Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Found    GroupLinked Group     Identified Blast Description.
     1   0.0    0Xt7.1-CABJ3470.3                          424 FAM     30        537      551                Ubiquitin C [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 193.0    0Xt7.1-XZT48984.5                          499 PI      83        149      348                ribosomal protein S27a [Xenopus tropicalis]
     31175.0    0Xt7.1-CABJ11931.3                         425 PI      84        833     1971                Ubiquitin C [Xenopus tropicalis]
     42781.0    0Xt7.1-CABJ3470.3                          424 PI      95        377     2088                Ubiquitin C [Xenopus tropicalis]
     5 206.0    0Xt7.1-XZT43557.5                          293 PI      84        376      579                ubiquitin [Branchiostoma belcheri]
     6 873.0    0Xt7.1-CABJ12119.3                          28 PI      83        377     1287                ubiquitin C [Gallus gallus]
     7 261.0    0Xt7.1-TGas062m01.3.5                        5 PI      86        377      603                ubiquitin/ribosomal protein S27a fusion protein [Branchiostoma belcheri tsingtaunese]

 This cluster: approximate FL confidence score = 97%

 1012192393 Xt7.1-XZT3753.5 - 993 ESTs
                                                                       ...-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-XZT3753.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTATGTAAGGCATGGATGTAAAGCCTGGAGAGAGAGTACCACTTCTGAAGTCTGCGCCCTTTGTTCTTGTGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAAACACTGACAGGGAAGACCATTACTCTTGAAGTAGAGCCAAGTGATACCATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGAATCCCTCCTGACCAACAGAGATTGATTTTTGCTGGCAAGCAATTGGAAGATGGCAGAACCCTCTCAGACTACAATATTCAAAAAGAATCCACCCTGCACTTAGTTCTACGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCTTAACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGATTACAACATTCAGAAAGAATCCACCCTGCACCTGGTCCTGCGTTTGAGGGGTGGGGTTTAAAACAATCATTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008298326                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGGCATGGATGTAAAGCCTGGAGAGAGAGTACCACxxxTxAAGTCTGCGCCCTTTGTTCTTGTGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAAACACTGACAGGGAAGACCATTACTCTTGAAGTAGAGCCAAGTGATACCATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGAATCCCTCCTGACCAACAGAGATTGATTTTTGCTGGCAAGCAATTGGAAGATGGCAGAACCCTCTCAGACTACAATATTCAAAAAGAATCCACCCTGCACTTAGTTCTACGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCTTAACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGATTACAACATTCAGAAAGAATCCACCCTGCACCTGGTCCTGCGTTTGAGGGGTGGGGTTTAAAACAATCATTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         3     7     3     7     3     8     3     8     4    11     4    12    17    31    62    78   134   159   199   232   266   296   289   317   318   340   329   348   334   357   354   360   356   361   358   362   359   363   359   363   355   362   359   366   360   368   361   368   360   368   366   371   365   373   372   375   370   377   373   378   373   380   376   383   381   390   379   390   379   390   377   390   383   394   381   394   378   392   378   392   385   396   383   397   389   399   374   401   383   400   385   400   386   401   385   401   387   404   384   402   389   403   389   405   387   403   381   402   380   400   376   400   376   397   344   383   363   383   358   380   359   375   346   371   340   368   347   366   341   360   334   359   323   355   322   352   303   337   303   332   290   328   279   307   260   305   243   295   234   285   225   272   189   243   167   214   168   206   158   193   157   190   151   176   145   166   147   165   143   159   143   157   141   157   140   153   141   152   149   156   147   155   148   160   152   162   155   166   158   165   150   164   156   168   159   174   163   180   175   192   172   192   176   197   180   201   181   207   190   212   204   229   210   232   257   282   284   310   293   319   330   348   346   365   362   380   390   401   403   413   416   426   409   433   424   438   440   450   442   454   453   464   446   468   463   476   465   483   463   483   450   473   463   480   461   481   458   479   466   477   453   479   447   478   462   479   451   467   443   464   443   464   458   466   429   465   446   465   441   465   429   461   437   455   423   456   430   452   417   447   437   449   441   452   441   451   427   450   440   450   414   448   430   445   433   440   427   440   416   440   428   438   417   437   421   434   406   429   392   426   411   426   415   426   410   426   398   422   408   420   387   416   369   406   355   388   328   364   275   348    71   147   111   119    31    35    11    12
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---A-----T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---C--A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        T-----------
                                               BLH ATG     148    1951                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN     148     279                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR     148      50                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               CDS MIN     148      60                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               EST CLI      87      60                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG     148      12                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Sc ==== 0          NP_013061.1 involved in stress response system; Ubi4p [Saccharomyces cerevisiae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Dr ==== 0          NP_001071272.1 hypothetical protein LOC777766 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ce ==== 0          NP_741157.1 ribosomal Protein, Large subunit, ubiquitin (94.0 kD) (ubq-1) [Caenorhabditiselegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 0          NP_062613.2 ubiquitin C; polyubiquitin C [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 0          NP_066289.2 ubiquitin C [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 0          NP_728908.1 CG11624-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xl ==== 0          AAH54976.1 Unknown (protein for MGC:64478) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 0          NP_001080865.1 ubiquitin C [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          AAH74652.1 Ubiquitin C [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-XZT3753.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAG---------------------------TGA------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   1           Tbd0 FL                     IMAGE:5335302.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAAACACTGACAGGGAAGACCATTACTCTTGAAGTAGAGCCAAGTGATACCATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGAATCCCTCCTGACCAACAGAGATTGATTTTTGCTGGCAAGCAATTGGAAGATGGCAGAACCCTCTCAGACTACAATATTCAAAAAGAATCCACCCTGCACTTAGTTCTACGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCTTAACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGATTACAACATTCAGAAAGAATCCACCCTGCACCTGGTCCTGCGTTTGAGGGGTGGGGTTTAAAACAATCATTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu128o12.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAAACACTGACAGGGAAGACCATTACTCTTGAAGTAGAGCCAAGTGATACCATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGAATCCCTCCTGACCAACAGAGATTGATTTTTGCTGGCAAGCAATTGGAAGATGGCAGAACCCTCTCAGACTACAATATTCAAAAAGAATCCACCCTGCACTTAGTTCTACGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCTTAACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGATTACAACATTCAGAAAGAATCCACCCTGCACCTGGTCCTGCGTTTGAGGGGTGGGGTTTAAAACAATCATTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAA
