAATAGGTATCTATACGTCCGACCC
  3   1   2       bld Fat1      in                         CABC1532.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCCATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGGAGAAAGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGAtattattattaacatgtatttataaagccccaacatattccacagcgctgCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTT
  3   1   2       bld Mus1      in                        CABH11560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTGCAAGTGTGGACATCCCATCAGGATGGGACGTGAGAAAGGGACCCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGAtattattattaacatgtatttataaagccccaacatattccacagcgctgCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTT
  3   1   2       bld Liv1      in                        CAAR12501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAGGATGGGACGTGGAGAAAGGGAACCCAGAGGGGATACAGCCGGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCTGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGAtattattattaacatgtatttataaagccccaacatattccacagcgctgCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTTAAAAATGAAAAAA
  3   1   2       bld Te1       in                         CBWN1485.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGGGATACAGCCAGACATGCTTATTTCTTTGACCGCTCCCAAACAATCAGCCGTGCACTTCACCGGACGATACCACTTCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGATGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATGTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTTAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA22AG06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAAACAATCAGCCGTGCACTTCACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGATGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATGTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACA
  3   1   2       bld Spl2      in                        CBSS1874.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACCGGACGATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTT
  3   1   2       bld Brn4      in                        CAAL10637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATACCACTTCCTGGGTGGAAGATTTGTCCCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTTTCAGCCACTTCAGACCAAGTTGTCAGCTTTTTGGACGGTGTATGGAGGTGACGGCCTCCCAGATATTTTTTTTAACATGTATTTATAAAGCCCCAACATTTTCCACAGGGCTGCAATTTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTTTTGGCATTTGGGGGGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGGGAAAAGCCCCTTGGGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTTTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTT
  3   1   2       bld Thy1      in                        CBST5433.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAAAGGCACTAGAGAAAAAGTACAGTCTCAATCTCCCACCATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTTTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATTTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTTTAAAGCTGTCATTGGGTAACATGTATATTCATTAAATCTAATTACTGG
  3   1   2       bld Int1      in                         CAAP9207.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGGCTGAAAAATTGAAATTTCAAATTAAGATAGGGCCCTTTTTTGTCCAAGTATATTTTCTTCCACATCCCCCAGAAAACCCCATAGGATTGGTTTAAATGCAGCCTGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGGTGGTGTTTTAGCCACTTCAGACCAAGTTGTCAGCTTTTTGGACGGTGTATGGAGGGGACGGCCTCCCCGATTTTTTTTTTAACATGTATTTTTAAAGCCCCAACATTTTTCACAGGGGTGCAATTTTTTGGCAGGCTTGCAAATTGAATTGAGAGAGGGCTTTTTTGGCATTTGGGGGGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTTTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGGGAAAAGCCCCTTGGGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTTTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTTAAAAATGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Bone                               CBTC11567.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATACCCTGGGACTGAATGTGTCCAGAAGCTGCCTTAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAAAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTT
  3   1   2       bld Spl2      in                        CBSS1811.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAACCAAAGAGTGTGCTTAGGGGAGGGTGGAATTCAGTAGGCAGTGACTGAAAAATTGAAATTACAAATTAAGATAGGGCACTTTTTTGTCCAAGTATATTTACTACCACATCACCCAGAAAACCACATAGGATTGGTTTAAATGCAGCATGATATAGATCAGATGATCAACTTGTGGCCTTATAGCACTTAGGGAACTACTTTCCCATTTATTTCATGGAAGGTTGAGAGTTAAGTTGGTTATGAGTAGGTTGATATAAGCTGCTGTCTCAGCCACTTCAGACCAAGTTGTCAGCTTATTGGACGGTGTATGGAGGTGACGGCCTGCCAGATATTATTATTAACATGTATTTATAAAGCCCCAACATATTCCACAGCGCTGCAATCTATTGGCAGGCTTGCAAATTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTT
  5  -1   2       bld Ova1                                 CABE9843.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNTGAATTGAGAGAGGACTTTATTGGCATTTGGGGTGGCCAAATCAGGCAAAAATCAGGTAATTCATTGCTGTTCTTGTTGCTATAAAAAATAAGTACTTAACCTTTAATAAAATAAGGAGAAAAGCACCTTGAGCATAATTATTGTATCTATAAGTCCATACCCTTAACCTTTCTAAAGCTGTCATTGGGTAACATGTATATTCAATAAATCATGCCTTTAAAAATGCGTCTGATGCATGACTTTTTGCAGTTAGCTTCTGGGAAATGATTGCTTTGTATAAGTTACACTGAACCTGATGGCTTTATATTTGACACTTTTACATTTGTACATGGGACATCCCCTAAACTGGTTAGGGTATAGAAACATTACTAGTTTGAAACCTCTAAGTGATCCTTTGATACATGTCTTCCCAAGCAGGGTAACCAAGACGCCATACGTACAAAATGATGGGCCCTGGTATGTCGAAAACTTGTTATTCTACCTACTGTTGAACTACAAATCCCAGAAGCCCCAAAACATAATAGCAAGCATTGTAACATTTACCCTGCCCTTTGGCCAAATCAAAACAAATGTAAAATTATGAAAAGTCTGCATTTAATGAAGGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)