Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABG12635.5                           9 END     1           1       11                zinc finger protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 322.0    0Xt7.1-CABG9440.5                           31 PI      100      4011     4179                PREDICTED: hypothetical protein [Strongylocentrotus purpuratus]

 This cluster: approximate FL confidence score = 96%

 1012172964 Xt7.1-TGas136k18.3 - 73 ESTs
                                                                       ........-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas136k18.3                                                                                                                                                                                                                                                                                                                                                             CGCCAAGTTTCAGAGAGCAGTGCGGGTTGGAAGTGCTCGGTGCCTGCTGGCTGTGCTGACTGGTGTCCCGCCATGTCAAAGCAAAAGACCCTGTTCAGCTTCTTCCACAAGTCCCCCCCTATCTCCAGCAGCACCAAGTCCGGGAAAGCCTCTTCCCCAACCGAGGCCGATGTTCCCTCCTCTGGGGGCAAGAAGTCCAGCTCTTCACCTAAAGAGGGGGCCAAGGAAAGGGGGACTCCAGGCCGGGCTCATGGAGGGAAAGCTCCCCGGTCTGCCGCACCCAGCGCTGTCAGTGACTTCAACCCTGGAGACCTAGTTTGGGCCAAAATGCCTGGTCATCCATGGTGGCCCTCTTTGGTTTACAACCACCCAAAAGAAGACACTCATCTAAGGGGCAAGGGAAAGTCCCTTAATATCCATGTCCAGTTTTTTGATGACAGCCCTACAAGAGGATGGGTTGGAGCAAAATATATGAAGCCTTTCTCTGGTTCCACTGCTGCCGAAGCCCAAAAAGGTGGTCTTTTTTTTAGTACCAAGCCAGAAATAAGAAAAGCAATAAAAATGGCAGATGATGCCATGGCACAAGACAAGCAAAAGCGCCTTGAATTGGCTGTGTGCATGGAACCATCAGATTCGGAAGAGGATATGGAGGTTGAAGATGAGGGCTCTTCTGCAAGTCACGATGAAGCAGAAGACGTAAAAAAAAGGCAGCCAGTTCGGGAGAGTAAAAAGAATGGCAAACCCAAAAGAAGAAGGATTACGATAGAGTCAGACAGTGATAATGAAGGCTCTGATGATGAATTCAAGCCAGAAGACAGTGCTAGTAGTGATGAGGCCAGTAGTGGGGTGGATGAAGCTAAACTGTCAGAACCTGATTCTGAAACTGAAGAAGATAGCCCAGTCAAGGTCCCTTTAAAGCGTAAAAGAGGGAATCCTGACAAACCAACTGGCCCAAAAAAGCGCTTGCAAGATGAACTTTCAGAAACCCCCAAAAGAGCAAGCAATGTGTCTGCAGAGGCCAAGTTAAAGTTATCTTCCTTCTCTGCTCCCGAGTCTTTCGAATCACAGACAAATGCTGGCGGGACTGGCAGTGTTTCTGTATGGGACCATGAAAAGTTTGATTGGCTGCAAGATGGGAGAAGGAAGGATCTTAAACGTAAAAAGCAGAACGATGCTGATTACGACCCAAGCACCTTGTATGTCCCAGATGACTTCCTTAATAAATGCACTCCAGGCATGAGAAAATGGTGGCAGCTTAAATCTCAGAACTTTGATACGGTTATCTTTTATAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTCAACGAGTTGGGCCTGACATTCATGAAAGGCGCATGGGCTCATTCTGGCTTTCCAGAGATTGCTTTTGGACGATTTTCCGATGTTCTCGTACAGAAAGGATACAAAGTAGCCAGAGTGGAGCAGACGGAAACTCCAGAGATGATGGAAGTCCGGTGCAAGTCAATGTCACATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACTCAGACTTACAGTGTTTTAGATGGCAATCCGTCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAGAAAATGGATGATTCCTCTGGTCAAAGAAGAATATATGGTGTTTCTTTTGTGGACACCTCTGTAGGGAAATTTCACGTAGGTCAGTTTGAAGATGACCGCCATTGTTCGAGGTTTAGAACTTTGGTAGCCCATTTCCCTCCAATTCAGATCTTGTTTGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGTCTGTCAACTTCCATTCAGGAAAGCCTGCAGCCTACATCTCAGTTTTGGGACGCATTCAAAACACTGAAAACTTTAGCTGAAGAAGCTTACTTTGAAAAAGATTTTCAACCTGGCAGTGGCAACTTGCCAACAGTTTTGAAAAACTTGACTTCAGAAAATGACTCTTTAGCACTTACTCCTGGTGAAAAGAGTGAATTGGCTCTTTCAGCGCTTGGAGCATGTATATATTACCTTAAGAAATGTCTTATTGACCAAGAGCTGCTCTCTATGGCAAACTTTGAAGAATACATTCCTGTGGATACGGGCATAGAAAAAGCCCAGGCTTCAAGTAGTTTCTTTGCCAAGACGAGTCAGCGCATGGTTCTTGATGGAGTAACACTTACAAATCTGGAAATTCTCCAGAATGGAACAAATGGTTCTACAGAAGGGACACTGTTAGAAAAGCTGGACACATGCTCTACACCCTTTGGGAAGCGTCTCTTAAAACAGTGGCTGTGCGCCCCTCTTTGTAATCCCTTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGACTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAAACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTACTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008278896                                                                                                                                                                                                                                                                                                                                                                   GTTTCAxAxAGCAGTGCGGGTTGGAAGTGCTCGGTGCCTGCTGGCTGTGCTGACTGGTGTCCCGCCATGTCAAAGCAAAAGACCCTGTTCAGCTTCTTCCACAAGTCCCCCCCTATCTCCAGCAGCACCAAGTCCGGGAAAGCCTCTTCCCCAACCGAGGCCGATGTTCCCTCCTCTGGGGGCAAGAAGTCCAGCTCTTCACCTAAAGAGGGGGCCAAGGAAAGGGGGACTCCAGGCCGGGCTCATGGAGGGAAAGCTCCCCGGTCTGCCGCACCCAGCGCTGTCAGTGACTTCAACCCTGGAGACCTAGTTTGGGCCAAAATGCCTGGTCATCCATGGTGGCCCTCTTTGGTTTACAACCACCCAAAAGAAGACACTCATCTAAGGGGCAAGGGAAAGTCCCTTAATATCCATGTCCAGTTTTTTGATGACAGCCCTACAAGAGGATGGGTTGGAGCAAAATATATGAAGCCTTTCTCTGGTTCCACTGCTGCCGAAGCCCAAAAAGGTGGTCTTTTTTTTAGTACCAAGCCAGAAATAAGAAAAGCAATAAAAATGGCAGATGATGCCATGGCACAAGACAAGCAAAAGCGCCTTGAATTGGCTGTGTGCATGGAACCATCAGATTCGGAAGAGGATATGGAGGTTGAAGATGAGGGCTCTTCTGCAAGTCACGATGAAGCAGAAGACGTAAAAAAAAGGCAGCCAGTTCGGGAGAGTAAAAAGAATGGCAAACCCAAAAGAAGAAGGATTACGATAGAGTCAGACAGTGATAATGAAGGCTCTGATGATGAATTCAAGCCAGAAGACAGTGCTAGTAGTGATGAGGCCAGTAGTGGGGTGGATGAAGCTAAACTGTCAGAACCTGATTCTGAAACTGAAGAAGATAGCCCAGTCAAGGTCCCTTTAAAGCGTAAAAGAGGGAATCCTGACAAACCAACTGGCCCAAAAAAGCGCTTGCAAGATGAACTTTCAGAAACCCCCAAAAGAGCAAGCAATGTGTCTGCAGAGGCCAAGTTAAAGTTATCTTCCTTCTCTGCTCCCGAGTCTTTCGAATCACAGACAAATGCTGGCGGGACTGGCAGTGTTTCTGTATGGGACCATGAAAAGTTTGATTGGCTGCAAGATGGGAGAAGGAAGGATCTTAAACGTAAAAAGCAGAACGATGCTGATTACGACCCAAGCACCTTGTATGTCCCAGATGACTTCCTTAATAAATGCACTCCAGGCATGAGAAAATGGTGGCAGCTTAAATCTCAGAACTTTGATACGGTTATCTTTTATAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTCAACGAGTTGGGCCTGACATTCATGAAAGGCGCATGGGCTCATTCTGGCTTTCCAGAGATTGCTTTTGGACGATTTTCCGATGTTCTCGTACAGAAAGGATACAAAGTAGCCAGAGTGGAGCAGACGGAAACTCCAGAGATGATGGAAGTCCGGTGCAAGTCAATGTCACATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACTCAGACTTACAGTGTTTTAGATGGCAATCCGTCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAGAAAATGGATGATTCCTCTGGTCAAAGAAGAATATATGGTGTTTCTTTTGTGGACACCTCTGTAGGGAAATTTCACGTAGGTCAGTTTGAAGATGACCGCCATTGTTCGAGGTTTAGAACTTTGGTAGCCCATTTCCCTCCAATTCAGATCTTGTTTGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGTCTGTCAACTTCCATTCAGGAAAGCCTGCAGCCTACATCTCAGTTTTGGGACGCATTCAAAACACTGAAAACTTTAGCTGAAGAAGCTTACTTTGAAAAAGATTTTCAACCTGGCAGTGGCAACTTGCCAACAGTTTTGAAAAACTTGACTTCAGAAAATGACTCTTTAGCACTTACTCCTGGTGAAAAGAGTGAATTGGCTCTTTCAGCGCTTGGAGCATGTATATATTACCTTAAGAAATGTCTTATTGACCAAGAGCTGCTCTCTATGGCAAACTTTGAAGAATACATTCCTGTGGATACGGGCATAGAAAAAGCCCAGGCTTCAAGTAGTTTCTTTGCCAAGACGAGTCAGCGCATGGTTCTTGATGGAGTAACACTTACAAATCTGGAAATTCTCCAGAATGGAACAAATGGTTCTACAGAAGGGACACTGTTAGAAAAGCTGGACACATGCTCTACACCCTTTGGGAAGCGTCTCTTAAAACAGTGGCTGTGCGCCCCTCTTTGTAATCCCTTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGACTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAAACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTACTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAAxxAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                  2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     6     6     7     7     7     7     7     7     7     7     7     7     8     8     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    11    10    11    10    11    11    11    11    11    11    11    11    11    10    11    11    12    12    13    12    12    12    12    12    12    13    13    13    13    12    13    12    13    12    14    12    13    13    14    14    15    13    16    12    16    13    15    14    15    14    15    14    15    14    15    14    15    14    15    14    16    14    16    14    16    14    15    13    15    13    14    13    14    13    14    13    14    12    13    12    13    11    12    12    13    12    13    10    12    10    12    12    13    12    13    13    14    13    14    13    14    13    13    12    12    12    12    12    12    12    12    11    12    10    11    11    11    13    13    14    14    15    15    15    15    15    15    16    16    18    18    18    18    18    18    19    19    19    20    22    22    28    28    29    29    28    30    29    29    27    30    26    31    30    32    29    32    29    33    29    33    29    33    29    33    31    35    31    35    32    36    32    37    32    38    31    38    32    38    32    38    34    39    33    38    34    37    35    39    38    40    38    40    38    39    37    39    36    38    37    38    35    36    34    36    35    36    36    37    36    37    37    37    37    37    37    37    36    36    36    36    35    36    36    36    36    36    36    36    36    36    36    36    35    36    36    36    36    36    35    36    34    35    32    34    32    34    32    34    32    34    32    34    31    34    32    35    32    34    32    34    32    34    31    33    31    33    29    33    27    33    28    33    19    27     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                               BLH ATG      72    1534                                                                                                                                                                                                                                                                                                                                                             
                                               BLH MIN      27     296                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 7e-007     AAH92548.1 MGC107852 protein [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Sc ---- 2e-150     NP_010382.1 Msh6p [Saccharomyces cerevisiae] --------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 0          NP_491163.1 MutS Homolog (133.6 kD) (msh-6) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 0          NP_648755.1 CG7003-PA [Drosophila melanogaster] -----=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 0          XP_797647.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dr ==== 0          NP_878280.1 mutS homolog 6 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 0          NP_034960.1 mutS homolog 6 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 0          NP_000170.1 mutS homolog 6; G/T mismatch-binding protein; mutS (E. coli) homolog 6 [Homosapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 0          XP_419359.