  0   1   1           Egg  FL                     TEgg052p01.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAAACACTGACAGGGAAGACCATTACTCTTGAAGTAGAACCAAGTGATACCATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGAATCCCTCCTGACCAACAGAGATTGATTTTTGCTGGCAAGCAATTGGAAGATGGCAGAACCCTCTCAGACTACAATATTCAAAAAGAATCCACCCTGCACTTAGTTCTACGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCTTAACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGATTATAACATTCAGAAAGAATCCACCCTGCACCTGGTCCTGCGTTTGAGGGGTGGGGTTTAAAACAATCATTATGCATCTGCTCTGCATTACTTGCTTGTTGCACTTTGTTTCAATAAAGCTATTGCATTCCAAAAAAAAAAAAAAAAAA
  5   1   1         - Liv1      in                        CAAR11326.5p AACCTCAACATAGACCACCACCAACCACATCAGTATACCCTCTGAGTAAACATGCTTGCCACCAACAACAGATCACTTTAATATGCACTAAAATAATAATGCCGCTGCAATACATTGTTATTGATTTATTGTAACAAACTGTATAGCAACATTCATGTTCTCATTTTTGTTGTCTTGTTTGACTTTTGTAAGTCAAATAAAATTTACCTTTATAAAAAAAAAAAGTGGAGTGAAGCATTGCTGGTGATGATGCCCGGGGCGGCCGGTTAGCAATTGGATTTCAACAAGAAGATGTTGCTCATTGCAGCCATTCAGATGCTTTTGTTTTTCTtgttgaaatctagttgctgatttgttgcccttggaggcatcaccagtggtgcttcactcaactctttacacagcatgataaatataATCCTAACGCTGTCACCAAGCAGCTAGTGGAACATGTGATGGGGAGGAAAATAAAAGTTATTTTTTACAGCTTAAATTCTAAAAGCGTTCTCATTATTTTTGAAATACTATTTAAAAATCATAACTTGTAAAGATCAATTAACTCCTAAATCTGTTTCAAATTTCCTAGCATTGCTTGGTTAGTAGGATACATGGGGGCCCTAGCAACTAGATGGTTTAAATTCCAAATTTAAGAACTGCAGTTACATTTGACTGTAGCAGAGGGAGTTTAATATGTATGTTTTAGTCTGACTATATGGGTTAACTTCCAAGAGAGACTAGCTTTTGAGGTTAGCTAATTGTCAGAATCCTCAGGGGACTAGATCATACAGGCACTTAAGATACGTATAAGCTGTTTTGTAAAACTGGCTGCATTTGTAAGCAT
  3  -1   1       chi Spl2 5x3  out                       CBSS7124.rev                                                                                                                                                                                                                                                                                                                CTTCTGTTTAATTATGAGCAAGTCCTGGTCAACAGCACAACTGTCTCCCTTTTTGCCCTTATGTTTCTTCCTCCAGCCCTTTTTTAAGCAAATTTTTCTTGTCTTCCTTGAACAGGTTGCTGCCATCATGCTTCTTTGAAGATTTTTTATACTTTAAGTAATCATTGGGGCGTCCACGGGGGAAATCCTCCTCTGTTTCTTGAAGGCCAGATCTTTTTTTCTTACGCTTCTTCATTTGCTTTGTCTCTGCACATTCTTCATCCATGAGGGTACCCTGCTTCTTTTTTTTACTAGGACGTTTCTTTTTCCTTCTCTTGGCAGGTGGCTTAGCATCTTCCTTGCTTTCGTTGTGTTCCCCTATCTCCCATGTCAAAAGGCCTGCTTCCTGGAGATCTTTAATCTTGCTTTTTGCTCGTTCATTTCTTTTCCAGATATCATGTTCACGGTCATAAGTAAACACAAGCTGACAGGTAGGGAAGTTGTCACTGTGCGGACGCGTGGGCTTTAGCAACGGTGCAGCTTGAAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCA
  5   1   1   15    - Gas7 5g3  in                         XZG32297.5p .......................................................................................................................................................................................................................................................................................................................................................................................................CTTTACACAGCATGATAAATATAATCCTAACGCTGTCACCAAGCAGCTAGTGGAACATGTGATGGGGAGGAAAATAAAAGTTATTTTTTACAGCTTAAATTCTAAAAGCGTTCTCATTATTTTTGAAATACTATTTAAAAATCATAACTTGTAAAGATCAATTAACTCCTAAATCTCTAGTTTCAAATTTCCTAGCATTGCTTGGTTAGTAGGATACATGGGGGCCCTAGCAACTAGATGGTTTAAATTCCAAATTTAAGAACTGCAGTTACATTTGACTGTAGCAGAGGGAGTTTAATATGTATGTTTTAGTCTGACTATATGGGTTAACTTCCAAGAGAGACTAGCTTTTGAGGTTAGCTAATTGTCAGAATCCTCAGGGGACTAGATCATACAGGCACTTAAGATACGTATAAGCTGTTTTGTAAAACTGGCTGCATTTGTAAGCATGTTAATAATTTTTTCTTTTATTTACAGAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCCTTGAGGTGAGCCCAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGAC
  5   1   1         - Abd0 5g                            IMAGE:7016319                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCATTTTGTATGCAGCTGTTCGTACGCCAAAGTCATAACTTTCATTCAAATAACAGAAGCTTGCGGTGAAGTACATACTTATGTCAATCTTACAGTTTAATTCAGACACATACTAAGGTAACGGAATTTTTTGCTAGCATCTTTGCGACACTGTTGTGCCGTTTCACGCGTATTAAAAAAAAAAAAAGTCCCTGTTATCGGCCACCTCGGAAGGATATACCAAGGACGTAAATAAAGTCTGCGCCCTTTGTTCTTGTGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGAATGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGAACTACACATTTCAAAA
  3   1   1         - Te4       in                        CAAN11038.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTAACAGGCTGTGTTAAGAAAAAAAAAGCAAGACCTTTCTTTTTATGTAAGGCATGGATGTAAAGCCTGGAGAGAGAGTACCACTTCTGAAGTACTGGAATTTGGAGAGGAGGGAGAGACATCTAGATAATGAGACTTTATGATTGATGATGACTGGGACAGCAGAGAAAATATAAAGCAAGTACAGAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAAGGTAAAAGC
  5   1   1         - Te4       in                        CAAN11038.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTAACAGGCTGTGTTAAGAAAAAAAAAGCAAGACCTTTCTTTTTATGTAAGGCATGGATGTAAAGCCTGGAGAGAGAGTACCACTTCTGAAGTACTGGAATTTGGAGAGGAGGGAGAGACATCTAGATAATGAGACTTTATGATTGATGATGACTGGGACAGCAGAGAAAATATAAAGCAAGTACAGAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAAAAAAAAAAAA
  5   1   1   14    - Te5  5g3  in                         CAAO9886.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTTTCTTTTTATGTAAGGCATGGATGTAAAGCCTGGAGAGAGAGTACGACTTCTGAAGTACTGGAATTTGGAGAGGAGGGAGAGACATCTAGATAATGAGACTTTATGATTGATGATGACTGGGACAGCAGAGAAAATATAAAGCAAGTACAGAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTTGCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTC
  5   1   1   24    - Te3  5g                             CAAM14348.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCACCTCGGACGGATATACCAAGGACGTAAATAAAGTCTGCGCCCTTTGTTCTTGTGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAAACAAGTGAC
  5   1   1   24    - Te5  5g                             CAAO10152.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTAAATAAAGTCTGCGCCCTTTGTTCTTGTGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTTTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGA
  5   1   1       chi Tad5 5g3  in                         XZT53607.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATAGGTTATATTAGTTAGTTGCTTAATGTATACGTGTATCTCCGCTTGATTTTGATGTATCTGGACCGTTGTATATATAAGTACATTGGGCCGTCTTTTAACGAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTC
  5   1   1   14    - Te5  5g3  in                         CAAO2008.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAATAAAGTCTGCGCCCTTTGTTCTTGTGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGC
  3  -1   1         - Te1       out                        CBWN9944.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGTGATCTAGAACTAGGTGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAA
  5   1   1         - Gas1 5g                            IMAGE:6988406                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTCTTGTGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTTGTCAAGAACCCTGACTGGGGAAGACCATTTACTCTTTGAAGTTTGAGCCCAAGTGAACCCAATTTGAGGAATGTGGAAG
  5   1   1         - 1030 5g                         IMAGE:7093404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCCCCCGGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAAATGTAAAGCAAAATTTCAGACAAAGAAGTATTCCTCCGACAGCAAGATTGATCTTGGCGGAAGCGCTGG
  5   1   1         - 1030 5g                         IMAGE:7091956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCCCCCGGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGGAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAGTGACACAATTGAAATGTAAGGCGAAATCCAAGATAAGGAGG
  5   1   1         - Gas1 5g                            IMAGE:6986681                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGGGCCTGGGTACCGGGGTCCGGGAATTCCCGGGGATGTAACTGGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCT
  5   1   1         - Gas1 5g                            IMAGE:6988893                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATTGCCCGGGGATCTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGGAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTT
  5   1   1         - 1030 5g                         IMAGE:7029501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCCCCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAAAAATAACCCTTTGAGGTTGAACCAAGTGACACCATTGAAAAATGTAAAAGCAAAAATTTCAAGACAAAGAAAGGATTCCCTCCCCGACCAGCAAAAGATTGATCTTTTGCCCGGAAAGCAACTGGGAAAATGGCCGGCACCCTTTCTCTGAATTCCAACATTTCCAAAAAGAAATCCCACACTTGCACTTGGGTTTCTTTCGCTCTACAAAAGGTGGGGAATGCAAAATTTTTTGGTCAAGGACCCCCGGACAGG
  5   1   1         - BrSp 5g                           EC2BBA8AB08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGC
  5   1   1   22    - Tad5 5g                              XZT26724.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACNACATTCAGAAAGAATCCACACTGCACTGGGTTCTTCGTCTC