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAH89270.1 Unknown (protein for MGC:85188) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED = ?? ==== 0          NP_001089247.1 hypothetical protein LOC734294 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas136k18.3                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------ATG---------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATGATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------ATG------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       ext Neu  5g                        TNeu070m16.p1cSP6                                                                                                                                                                                            GCCCCTTTACCTTTATTTCAAAGGAAATCGTTGCTGGGAATTGTAGTTTAAGGACAGCCGCTTACTCTTTAATGTATCCGCCTACCCTGTTTGTTTGAGGTTGCTGATTGGCTGCCCGTCTGGTTGCCGTATGGTCTCTGCCAAGTAGTTTTTCCCGCCAGCGCCAAGTTTCATATAGCATTGCGGGTTGGAAGTGCTCGGTGCCTGCTGGCTGTGCTGACTGGTGTCCCGCCATGTCAAAGCAAAAGACCCTGTTCAGCTTCTTCCACAAGTCCCCCCCTATCTCCAGCAGCACCAAGTCCGGGAAAGCCTCTTCCCCAACCGAGGCCGATGTTCCCTCCTCTGGGGGCAAGAAGTCCAGCTCTTCACCTAAAGATGGGGCCAAGGAAAGGGGGACTCCAGGCCGGGCTCATGGAGGGAAAGCTCCCCGGTCTGCCGCACCCAGCGCTGTCAGTGACTTCAACCCTGGAGACCTAGTTTGGGCCAAAATGCCTGGTCATCCATGGTGGCCCTCTTTGGTTTACAACCACCCAAAAGATGACACTCATCTAATGGGCAAGGGAAAGTCCCTTA
  5   1   4   14 seed Te4  5g3  in                         CAAN4267.5p ............................................................................................................................................................................................................................................................................................................................................................CGCCAAGTTTCAGAGAGCAGTGCGGGTTGGAAGTGCTCGGTGCCTGCTGGCTGTGCTGACTGGTGTCCCGCCATGTCAAAGCAAAAGACCCTGTTCAGCTTCTTCCACAAGTCCCCCCCTATCTCCAGCAGCACCAAGTCCGGGAAAGCCTCTTCCCCAACCGAGGCCGATGTTCCCTCCTCTGGGGGCAAGAAGTCCAGCTCTTCACCTAAAGAGGGGGCCAAGGAAAGGGGGACTCCAGGCCGGGCTCATGGAGGGAAAGCTCCCCGGTCTGCCGCACCCAGCGCTGTCAGTGACTTCAACCCTGGAGACCTAGTTTGGGCCAAAATGCCTGGTCATCCATGGTGGCCCTCTTTGGTTTACAACCACCCAAAAGAAGACACTCATCTAAGGGGCAAGGGAAAGTCCCTTAATATCCATGTCCAGTTTTTTGATGACAGCCCTACAAGAGGATGGGTTGGAGCAAAATATATGAAGCCTTTCTCTGGTTCCACTGCTGCCGAAGCCCAAAAAGGTGGTCTTTTTTTTAGTACCAAGCCAGAAATAAGAAAAGCAATAAAAATGGCAGATGATGCCATGGCACAAGACAAGCAAAAGCGCCTTGAATTGGCTGTGTGCATGGAACCATCAGATTCGGAAGAGGATATGGAGCTTGAAGATGAGGGCTCTTCTGCAAGTCACGATGAAGCAGAAGACGTAAAANAAAGGCAGCCAGTTCGGGAGAGTAAAAAGAATGGCAAACCCAAAAGAAGAAGGATTACGATAGAGTCAGACAGTGATAATGAAGGCTCTGATGATGAATTCAAGCCAGAAGACAGTGCTAGTAGTGATGAGGCCAGT
  5   1   3        nb Te4  PIPE in                         CAAN7828.5p                                                                                                                                                                                                                                                                                                                                                                       CAGAGAGCAGTGCGGGTTGGAAGTGCTCGGTGCCTGCTGGCTGTGCTGACTGGTGTCCCGCCATGTCAAAGCAAAAGACCCTGTTCAGCTTCTTCCACAAGTCCCCCCCTATCTCCAGCAGCACCAAGTCCGGGAAAGCCTCTTCCCCAACCGAGGCCGATGTTCCCTCCTCTGGGGGCAAGAAGTCCAGCTCTTCACCTAAAGAGGGGGCCAAGGAAAGGGGGACTCCAGGCCGGGCTCATGGAGGGAAAGCTCCCCGGTCTGCCGCACCCAGCGCTGTCAGTGACTTCAACCCTGGAGACCTAGTTTGGGCCAAAATGCCTGGTCATCCATGGTGGCCCTCTTTGGTTTACAACCACCCAAAAGAAGACACTCATCTAAGGGGCAAGGGAAAGTCCCTTAATATCCATGTCCAGTTTTTTGATGACAGCCCTACAAGAGGATGGGTTGGAGCAAAATATATGAAGCCTTTCTCTGGTTCCACTGCTGCCGAAGCCCAAAAAGGTGGTCTTTTTTTTAGTACCAAGCCAGAAATAAGAAAAGCAATAAAAATGGCAGATGATGCCATGGCACAAGACAAGCAAAAGCGCCTTGAATTGGCTGTGTGCATGGAACCATCAGATTCGGAAGAGGATATGGAGCTTGAAGATGAGGGCTCTTCTGCAAGTCACGATGAAGCAGAAGACGTAAAAAAAAGGCAGCCAGTTCGGGAGAGTAAAAAGAATGGCAAACCCAAAAGAAGAAGGATTACGATAGAGTCAGACAGTGATAATGAAGGCTCTGATGATGAATTCAAGCCAGAAGACAGTGCTAGTAGTGATGAGGCCAGTAGTGGGGTGGATGAAGCTAAACTGTCAGAAACTGATTCTGAAACTGA
  5   1   3        nb Gas8 5g3  in                          st25l21.5p                                                                                                                                                                                                                                                                                                                                                                                       TCTGCAGCGCTCGGTGCCTGCTGGCTGTGCTGACTGGTGTCCCGCCATGTCAAAGCAAAAGACCCTGTTCAGCTTCTTCCACAAGTCGCCCCCTATCTCCAGCAGCACCAAGTCCGGGAAAGCCTCTTCCCCAACCGAGGCCGATGTTCCCTCCTCTGGGGGCAAGAAGTCCAGCTCTTCACCTAAAGAGGGGGCCAAGGAAAGGGGGACTCCAGGCCGGGCTCATGGAGGGAAAGCTCCCCGGTCTGCCGCACCCAGCGCTGTCAGTGACTTCAACCCTGGAGACCTAGTTTGGGCCAAAATGCCTGGTCATCCATGGTGGCCCTCTTTGGTTTACAACCACCCAAAAGAAGACACTCATCTAAGGGGCAAGGGAAAGTCCCTTAATATCCATGTCCAGTTTTTTGATGACAGTCCTACAAGAGGATGGGTTGGAGCAAAATATATGAAGCCTTTCTCTGGTTCCACTGCTGCCGAAGCCCAAAAAGGTGGTCTGTTTTTTAGTACCAAGCCAGAAATAAGAAAAGCAATAAAAATGGCAGATGATGCCATGGCACAAGACAAGCAAAAGCGCCTTGAATTGGCTGTGTGCATGGAACCATCAGATTCGGAAGAGGATATGGAGGTTGAAGATGAGGGCTCTTCTGCAAGTCACGATGAAGCAGAAGAC
  5   1   2       add Gas       in                   TGas135p10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGTTTTTCCCGCCAGCGCTGTCAGTGACTTCAACCCTGGAGACCTAGTTTGGGCCAAAATGCCTGGTCATCCATGGTGGCCCTCTTTGGTTTACAACCACCCAAAAGAAGACACTCATCTAGGGGGCAAGGGAAAGTCCCTTAATATCCATGTCCAGTTTTTTGATGACAGCCCTACAAGAGGATGGGTTGGAGCAAAATATATGAAGACACTCCTCTAAGGGGCAAGGGAAAGTCCCTTAATATCCATGTCCAGTTTTTTGATGACAGCCCTACAAGAGGATGGGTTGGAGCAAAATATATGAAGCCTTTCTCTGGTTCCACTGCTGCC
  5   1   3        nb Egg       in                   TEgg003l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACTTCAACCCTGGAGACCTAGTTTGGGCCAAAATGCCTGGTCATCCATGGTGGCCCTCTTTGGTTTACAACCACCCAAAAGAAGACACTCATCTAAGGGGCAAGGGAAAGTCCCTTAATATCCATGTCCAGTTTTTTGATGACAGCCCTACAAGAGGATGGGTTGGAGCAAAATATATGAAGCCTTTCTCTGGTTCCACTGCTGCCGAAGCCCAAAAAGGTGGTCTGTTTTTTAGTACCAAGCCAGAAATAAGAAAAGCAATAAAAATGGCAGATGATGCCATGGCACAAGACAAGCAAAAGCGCCTTGAATTGGCTGTGTGCATGGAACCATCAGATTCGGAAGAGGATATGGAGGTTGAAGATGAGGGCTCTTCTGCAAGTCACGATGAAGCAGAAGACGTAAAAAAAAGGCAGCCAGTTCGGGAGAGTAAAAAGAATGGCAAACCCAAAAGAAGAAGGATTACGATAGAGTCAGACAGTGATAATGAAGGCTCTGATGATGAATTCAAGCCAGAAGACAGTGCTAGTAGTGATGAGGCCAGTAGTGGGGTGGATGAAGCTAAACTGTCAGAACCTGATTCTGAAACTGAAGAAGATAGCCCAGTCAAGGTCCCTTTAAAGCGTAAA
  5   1   2       ext Gas7      in                         XZG59041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGCATGGAACCATCAGATTCGGAAGAGGATATGGAGGTTGAAGATGAGGGCTCTTCTGCAAGTCACGATGAAGCAGAAGACGTAAAAAAAAGGCAGCCAGTTCGGGAGAGTAAAAAGAATGGCAAACCCAAAAGAAGAAGGATTACGATAGAGTCAGACAGTGATAATGAAGGCTCTGATGATGAATTCAAGCCAGAAGACAGTGCTAGTAGTGATGAGGCCAGTAGTGGGGTGGATGAAGCTAAACTGTCAGAACCTGATTCTGAAACTGAAGAAGATAGCCCAGTCAAGGTCCCTTTAAAGCGTAAAAGAGGGAATCCTGACAAACCAACTGGCCCAAAAAAGCGCTTGCAAGATGAACTTTCAGAAACCCCCAAAAGAGCAAGCAATGTGTCTGCAGAGGCCAAGTTAAAGTTATCTTCCTTCTCTGCTCCCGAGTCTTTCGAATCACAGACAAATGCTGGCGGGACTGGCAGTGTTTCTGTATGGGACCATGAAAAGTTTGATTGGCTGCAAGATGGGAGAAGGAAGGATCTTAAACGTAAAAAGCAGAACGATGCTGATTACGACCCAAGCACCTTGTATGTCCCAGATGACTTCCTTAATAAATGCACTCCAGGCATGAGAAAATGGTGGCAGCTTAAATCTCAGAACTTTGATACGGTTATCTTTTATAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTCAACGAGTTGGGCCTGACATTCATGAAAGGCGCATGGGCTCATTCTGGCTTT
  5   1   2       ext Gas7      in                         XZG46469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTGCTAGTAGTGATGAGGCCAGTAGTGGGGTGGATGAAGCTAAACTGTCAGAACCTGATTCTGAAACTGAAGAAGATAGCCCAGTCAAGGTCCCTTTAAAGCGTAAAAGAGGGAATCCTGACAAACCAACTGGCCCAAAAAAGCGCTTGCAAGATGAACTTTCAGAAACCCCCAAAAGAGCAAGCAATGTGTCTGCAGAGGCCAAGTTAAAGTTATCTTCCTTCTCTGCTCCCGAGTCTTTCGAATCACAGACAAATGCTGGCGGGACTGGCAGTGTTTCTGTATGGGACCATGAAAAGTTTGATTGGCTGCAAGATGGGAGAAGGAAGGATCTTAAACGTAAAAAGCAGAACGATGCTGATTACGACCCAAGCACCTTGTATGTCCCAGATGACTTCCTTAATAAATGCACTCCAGGCATGAGAAAATGGTGGCAGCTTAAATCTCAGAACTTTGATACGGTTATCTTTTATAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTCAACGAGTTGGGCCTGACATTCATGAAAGGCGCATGGGCTCATTCTGGCTTTCCAGAGATTGCTTTTGGACGATTTTCCGATGTTCTCGTACAGAAAGGATACAAAGTAGCCAGAGTGGAGCAGACGGAAACTCCAGAGATGATGGAAGTCCGGTGCAAGTCAATGTCACATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACTCAGACTTACAGTGTTTTAGATGGCAATCCGTCTGAAAGCCATAGTAAGTATCTTCTGTGC
  5   1   2       ext Limb      in                        CBSU1126.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGGCAGCTTAAATCTCAGAACTTTGATACGGTTATCTTTTATAAGGTTGGCAAGTTTTATGAACTTTATCACATGGATGCTGTCATTGGGGTCAACGAGTTGGGCCTGACATTCATGAAAGGCGCATGGGCTCATTCTGGCTTTCCAGAGATTGCTTTTGGACGATTTTCCGATGTTCTCGTACAGAAAGGATACAAAGTAGCCAGAGTGGAGCAGACGGAAACTCCAGAGATGATGGAAGTCCGGTGCAAGTCAATGTCACATCCAAGTAAATTTGACAGGGTTGTAAGAAGAGAAATATGCAGGATCATTACTAAAGGGACTCAGACTTACAGTGTTTTAGATGGCAATCCGTCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAGAAAATGGATGATTCCTCTGGTCAAAGAAGAATATATGGTGTTTCTTTTGTGGACACCTCTGTAGGGAAATTTCACGTAGGTCAGTTTGAAGATGACCGCCATTGTTCGAGGTTTAGAACTTTGGTAGCCCATTTCCCTCCAATTCAGATCTTGTTTGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGTCTGTCAACTTCCATTCAGGAAAGCCTGCAGCCTACATCTCAGTTTTGGGACGCATTCAAAACACTGAAAACTTTAGCTGAAGAAGCTTACTTTGAAAAAGATTTTCAACCTGGCAGTGGCAACTTGCCAACAGTTTTGAAAAACTTGACTTCAGAAAATGACTCTTTAGCACTTACTCCTGGTGAAAAGAGTGAATTGGCTCTTTCAGCGCTTGGAGCATGTAT
  5   1   2       ext Tad5      in                         XZT44131.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGAGAAATATGCAGGATCATTACTAAAGGGACTCAGACTTACAGTGTTTTAGATGGCAATCCGTCTGAAAGCCATAGTAAGTATCTTCTGTGCTTCAAAGAGAAAATGGATGATTCCTCTGGTCAAAGAAGAATATATGGTGTTTCTTTTGTGGACACCTCTGTAGGGAAATTTCACGTAGGTCAGTTTGAAGATGACCGCCATTGTTCGAGGTTTAGAACTTTGGTAGCCCATTTCCCTCCAATTCAGATCTTGTTTGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGTCTGTCAACTTCCATTCAGGAAAGCCTGCAGCCTACATCTCAGTTTTGGGATGCATTCAAAACACTGAAAACTTTAGCTGAAGAAGCTTACTTTGAAAAAGATTTTCAACCTGGCAGTGGCAACTTGCCAACAGTTTTGAAAAACTTGACTTCAGAAAATGACTCTTTAGCACTTACTCCTGGCGAAAAGAGTGAATTGGCTCTTTCAGCGCTTGGAGCATGTATATATTACCTTAAGAAATGTCTTATTGACCAAGAGCTGCTCTCTATGGCAAACTTTGAAGAATACATTCCTGTGGATACGGGCATAGAAAAAGCCCAGGCTTCAAGTAGTTTCTTTGCCAAGACGAGTCAGCGCATGGTTCTTGATGGAGTAACACTTACAAATCTGGAAATTCTCCAGAATGGAACANATGGTTCTACAGAAGGGACACTGTTAGAAAAGCTGGACACATGCTCTACACCCTTTGGGAAGCGTCTCTTANAACAGTGGCTGTGCGCCCCTCNTTGTATCCCTTC