  5   1   1         - Te5       in                         CAAO8113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACT
  5   1   1         - Te5       in                         CAAO9128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1   10    - Limb 5g3  in                        CBSU3539.fwd ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTCCGCTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAGAATGTGAAGGCTAAAATACAGGACAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTCCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACCATTGAAAATGTAAAGGCCAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGTTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCA
  5   1   1         - BrSp 5g3  in                     EC2BBA21DB04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAGAATGTGAAGGCTAAAATACAGGACAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTT
  5   1   1         - BrSp 5g3  in                     EC2BBA33CF02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAGAATGTGAAGGCTAAAATACAGGACAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCCAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCT
  5   1   1         - HeRe 5g3  in                     EC2CAA10AH09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAGAATGTGAAGGCTAAAATACAGGACAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTCCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACCATTGAAAATGTAAAGGCCAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGTTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGTATTCCT
  5   1   1         - Te5       in                        CAAO12563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCNAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1         - Te5                                  CAAO8740.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACT
  5   1   1   22    - Tad5 5g                              XZT65294.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCTACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGA
  5   1   1       chi 1030 5x                         IMAGE:7092477.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCCCTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCCGAATTTTTGTGAAGACCCTAACTGGGAAAACCATTTACCTTTGAGGTTGAACCAATTGGATCTTTTGGAAAAGTGTAAGGCAAAAAATCCCAAAAAAGGAAGGGTTTCCCCCCTGACCACCAAAAAATTTTTTTTTTTCCGGGCAGCCCCCTGGAAAAAAGGGCCCACCCCTTTTTTTAAAAAAAAACTTTAAAAAAAAAACCCCCTTGGCCCTTTTTTTTTTCCTTCCAAAGGGGGGGAGGAAAAATTTTTTGGAAAACCCCCGGGGGGGGAAAAAAAAAACCCCTTGGGTTTAACCCATGGTCCCCTTTTTAAAGTTAAAAGCAAAAATTTTACAA
  5   1   1       chi 1030 5x                         IMAGE:7027501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGATAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGTAGAGATTGATTTTTGCTGGCAAGCATCTGGAAAATGGTCGCACTCTTTCTGACTACAACATTCCAAAAGAATCCACCTTGCACTTAGTTCTTCCCCCCAGAAGTGGGATGCACATACCTGTGCATACCCCGCCCGCTCCAACAACAATCCCTTGAGGCTGCATCCCCGAGGATTCCCATTCAAATAGCGAATGCCGACATCCCCCAGATTACGGACCGTTTTTTCCCCCCCCACCCATAAAAAGAAGTGATCCTTTCGTCTGGGAATAGCCTGCCTGGAAAAATAGGGCCCTAACAACCCTCCCCTGGAATTTACCCCCCCCCCCCTAAATTGAACCGCCATACCATGCGCCATTGCGGTTTCATTTCCTTCCCGCCGTGAAAGCGTGGTGGAAATCGCACCCAATATTGTTTTGTTTCCCCCCTACCGCCTGCTTTATTGGGCGC
  5   1   1         - 1030 5g                         IMAGE:7092515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCNAGATAAGGAAGGTATTCCNTCCGACCAGCAGAGATTGATCTTTGCTGGGAAGCAGCTGGAAGAGGGCGCACACC
  5   1   1         - 1030 5g                         IMAGE:7094722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAACAATAACCCTTGAGGTTGACCAAGTGACACCATTGAAATGTAAAAGCAAAATCAAGACAAGAAAGATTCTCCCGACAGCAAAATGATCTTG
  5   1   1   22    - Gas7 5g                              XZG48584.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTTGAGTTGAGCCCAGTGACACAATTGAGAATGTGAAG
  5   1   1         - 1030 5g                         IMAGE:7093492.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGNATCTTGCTGGAAGCAGCTGGAAGATGGCGC
  5   1   1         - Neu  5g3  in                   TNeu053g17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGCTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAA
  5   1   1         - BrSp 5g3  in                     EC2BBA32DF05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAGAATGTGAAGGCTAAAATACAGGACAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCCAAAATCCAAGACCAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Egg       in                   TEgg007l24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCG
  5   1   1   10    - Liv1 5g3  in                         CAAR3335.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCTCGATTCAATCGGCACGAGGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAAT
  5   1   1   22    - Tad5 5g                              XZT25020.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGA
  5   1   1   12    - Tad5 5g3  in                         XZT68075.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGNAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTG
  5   1   1         - Neu  5g3  in                   TNeu095c08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTC
  5   1   1         - Neu  5g3  in                   TNeu119e22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGAGCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGC
  5   1   1         - Gas1 5g3  out                      IMAGE:6989722                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGGTCTTCGTCTCAGAGTGGGATGCAGATTTNTGTCAGGC
  5   1   1         - Te5       in                         CAAO7438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCA
  5   1   1         - Neu  5g3  in                   TNeu114d13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTAGCAACAGGTGCATGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAA
  5   1   1       chi Abd0 5x3  out                      IMAGE:6999336                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGNCAACAGCTGGAAGATGGCCGAACCNTATCAGACTANTACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCGNTTGAGAGGTGGGATGCANATATTTGTGAGACCCTGACTGGGAAAGACATTTACCCTGAGGGTGAGCCAGGGATACTTTGAAAATGGAAAGGCAAAATCAAAAACAGGAAGGCTTCCCCCTGACAACAAAATTGATTTGCTGGAACCCTTGAAAAGGCCCCTCCTTTTGAATAAATTTAAAAAAACCCCTTTCCTTTTTTTTCCTCCCAAGGGGGGCCAATTTTTGGAACCCCCTG
  5   1   1         - Neu       in                   TNeu066m14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGGGCCCGGGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAA
  5   1   1         - Gas1 5g3  in                     NISC_mq04g08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGAC
  5   1   1         - Te5       in                         CAAO9198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGGAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1   22    - Gas7 5g   ?                          XZG27465.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTTTAGCAACGGTGCAGCTTGGAGGTAACTAGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTAGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGACAACCCTGACTGGGAAAACAATAACCCTTGAGGTTGAA
  5   1   1         - Gas  5g                        TGas125f13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAG
  5   1   1         - Tbd0 5g3  in                       IMAGE:6977732                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAAAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAAGTGAGCCCAGTGACACAATTGAGAATGTGAAGGGCAAAATCCAAGATAAGGAAAGCATTCCCCCTGAACAGCCAGAGTTTGATCTTTGCAAGGCAGACACTGGAAAGATGGCAAAAACCTGTCCGATTAACATATTCACAAAGAATCCACCCCTACATTTGGGTCCTTCGGCCCCCAAAAGTGGGGAGGCGAAAAATTTC
  5   1   1         - Neu0 5g3  in                       IMAGE:6991377                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGGAAGACATTTACTCTTGAAGTTGAGCCCAGTGACACAATTTGAGAATGTGAAAGCAAAAAATCCAGATAAGGAAGGCATTTCCCCCTGACCAACAAAGGTTGATCTTTGGCAGCAAGCAGCTGGA
  5   1   1         - Neu0 5g                            IMAGE:6994229                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGGAAAGGATCCCACACTGCACTTTGGTTCTTCGTCCTCAAAGGTGGGGATGCAAGATTTTTTGTCCAGAACCCCTGACTGGGGAAAAACCCATTTACTCCCTTGGAAGATTGAAACCCCCG