  5   1   3        nb Gas7      in                         XZG45732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATTTCCCTCCAATTCAGATCTTGTTTGAGAAAGGCAACCCTTCTTCAGATACAAAGAAAGTTTTGAAGAGCTGTCTGTCAACTTCCATTCAGGAAAGCCTGCAGCCTACATCTCAGTTTTGGGACGCATTCAAAACACTGAAAACTTTAGCTGAAGAAGCTTACTTTGAAAAAGATTTTCAACCTGGCAGTGGCAACTTGCCAACAGTTTTGAAAAACTTGACTTCAGAAAATGACTCTTTAGCACTTACTCCTGGTGAAAAGAGTGAATTGGCTCTTTCAGCGCTTGGAGCATGTATATATTACCTTAAGAAATGTCTTATTGACCAAGAGCTGCTCTCTATGGCAAACTTTGAAGAATACATTCCTGTGGATACGGGCATAGAAAAAGCCCAGGCTTCAAGTAGTTTCTTTGCCAAGACGAGTCAGCGCATGGTTCTTGATGGAGTAACACTTACAAATCTGGAAATTCTCCAGAATGGAACAAATGGTTCTACAGAAGGGACACTGTTAGAAAAGCTGGACACATGCTCTACACCCTTTGGGAAGCGTCTCTTAAAACAGTGGCTGTGCGCCCCTCTTTGTAATCCCTTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGGCTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATTGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACT
  5   1   2       ext Gas7      in                         XZG31805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTAGCACTTACTCCTGGTGAAAAGAGTGAATTGGCTCTTTCAGCGCTTGGAGCATGTATATATTACCTTAAGAAATGTCTTATTGACCAAGAGCTGCTCTCTATGGCAAACTTTGAAGAATACCTTCCTGTGGATACGGGCATAGAAAAAGCCCAGGCTTCAAGTAGTTTCTTTGCCAAGACGAGTCAGCGCATGGTTCTTGATGGAGTAACACTTACAAATCTGGAAATTCTCCAGAATGGAACAAATGGTTCTACAGAAGGGACACTGTTAGAAAAGCTGGACACATGCTCTACACCCTTTGGGAAGCGTCTCTTAAAACAGTGGCTGTGCGCCCCTCTTTGTAATCCCTTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGGCTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCAGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCANAACTGGTGTGATCACTCCCTAAGT
  5   1   3        nb Egg       in                   TEgg017f19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTATTGACCAAGAGCTGCTCTCTATGGCAAACTTTGAAGAATACATTCCTGTGGATACGGGCATAGAAAAAGCCCAGGCTTCAAGTAGTTTCTTTGCCAAGACGAGTCAGCGCATGGTTCTTGATGGAGTAACACTTACAAATCTGGAAATTCTCCAGAATGGAACAAATGGTTCTACAGAAGGGACACTGTTAGAAAAGCTGGACACATGCTCTACACCCTTTGGGAAGCGTCTCTTAAAACAGTGGCTGTGCGCCCCTCTTTGTAATCCCTTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGACTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGG
  5   1   2       ext Gas7      in                         XZG20559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGACGAGTCAGCGCATGGTTCTTGATGGAGTAACACTTACAAATCTGGAAATTCTCCAGAATGGAACAAATGGTTCTACAGAAGGGACACTGTTAGAAAAGCTGGACACATGCTCTACACCCTTTGGGAAGCGTCTCTTAAAACAGTGGCTGTGCGCCCCTCTTTGTAATCCCTTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGACTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAAACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACG
  3   1   3        nb Te4  PIPE in                         CAAN7828.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACGAGTCAGCGCATGGTTCTTGATGGAGTAACACTTACAAATCTGGAAATTCTCCAGAATGGAACAAATGGTTCTACAGAAGGGACACTGTTAGAAAAGCTGGACACATGCTCTACACCCTTTGGGAAGCGTCTCTTAAAACAGTGGCTGTGCGCCCCTCTTTGTAATCCCTTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGATCTCCTAAAGAAACTCCCTGATCTAGAGAGGCTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAGACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATT
  3   1   3        nb Egg       in                    TEgg003l23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGTGGCTGTGCGCCCCTCTTTGTAATCCCTTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGACTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAAACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas       in                   TGas060c23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTCCATTAATGATCGTTTAAACGCAGTGGAAGATCTCATGGACCTTCCTGATAAAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGACTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTAT
  5   1   3        nb Egg       in                   TEgg001n15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTGTCTGAAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGACTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAAACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTACTGGACTAAAGCAATTGAAAAGATGTTTGGAG
  3   1   2       add Egg                             TEgg030e03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTTAGTGAGCTCCTAAAGAAACTCCCTGATCTAGAGAGACTGCTGAGCAAAATTCACAGTATCGGTTCCCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAAATCCTCCAGCGGCCACTTTCCTGACCTATTGGCAGAGATGAAGAGATGGGATACTTCTCTTGATCACGAGAAAGCGCGCAAAATTGGTGTGATCACTCATAAAGTGGGTTTCGATCCGGATTACGATGGCGCCTTGAAAGATATCAAAGCCACTGATGCAAGATCTTAGTCGGGTTTTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTGGTATATTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTATCCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTAGTGGAGTATAGCAATTGAAAAGAGGTTTGGAGACCTCGCGAACGCAGAGGAACGCGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTGTTGTATAACTGTGATAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg       in                   TEgg059b18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCACTTAAAAGCCAGAACCATCCAGATAGCAGGGCTGTAATGTACGAGGAAATCGCTTACAGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAAACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTACTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATG
  5   1   3        nb HdA       ?                    THdA039m06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTCCAGATATCACGGCTGTAATGTACGAGGAAATCGCTTACGCAAGAAGAAGATTGCAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAAACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTACTGGACTAAAGTAATTGAAAAGATGTTTGGAGAC
  5   1   3        nb HdA       out                  THdA039m05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGATTTCTTATCTGCTCTGGAGGGGTTTAAAGTCATGAGAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACCAGAAAGCGCGCAAAACTGGTGTGATCACTCCTAAGGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAATCACCGAACAGGATCGTACCGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCATCTACTGCGGGACGGCCAACATACCATACTGAATGGAAATT
  5   1   2       ext Tad5      in                         XZT43448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAAGTGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAGACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTATTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACA
  5   1   2       ext Te5       in                        CAAO10332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATCAGTATTCTGGAAGATGCTGCTGCTAACTTTAAGTCAAGTATACTGAAACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAGACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTATTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCAC
  5   1   3        nb Tad5      in                         XZT64657.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACAAATTGTAAGTATTAAAGGTAAAACTCCCCAGGGACACTTCCCTGACCTATCGGCAGAGCTGAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAGACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTATTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCC
  5   1   2       add In63                            IMAGE:8959105.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAAGCTGAAAGAGATGGGATACTTCTTTTGATCACGAGAAAGCGCGCAAGACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTATTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCAGGTTGTTATGGCACAGCTGGGATGTACGTGCCGGCAGAGTCTTGCAGACTGACTCCGTAGACCGGGTGTTAACCGACTGGTGCATCTGACGAATCATGCAGTGAAAGCACATTTTGTGAATTGAATGACTCTAGCATCTGCAGCATGCACAGAACATTCCTTGGGCTTTCTGGCATGTAACCTTGA
  5   1   2       add In63                            IMAGE:8961293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATACTTTCTTTTGATCACGAGAAAGCGCGCAAGACTGGTGTGATCACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTATTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGTAAATGCATACATTTTATAACGTTATACCCAAGTTAAAAAAAAAAAATTGGTTCCAATGGGATTGTGTTTACATTTGTTCCCTTTTAAAAATTTAACCAGGGTCCTGCACTGCGCTTCTCTCTCCCACTACGCAAAGACTTTCAGACAGCTATTCTCCATACTGTACTAAATACAGCTGTGCACATGATGTAGCAGCAATTCCCTAAACCCTATGCTACTGCAACTGATGATATTGGTCAAACATTGTCATTGACGCTATCGAATGCATGCTGCAATCTGAACTCGCAGGCAGTCTAACCTCGACGAATTA
  5   1   2       ext Gas7      in                         XZG49255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGAGAAAGCGCGCAAAACTGGTGTGATAACTCCTAAAGTGGGTTTTGATCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTACTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGTCAAGGTGGTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACA
  5   1   2       add In54                            IMAGE:8943944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCCCGCCCTTCATTGGCAACGCCAAAACTCCATTTTAAAATTCGTCCCGGATTACGATGAAGCATTGAAAGATATCAAAACCACAGAACAAGATCTTAACGAGTATTTGGATAAACAGCGCAAACGACTCAGCTGTAAAACTGTCGTCTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTACTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGATGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGTGCATCTGACCGAATCATGGCAGTGAAAGCACATTTTTTTGTGATTGAGTGAAACCTCTAGCATACTGCAGCATGCACAGACATCCTGGTGCTCTGATGACTGAGAGCACGCCTACCTTTGATGTACAGCCTATAGCCAGGTGCGGGTG
  5   1   3        nb TpA  5x3  out                  TTpA005f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCAAACGACTCAGCTGTAAAACTGGTCTTTTACTGGGGGACGGCCAAGAACCGATACCAAATGGAAATTCCCGAGAGTGTTACAGAGCGTAACCTGCCGGAAGAGTATGAATTAAAATCGACAAAAAAAGGATACAAGCGCTACTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGATGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATG
  5   1   3        nb Egg                            TEgg112b23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGGACTAAAGCAATTGAAAAGATGTTTGGAGACCTCGCGAACGCAGAGGAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCACTACAGCCAAGGTGGTGATGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGA
  5   1   2       add Gas                            TGas071b01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCCATCGATTAAAACCCCCCCGGGGGAAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCATTACAGCCAATGTGGTGATGGGCC
  5   1   3        nb Gas                            TGas071l06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAACGGCGGGATGCCGCTCTTAAAGACTGTATGAGGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGATGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAAGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCATGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGTGAAAGCACATTTTTTGTGGAATTGAGTGAAA
  5   1   3        nb Ova1      in                         CABE5967.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTCTTAAAGACTGTATGACGAGGCTCTTCTATAACTTTGATAAAAACTACAAAGAATGGCAGACTGCTGTGGAATGCTTTGCGGTATTAGATGTCCTCATAAGTTTATCTCAGTACAGCCAAGGTGGTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGTAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGGTGTTAAGGAACTCTCTCAAAGTGTCAAATGGC
  5   1   3        nb Tbd1      in                         CBXT4788.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGACGGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAG
  5   1   3        nb Gas7      in                         XZG44875.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCCCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTAAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAGTGCTCCATACCTGCTGAGGTGC
  5   1   3        nb Egg       in                   TEgg027j07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCAGTCTGCAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAA
  5   1   3        nb Ova1      in                         CABE2232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGACCGGTGATTGTGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCCAAAAGCAAGAGAATTTGAAAGCATTACGGT
  5   1   2       ext Egg       in                   TEgg034a13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTACAGGACAACCATTTGCCATTTTTGGAGCTGAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCG
  5   1   3        nb Gas7      in                         XZG49940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAGGTTCTCGACATCCCTGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCCCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTAAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAAT
  3   1   2       add Gas       in                    TGas135p10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCATTACAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGAATCCACACGGGTATGATCTAATAAACTTTATTTTTAAAAAAGAAAAAAAAAAA
  3   1   3        nb Gas       ?                     TGas136k18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATACAAAAAACCTTTTTTGGGGATGATTTCATTCCAAATGACATTCTCATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTAAAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG49255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGACATTCTCATTGGCTGTAGGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTNTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTAAAAAAAAAAAAAAAGG
  3   1   4      seed Te4  5g3  in                         CAAN4267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTT
  3   1   2       ext Tad5      in                         XZT43448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGCTGTAAGGAGGAGGACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTNTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTT
  3   1   3        nb Gas8 5g3  in                          st25l21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTAAGGAGGAGGACTNTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACT
  3   1   3        nb Ova1      in                         CABE5967.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACTCTGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATG
  3   1   3        nb Ova1      in                         CABE2232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATG
  3   1   2       ext Egg       in                    TEgg059b18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTTTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTTTACACACTACCACTTTTTGGTGGAGGATTACTTTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCCCCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTTTTCAGAGAGCTGAATTTCTTGCTGGACAACCCTTCCTTTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCAAAAAGGCTGCGTTCCAACCCGGGTATGATCTAATAAAACTTTATTTTTTAAAAATGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg034a13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Te5       in                        CAAO10332.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGACAGCAGCGATGAAGCTCACTGTGTGCTGTCACAGGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATG
  3   1   2       ext Tad5      in                         XZT44131.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGACAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTNTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATCCTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATG
  3   1   2       ext Limb      in                        CBSU1126.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCAGCGATGAAGCTCACTGTGTGCTTGTCACAGGGCCAAACATGGGAGGAAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTT
  3   1   3        nb Gas7      in                         XZG44875.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTGTGCTGTCACAGGGGCCAAACATGGGAGGAAAGTCAACCCTTTTAAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTT
  3   1   2       ext Gas7      in                         XZG31805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGCCAAACATGGGAGGAAAGTCAACCCTTTAAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTT
  5   1   3        nb Gas7                                 XZG13923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACATGGGAGGAAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTTTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTTAAAATGACAAANAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG45732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTCAACCCTTTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTTTACACACTACCACTTTTTGGTGGAGGATTACTTTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCCCCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTTTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGG
  3   1   2       ext Gas7      in                         XZG20559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGAGACAGGCAGGTCTCCAGGTTGTTATGGCACAGCTGGGATGTTACGTGCCGGCAGAGTCTTGCAGACTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATG
  3   1   3        nb Egg       in                    TEgg027j07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGGCACAGCTGGGATGTTACGTGCCGGCANGAGTCTTGCAGACTGACTCCCGTAGACNNCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG46469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGACTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTT
  3   1   3        nb Egg       in                    TEgg001n15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCCGTAGACCGGGTGTTTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg017f19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTACACGACTGGGTGCATCTGACCGAATCATGGCAGGTGAAAGCACATTTTTTGTGGAATTGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tbd1      in                         CBXT4788.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACGACTGGGTGCATCTGACCGATCATGCAGTGAAAGCACATTTTTGTGGAATGAGTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTTTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG49940.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAATCATGGCAGGTGAAAGCCCATTTTTTGTGGAATTGGGGGAAACCTTTAGCATTTTGCAGCATGCAACAGAACATTCCCTTGTGGTTTTGGATGAACTTGGAAGGGGCCCGGCTCCCTTTGATGGTACAGCTATAGCCCGTGGGGTTGTTAAGGAACTTTTTCAAAGGGTCAAATGCCGAACTTTTTTTTTTTCCCCCTACCCCTTTTTGGGGGGGGGTTTTTTTCACAGCCCGGCTGTTCCCCTTGGGCCCATGGCATGCATGGTGGAAAATGAGTGGGGGGGTCCAAGCCCGGGGGCCCTCCCGTTCCTTTTCAAGTTCATTAAAGGGGGTTGTCCTAAAAGCTTTGGGTTTAATGGTGCAAGGGTGGGTCCCCTTCCTGGTGAAATTTTCCCGGTTGGCCCCCAAAAAGCAAGGGATTTGAAAGCCTTTCGGTTTCCCTCAGGGTTTTCAGAGAGGGGAATTTTTTGGTGGGCAACCCTTCCTTTGATGGCCAAGGGCTCCATAACCTGGGGAAGGGGGTCCAATAACATGTCCCAATGCCCCTGCTGTTTGGGGGGGTTTTTTCCCAAGGGTGGGTTCCCCCCGGGTATGATTTAATAAACTTTTTTTTTTTAAAAGGG
  5   1   3        nb Gas7      in                         XZG28742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGAAACCTCTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGAAAAANAAAAAAAAAAAAAAA
  5   1   2       ext Gas7      in                         XZG15365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAGCATACTGCAGCATGCAACAGAACATTCCCTTGTGCTTCTGGATGAACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACTCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG59041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGTTTTGGATGACTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGACCATATTTCCATTTTTTTTCTTCCCTAGGAAATTAAACTTTTTTTTTTTGTTTGTTTAAATTCATACCTACCCTCTACATAATGGTTATTGAATACTCCACAATATATTAAGTCTAGATGTTATGGTACATGCATACACTTTCAGGCTGTTTGATTACCCACTGTCACCAATACATAGAAATGGGGGGGAAAAACAGAAAGCAATGGAACGGGTATAGAAAAT
  3   1   3        nb Tad5      in                         XZT64657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATGAACTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATG
  3   1   3        nb Te4       in                         CAAN8804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATG
  5   1   3        nb Te4       in                         CAAN8804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTGGAAGAGGCACGGCTACCTTTGATGGTACAGCTATAGCCAGTGCGGTTGTTAAGGAACTTTCTCAAAGTGTCAAATGCCGAACTTTATTCTCTACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACCCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTTAAAAATGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG15365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACACACTACCACTCTCTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCACATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCACCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATCTCTTGCTGGACAACTCTTCCTCTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCACCCGGGTATGATCTAATAAACTTTATTTTTTTAA
  3   1   3        nb Gas7      in                         XZG28742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTGGAGGATTACTCTCACAGCCAGGCTGTACGCCTTGGGCCCATGGCATGCATGGTGGAAAATGAGTGCGAGGATCCAAGCCAGGAGACCATCACGTTCCTTTACAAGTTCATTAAAGGAGCTTGTCCTAAAAGCTATGGATTTAATGCTGCAAGGCTGGCTCACATTCCTGATGAAATTATCCAGGTTGGCCCCCAAAAAGCAAGAGAATTTGAAAGCATTACGGTTTCCCTCAGGCTCTTCAGAGAGCTGAATTTCTTGCTGGACAACCCTTCCTTTGATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCTGCGTTCCCCCCGGGTATGATCTAATAAACTTTTTTTTTTAAAAATGG
  3   1   3        nb Gas       in                    TGas060c23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGGCCAAGTGCTCCATAACCTGCTGAAGGTGCTCCAATAACATGTCCCAATGCCACTGCTGTTTGTGTGTGTTTATTCACAAGGCNTGCGTTCCACACGGGTATGATCTAATAAACTTTATTTTTAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)