  5   1   1         - Neu0 5g                            IMAGE:6994336                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGGAAGACATTTACTCTTGGAATTTGAGCCCCAGTGACACCAATTGAAAAATGTGAAAGGCAAAAAATCCAAGGATAAAGGAAAGGCCATTCCCCCCTGTACCAGGCAAAAAGGTTGGATCCTTTTGCCA
  5   1   1         - Neu0 5g                            IMAGE:6994349                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCATGCACGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAGAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACCATAACCCTTGAGGTTGAACCAAGTGACACCTGTTGATATGTAGAAGCAAAGATTCCAGACGAACAACGTATTCCTCCCGACCAGCAGAGATTGATCTTTGACCAGAAAGCAGCTGCGAAGATGGGCCGCACATCTCTCTGATTACAACTATTCAAAAAGAAATCCACACTTGCACATTGGGTCTTCAGTCTCAAAAAGTGGGATGCCACATTTTTTGATCAAGAACCCTGACTGGGAAGGACCATTTACGCTTTGAAGTTAGAGCCCAGTGGACACAATTTGAGAATGGTGAAAGGCTCAAAAACCCTCGAAAAAGGTAAGGGCATTTCCCCCTGGACCCAGCAAAAAGGTTGGATTCCTTTGGCAAGGCAAAGCGACCTGGGAAGCATGGGGAACAAACCGCTTGTCA
  5   1   1         - Neu0 5g3  in                     NISC_ng04c11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCT
  5   1   1         - Neu0 5g3  in                     NISC_ng09e07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTG
  5   1   1         - Neu0 5g3  in                     NISC_ng23a09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAAT
  5   1   1         - Tbd0 FL   in                    IMAGE:5335302.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAG
  5   1   1         - Gas  5g                        TGas012l04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGT
  5   1   1         - Neu  5g                        TNeu013j11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAAGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCT
  5   1   1         - Neu  5g                        TNeu042d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGT
  5   1   1   14    - Brn4 5g3  in                        CAAL22055.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGAGCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGG
  5   1   1   14    - Brn4 5g3  in                        CAAL22474.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGG
  5   1   1         - Te5       in                         CAAO2905.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCCGACAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTT
  5   1   1         - Te5       in                         CAAO5426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCCAGA
  5   1   1   14    - Te5  5g3  in                         CAAO6031.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTTGAGTTG
  5   1   1         - Te5       in                         CAAO7726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATNTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCTCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCA
  5   1   1         - Te5       in                         CAAO8095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAAT
  5   1   1   12    - Gas7 5g3  in                         XZG19633.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCACAGGTGGGATGCAAAAATTTGACAAGACCCTGCCTGGGAAAACAATAACCCTTTGGGGTTGAAAC
  5   1   1   10    - Te1  5g3  in                        CBWN12026.b1 .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAA
  5   1   1         - Gas  5x3  out                  TGas090k23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCCAATATTTGTGAACACCCTGACTGGTAAAACAATAACCCTTGAGG
  5   1   1         - Gas1 5g3  in                       IMAGE:6990094                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTAGCACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTCTGCCGGAAACCGCTGGAAGATGGCCGCACACTCTCTGATTACAACAGTCAGAAAGATTCACACTGCACTTGGTTCTTCGTCTCAAAGGTGGGATGCAGATTTTTGTCAGACCCTGACTGGAAAAACATT
  5   1   1         - Neu0 5g                            IMAGE:6994641                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAAGATCCACACTGCACTTGGTTCTTCGTCTCAAAGGTGGGATGCAGATTTTTTGTCAAGACCCCTGACTGGGAAAGACCATTAACTCTTTGAAAGTTGAAGCCCAAGTGNACACAAATTG
  5   1   1   22    - Tad5 5g                              XZT70696.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTAGCAACGGTGCAGCTTGGAGGTACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTG
  5   1   1         - Gas1 5g                            IMAGE:6989513                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACACATTCAGAAAGAATCACACTGCACTTGGTTTCTCGTCTCAGAAGTGGGATGCAGATTTTTTGTCAGACCCTGACTGGGNAAGACATACTNNCTGAGTTGAGCCAGTGACACATTGAGATGTGAAGCAANATCAGATANGAAGCATCCCTGACAGCAAGTGATTT
  5   1   1         - TpA  5g3  in                   TTpA036o22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGCAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAAATCCAGATAAGGA
  5   1   1         - TbA  5g3  in                   TTbA028n23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGCAACGGTGCAGCTTGGAGGTAACTGGCTTAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGAC
  3   1   1         - Neu       in                    TNeu066m14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCCTGACGTGGTAAAACCAATAACCCCTTGAGGTTGAACCCAAGTGACACCATGAAAATGAAAAGCAAAAAAAAAAAAAAAAAA
  5   1   1         - Tbd0 5g3  in                     NISC_nl06a06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGATGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAG
  5   1   1         - Gas  5g                        TGas038c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACGGTGCAGCTTGGNGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGNGAANACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATC
  5   1   1         - Te5       in                         CAAO5506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCACGCGTCCGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGC
  5   1   1   22    - Gas7 5g                              XZG41834.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGTTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1         - Gas  5g                        TGas099f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATT
  5   1   1         - Gas1 5g                            IMAGE:6987153                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCAACACTGCACTTGGGTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAGTTGAGCCA
  5   1   1         - Gas1 5g                            IMAGE:6987355                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTTGTCAGACCCTGACTGGGAAGACCATTACTCCTGAAGTTGAGCCCAGTGACACAATTGAGAATGTTGAAGCCAAAATCCCAGATAAAGAAAGCATTCCCCCTGACCAGCAGAAGTTGATCTTTGCAAGCAAGCAACTGGAAAGAGGCCAGAAACCTGTCCGAATACAATATTCAGAAAAGAATCCACCCCTACATTTGGGTGTCTTCCGTCTCCAGAGGTGG
  5   1   1         - TpA  5g3  in                   TTpA073i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACGGTGCAGCTTGGAGGTAACTGGTTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAACTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTT
  5   1   1   24    - Brn4 5g                             CAAL20800.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAA
  5   1   1   14    - Brn4 5g3  in                         CAAL6154.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAA
  5   1   1   14    - Brn4 5g3  in                         CAAL8030.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCCCAGTGACACATTTGAGAATGTGGAGGCAAAAATCCAG
  5   1   1   14    - Brn4 5g3  in                         CAAL8193.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGC
  5   1   1   14    - Te5  5g3  in                        CAAO11291.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGC
  5   1   1   14    - Te5  5g3  in                         CAAO2217.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACATTTGAGATGTGAAGGCAAAAATCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Te5       in                         CAAO2446.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGG
  5   1   1         - Te5       in                         CAAO5322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAG
  5   1   1         - Te5       in                         CAAO7730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCTAAGATAAGGAAG
  5   1   1   14    - Te5  5g3  in                         CAAO9756.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1   12    - Gas7 5g3  in                         XZG22441.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCG
  5   1   1   12    - Gas7 5g3  in                         XZG23257.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAA
  5   1   1   12    - Tad5 5g3  in                         XZT18105.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATC
  5   1   1         - Gas1 5g                            IMAGE:6988914                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGAATACAACATTCAGAAAGAATCACACTGCACTGGTTCTTCGTCTCAGGGTGGGATGCAGATTTTGTCAAGACCTGAT
  5   1   1         - Neu0 5g3  in                       IMAGE:6991937                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGGATTGAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAAAATGTGAAGGCAAAAATCCAAGATAAAGGAAGGCATTTCCCCCTGAACAACCAAAAGTTGATCTTTGCAGGCAAGCCACTGGAAGATGGGAGAACCCTG
  5   1   1         - Neu0 5g                            IMAGE:6993425                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAGTTGAGCCCAGTGACACAATTTGAGATGTGAAGGCAAAAATCCAGATAAGGAAGGCATTCCCCCCTGACCAGCAAAAGTTGAATCTTTGCAGGCAAGCAGCTGGAAGAATGGCAGAACCCCGTTCAGAATACAATATTT
  5   1   1         - Neu0 5g                            IMAGE:6994308                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACGGTGCAGCTTGGAGGAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGGATGCAGATTTTTGTCAAGACCCCTGACTGGGAAAGACCATTACTCTTGAAGTTTGAGCCCANGTGACACAATTTTGAGAAATGTGAAGGGCAAAAAATCCCAAGAATTAGGGAAAGGGGCATTTCCCCCTTGGACCAAGCCAN
  5   1   1         - TpA  5g3  in                   TTpA065p10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAACAAT
  5   1   1         - TbA  5g3  in                   TTbA036o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCT
  5   1   1         - Te4       in                        CAAN11898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAA
  5   1   1   22    - Gas7 5g                              XZG19294.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTAGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCTAGAATAGGAAGGTATTCCTCC
  5   1   1   12    - Gas7 5g3  in                         XZG24974.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAG
  5   1   1   12    - Gas7 5g3  in                         XZG62769.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACT
  5   1   1         - Gas8 5g3  in                          st12g23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCANANGTGGGATGCAAATTTTTGTCAAGACCCTGAC
  5   1   1         - Egg       in                   TEgg004j18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGAT
  5   1   1         - Tbd0 5g3  in                     NISC_nl13a05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGATGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAG
  5   1   1         - Gas  5g3  in                   TGas098i18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTG
  5   1   1         - Neu  5g3  in                   TNeu061b23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGGGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATATGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGA
  5   1   1         - Bone      in                        CBTC1360.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTC
  5   1   1         - Neu  5g3  in                   TNeu103h19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCG
  5   1   1         - TbA  5g3  in                   TTbA048k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAGCTTGGAGGTAACTGGTTGAAATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGAACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTC
  5   1   1   24    - Brn4 5g                             CAAL23690.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCC
  5   1   1   14    - Brn4 5g3  in                         CAAL6478.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAG
  5   1   1   14    - Brn4 5g3  in                         CAAL9755.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1   14    - Te3  5g3  out                        CAAM3736.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGANAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAAATGGCCGCACCCTCTCTGACTACAACATTCAAAAAG
  5   1   1         - Te5       in                         CAAO3983.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGAT
  5   1   1         - Te5       in                         CAAO4814.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGA
  5   1   1         - Te5       in                         CAAO5418.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAAT
  5   1   1         - Te5       in                         CAAO7831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAGTTGAGCCCAGTGACACATTGAGAATGTGAAGGCAAAAATCAAGATAAGAAGGCA
  5   1   1   10    - Hrt1 5g3  in                         CAAQ3090.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCAATTCGGCACGAGGCTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCA
  5   1   1   22    - Gas7 5g                              XZG11607.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATNTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGC
  5   1   1   22    - Gas7 5g                              XZG36069.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTTACTCTGAAGTTGAGCCCAGTGACACAATTGAGAATGTG
  5   1   1         - Tbd0 5g                            IMAGE:6980709                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAAGTGGGATGCAGATTTTTGN
  5   1   1         - Gas1 5g                            IMAGE:6988396                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACNAATTGAGAATGTGAAGGCAAAAATCCCAAGATAAGGAAAGGGCATTCCCCC
  5   1   1   14    - Brn4 5g3  in                        CAAL20422.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGACGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTCGAACCAAGTGACACCATTGAAAATGTAAAAGCCACAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGATAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCT
  5   1   1   12    - Gas7 5g3  in                         XZG42437.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGCAGCTTGGAGGTAACTAGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTAGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCT
  5   1   1         - Neu  5g                        TNeu093d01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGC
  5   1   1         - Tbd0 5x3  out                      IMAGE:6977224                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCAGCTTGGAGGTACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCAGATTANCACATTCCAGAAAGAATCACCACTGCACTTTGTTTCTTTCGTCTCAGAAGGTGGGATGCAGAATTTTTGTCAAAGACCCTGGACTGGGGAAAGACCATTTACTCCTTGAAAGTTGAGCCCCCATGGAACCACAATTGAAGAAATGGTGAAAGGCCAAAAAATCCCAAGAATTAAGGGAAGGGGTTTTCCCCCCTGGAACCAAGCAAAAGAGTTTGAATTCTTTTTGCAAGGGGCAAAT
  5   1   1         - Gas1 5g                            IMAGE:6987972                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAGTTGAGCCCAGTGACACAATTTGAGATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGAACAGCAGAGGTTGATCTTTGCAGGCAAGCANCTGGGAAGATGGCAGAACCCTGTCAGATTACAATATTCCGAAAGAAATCACCCCTACATTTGGGTCTTTCGTCCTACAAAGTTGGGGATGA
  5   1   1         - Gas1 5g3  in                       IMAGE:6990049                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTAAACATTCAGAAAGAACCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTNCAGACCCTGACTGGGAAGACCAATACTN
  5   1   1   22    - Gas7 5g                              XZG39212.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTGAGCCCAGTGACACAATTGAGATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATCCCCCCTGACCAGC
  5   1   1   12    - Gas7 5g3  in                         XZG44841.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTT
  5   1   1   22    - Tad5 5g                              XZT16275.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAGTTGAGCCCAGTGACCAATTG
  5   1   1   10    - Bone 5g3  in                         CBTC733.fwd ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACATTGA
  3  -1   1         - Thy1      out                       CBST7739.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGCCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGA
  5   1   1         - Gas  5g                        TGas060l15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAA
  5   1   1         - TpA  5g3  in                   TTpA003c18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGA
  5   1   1         - Neu0 5g                            IMAGE:6995656                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAAGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGGTGAGCCCAGTGACACATTGAGAATGTGAAGGCAAAAATCCAAGATAAAGAAAGCATTCCCCCTGACCAGCAGAAGTTGAATCTTGCCAGCAAGCAGCTGGAAGAATGGCAGAACCCTGTCAGATTACAATATTTCAGAAAAGAATCCACC
  5   1   1         - Gas  5g                        TGas014h17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTTGGGAGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCC
  5   1   1         - TpA  5g                        TTpA077c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAA
  5   1   1         - TbA  5g                        TTbA025j23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCC
  5   1   1   14    - Brn4 5g3  in                        CAAL23103.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCCAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1   24    - Brn4 5g                              CAAL9076.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAGTTGAGCCCAGTGACATCATTGAGAATGTGAAGGCAAAAATCCA
  5   1   1   14    - Te3  5g3  in                        CAAM15236.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1         - Te5       in                        CAAO10721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCCCAGTGACACAATTGAGATGTGAAGCAAAAATC
  5   1   1         - Te5       in                         CAAO2577.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1   14    - Te5  5g3  in                         CAAO5834.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAATCCCAAG
  5   1   1   10    - Lun1 5g3  in                          CABD863.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGGTCTTCGTCTCA
  5   1   1   10    - Ova1 5g3  in                        CABE12813.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGG
  5   1   1   20    - Te1  5g                              CBWN2953.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGCCCACGCGTCCGGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAAAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCA
  5   1   1         - Neu  5g                        TNeu009i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGGNAGTAACTGGTTGAGAATCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGNTGAAAACGCTCACTGGNGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTC
  5   1   1         - Neu  5g                        TNeu042b16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGNGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAATGTGAAGGCTAAAATACAGGATAAAGAAGGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATC
  5   1   1   20    - Te1  5g                              CBWN7898.b1 ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAGAATGTGAAGGCTAAAATACAGGACAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTCCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACCATTGAAAATGTAAAGGCCAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGTTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAG
  5   1   1         - HdA  5g                        THdA034m09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGGGTAACTGGTTGAGATTCGTGCAAGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAAGCATTCCTCCAGATCAACAAAAGTTGATCTTTGCTGGCTAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGAGATCCACTCTGCATTTGGTTCTCCGTTTG
  5   1   1   12    - Gas7 5g3  in                         XZG15566.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAAATGGCCGCACACTCTCTGATTACAACATTC
  5   1   1         - TpA  5g3  out                  TTpA003b05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGGAGGTAACTGGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCANNGCAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACA
  5   1   1         - Neu0 5g                            IMAGE:6991236                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAAGACATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCAAGATAGGAAGCATCCCTGACAGCAGAGTGATCTTCAGCACACTACCCAGN
  5   1   1         - Gas1 5g3  in                     NISC_mq07e04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGA
  5   1   1         - Neu0 5g3  out                    NISC_ng03e10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGCTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGA
  5   1   1         - Tbd0 5x   in                     NISC_nl10c05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGA
  5   1   1         - TpA  5g3  in                   TTpA051k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAAGTGGGATGCAGATTTTTGTC
  5   1   1         - TbA       in                   TTbA010n12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAA
  5   1   1         - HdA  5g3  in                  THdA036k14.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCC
  5   1   1   14    - Brn4 5g3  in                        CAAL18144.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAAGATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACT
  5   1   1   14    - Brn4 5g3  in                        CAAL18375.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGA
  5   1   1   14    - Brn4 5g3  in                          CAAL547.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGC
  5   1   1   14    - Te5  5g3  in                        CAAO11841.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAAGTGAGCCCAGTGA
  5   1   1         - Te5       in                         CAAO7172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGCCCAAGGCAGTGAGTGCAGGCGTGGCACTGAGAGTGCAGGCAGAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATC
  5   1   1         - Te5       in                         CAAO8683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTG
  5   1   1         - Te5       in                         CAAO9482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAA
  3  -1   1         - Fat1                                 CABC6013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Lun1      in                        CABD11161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGC
  5   1   1   30    - Eye  5x3  out                        CCAX3675.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCCAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGGAAAACAATAACCCTTGAGGTTGAACCAAGTGACACATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACACATTCAGAAAGAATCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGAC
  5   1   1         - Gas  5g3  in                   TGas067h04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATG
  5   1   1         - Neu0 5g3  in                       IMAGE:6992705                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTGGAGGAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAAAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTTGAGAATGTGAAGGCAAAAAATCCCAGATTAGGAAGGCATTTCCCCCTGACC
  5   1   1   14    - Te5  5g3  in                         CAAO2095.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGTGTAAATGCGGAGCCGCCATTACGCGCTTGGCCCAAGGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAA
  5   1   1         - Egg  5g                        TEgg116b04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTG
  5   1   1         - TpA  5g3  in                   TTpA077g10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGGGAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAA
  5   1   1         - TpA  5g3  in                   TTpA077g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGGGAACTGGTTGAGATTCGTGCAGGACTGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCC
  3  -1   1         - Hrt1                                CAAQ11922.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCCAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTTGCAGGCAGCAGCTG
  5   1   1         - Tbd0 5g3  in                     NISC_nl17g03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGC
  5   1   1         - HdA  5g3  in                  THdA018o05.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGTAACTGGTTGAGATTCGTGCAAGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTAGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCG
  5   1   1         - Gas7      in                         XZG60392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGACGCGTGGGTTGTGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGA
  5   1   1         - Neu  FL                        TNeu128o12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGAGGTAACTGGTTGAGATTCTGCAGGACGCGGAGGGGGAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCGTTCCTCCAGATCAACAAAGGTGGATCTTTCTGGCAAACGGGGGGAGGATGGCCAACCTTATCAACTATAACATCCAAAAGGAGTCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGGGGAGCCAAGTGATACTATTGAGAATGTGAAGGCGAAAATCCAAGACAAGGAAGGCGTTCCCCCTG
  5   1   1         - Gas1 5g3  in                     NISC_mq19h07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGATAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACAC
  5   1   1         - TbA  5g3  in                   TTbA019l11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTAACTGGTTGAGATTCNGTGCAGGGACCTGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACT
  5   1   1         - Gas  5g                        TGas040f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACA
  5   1   1         - TbA  5g                        TTbA050f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTC
  5   1   1         - Gas       in                   TGas066g05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGGTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAAGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATC
  5   1   1         - Gas  5g3  in                   TGas070b20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTACTGGTCGAGATTCTTGCGCGTACCAGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTATATTTAGCGCCTAGTGACACTATTGAAAATGTGAAAGCTAAAATACATGATAAACAATGCATTCCTCCATATCAACAAAAGTTGATCTTTGCT
  5   1   1         - Gas1 5x   in                     NISC_mq14d01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGATCTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGC
  5   1   1   12    - Gas7 5g3  in                         XZG56699.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGACGTCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGAT
  5   1   1   22    - Tad5 5g                              XZT31104.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAATTG
  5   1   1   10    - Limb 5g3  in                        CBSU9136.fwd ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGTTGAGATTCGTGCAGGACCGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAGAATGTGAAGGCTAAAATACAGGACAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTCCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACCATTGAAAATGTAAAGGCCAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGTTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGA
  5   1   1         - Neu  5g                        TNeu143p12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAATGCATTCCTCCATATCAACAAATGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCATACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGATGTGGGATGCATATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGACAAGGAATGCATTCCCCCTGACCATCATATATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTATTTCTTCGTCTCATATGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCT
  5   1   1         - TbA  5g3  out                  TTbA013k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAACTGGTTGATATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCAGCTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCATCTCACAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCATAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTC
  5   1   1         - TbA  5g3  in                   TTbA020l11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAAGTTGATCTTTG
  5   1   1         - HdA  5g3  in                   THdA043o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAAGGCAAAATCCA
  5   1   1         - Te5       in                         CAAO5610.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTNGACACATTGAGAATGTGAAGGCAAAAAATCA
  5   1   1   10    - Ova1 5g3  in                          CABE590.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAA
  5   1   1   12    - Gas7 5g3  in                         XZG50766.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAG
  5   1   1   12    - Tad5 5g3  in                         XZT40568.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCA
  5   1   1         - TpA  5g3  out                  TTpA006j24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCT
  5   1   1         - Gas1 5g3  in                       IMAGE:6990732                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCCCATACTCTGAANNGTGAGCCAGTGACACATTTGAGATGTGAAGGGCAAAATCAGATAAGGAAGCATTCCCCTGACCN
  5   1   1         - Tbd0 5g   ?                      NISC_nl15f04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTG
  5   1   1         - TpA  5g3  in                   TTpA023p03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACTGGTTGAGATTCGTGCAGGACCGGCATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTTACACATTCAGAAAGAATCCACACTGCACT
  5   1   1         - HdA  5g3  in                   THdA008p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGA
  5   1   1   14    - Brn4 5g3  in                        CAAL19268.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAG
  5   1   1   24    - Brn4 5g                             CAAL20004.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATA
  5   1   1         - Te4       in                        CAAN11934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGA
  5   1   1   14    - Te5  5g3  in                        CAAO10328.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TAACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCAAG
  5   1   1         - Neu       in                   TNeu129l20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAACTGGTTGAGATTCGTGCAGGACCGGATCGGGAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCGTTCCTCCAGATCAACAAAGGTGGATCTTTGCTGGCAAACAGCTGGAAGATGGGCGAGCCTTATCAACTATAACATCCAAAAGGAGTCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTGGAGCCAAGTGATACTATTGAGAATGTGAAGGCGAAAATCCAAGACAAGGAAGGCGTTCCCCCTGACCACAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCT
  5   1   1         - TpA  5g3  in                  TTpA022d20.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCA
  5   1   1         - TpA  5g                        TTpA037g23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGCAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAAT
  5   1   1         - TpA  5g3  in                   TTpA053h03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTC
  5   1   1         - TbA  5g3  in                   TTbA013f06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAAGGCAAAATCCAAGATAAGGAAGGCATTCCCCCTG
  5   1   1         - HdA  5g3  in                   THdA023a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTTACATATTCAGAAAGAATCCACCCTACATTTGGTTCTT
  5   1   1   14    - Brn4 5g3  in                        CAAL20516.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTTGAGTTGAGCCCAGTGACACAATTGAGAATGTGAAAGGCAA
  5   1   1   24    - Brn4 5g                              CAAL9751.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTG
  5   1   1         - Te5       in                        CAAO10682.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGC
  5   1   1         - Te5       in                         CAAO5430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGG
  5   1   1         - Te5       in                         CAAO8371.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTTGAAGTGAGCCCAGTGACACAATTGAGAATGTGAAAGCAAAAATCCAAGATAAGGGA
  5   1   1         - Te5       in                         CAAO9093.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGG
  5   1   1   22    - Tad5 5g                              XZT16891.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGC
  5   1   1         - Tbd0 5g3  in                       IMAGE:6977431                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCACACTGCACTTGGTTCTTCGTCTCAAAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAGTTGAGCCCAGTGACCCAATTGAAAATGTGAAGGCAAAAATCCAAGAATAAGAAGGCATTCCCCCTGAACAACCAAAGTTTGATCTTTGCAAGGAAGCACCTGGAAAGAGGGCAAAACCCTGTCCA
  5   1   1         - Gas1 5x3  out                    NISC_mq10d11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGC
  5   1   1         - Gas1 5g3  in                     NISC_mq20a10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCC
  5   1   1         - TbA       in                   TTbA074j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCANGCAAGCAGCTG
  5   1   1   22    - Gas7 5g                              XZG13307.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGGGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACT
  5   1   1   22    - Tad5 5g                              XZT38316.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGG
  5   1   1   12    - Tad5 5g3  in                         XZT49265.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTC
  5   1   1         - Te1       in                        CBWN13429.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGA
  5   1   1         - Neu0 5g                            IMAGE:6992291                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAAAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGAACATTACTCTTGAAGTTGAGCCCAGTGACACAATTGGAGAATGTGAAAGGCAAAAATCCAAGATTAAGAAGGCATTCCCCCCTGAACAGCAAAAGGTTTGATCTTTTGCAG
  5   1   1         - Neu0 5g                            IMAGE:6994648                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTNCAGACCCTGACTGGGAAGACCATTACTCTTTGAGTTGAAGCCAGTGGACACATTTGAGGAATGTGAAGGGCAAAAATCCAAGATAAGGGAAGGCCATTCCCCCCTTGACCAGCAAGAGGTTTGGATCCTTTTGGCAGGCCAAGCAAGCCTGGAAAAAAAC
  5   1   1         - Abd0 5g3  in                       IMAGE:6999259                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGA
  5   1   1         - Neu0 5g3  in                     NISC_ng10e11.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGA
  5   1   1         - TbA  5x3  out                  TTbA031e24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGC
  5   1   1   24    - Brn4 5g                             CAAL21399.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCCAG
  5   1   1   24    - Te3  5g                             CAAM14839.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAG
  5   1   1   22    - Gas7 5g                              XZG54141.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTC
  5   1   1   22    - Gas7 5g                              XZG64629.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATAACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCA
  5   1   1   22    - Tad5 5g                              XZT34726.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGG
  5   1   1         - Gas8      in                          st14o20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAAACCATTACTCTTGAAGTNGAGCCNGTGACNCANTNGANAATGTAA
  5   1   1         - Gas8 5x3  out                          st1e21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAAAGGTGGGATGCANATTTTTGTCANGACC
  5   1   1         - Gas8 5g3  in                          st72p07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAANATGGCCGCACNCTCTCTGATTACAACATTCANAAAGAATCCACNCTGCACTTGGTTCTNCGTCTCANAGGTGGGATGCAAATTTTGTCAAGACCCTGACTGGGAAAACNTTACTCTNGAATTGANCCNGTGACCCATTGAAA
  5   1   1         - Gas1 5g3  in                       IMAGE:6989701                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTNCAGACCCTGACTGGGAAGACATTACTCNTTGAGTGAGCCAGTGACACATTGAGATGTGAGGCAAAATCCAGATAGGAAGCATCCCCTGACAGCGA
  5   1   1         - Neu0 5g                            IMAGE:6993516                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGGAGAATGTGAAGGCAAAAATCCAAAGATAAGGAANGGCATTCCCCCCTGAACCNAGCAGAAGGTTTGATCTTTTGCAAGGCCAAGCCAGCC
  5   1   1         - TpA  5g3  in                   TTpA017j04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAGTTG
  5   1   1         - Gas7 5x   in                         XZG45134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTAGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1   12    - Gas7 5g3  in                         XZG58436.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTAGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAGATAAGGAAGGCATCCCCCCCTGACAGC
  5   1   1         - Egg  5g                        TEgg135d09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAG
  5   1   1         - Gas       in                   TGas087k04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCACCAGAGATTGATTTTTGCTG
  5   1   1         - Neu  5g3  in                   TNeu058c12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAA
  5   1   1         - TpA  5g3  in                   TTpA012a21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGAGATTCGTGCAGGACCGGCATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Tbd0 5g3  in                       IMAGE:6978001                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGGAGAACATTACTCTTGAAGTTGAGCCCCGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTTGATCTTTGCAGGCAAGCAGCTGGAAAGATGGCAGAACCCTGTCAGAT
  5   1   1         - Tbd0 5g3  in                     NISC_nl22h07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGA
  5   1   1         - Gas  5g                        TGas045l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGNGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCT
  5   1   1         - TpA  5g                        TTpA043p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAAGGCAAAATCCAAGAATAGGAAGGCATTCCCCCTGACCAGCAGAAGGTGATCTTTGCAGGCAAGCAGCTGGA
  5   1   1         - TbA  5x3  out                  TTbA014a14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAGATTCGTGCAGGACCGGATCGGCACTAAATATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATC
  5   1   1         - HdA  5g3  in                  THdA031c06.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAANTTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAGCAGCTGGAAGAATGCAGAACCCTGTCAGATTACATATTCA
  5   1   1   24    - Brn4 5g                             CAAL11049.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTG
  5   1   1   14    - Brn4 5g3  in                        CAAL21896.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAAATGTGA
  5   1   1   14    - Te5  5g3  in                        CAAO10970.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1   14    - Te5  5g3  in                        CAAO11642.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAG
  5   1   1         - Te5       in                         CAAO5962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGA
  5   1   1   24    - Met5 5g                              CACX1423.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCTTAACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAG
  5   1   1         - Egg  5g                        TEgg086i10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAA
  5   1   1         - TbA  5g                        TTbA060l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCTCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTC
  5   1   1   14    - Brn4 5g3  in                        CAAL20671.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1   14    - Te5  5g3  in                        CAAO10291.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCT
  5   1   1   10    - Ova1 5g3  in                         CABE3340.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAATTCGGCACGAGGCCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCA
  5   1   1         - Sto1      in                         CABG6427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATAACTCTTGAAGTTG
  5   1   1         - Neu  5g                        TNeu094o10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAG
  5   1   1         - Neu  5x3  out                  TNeu108h09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAA
  5   1   1         - Tbd0 5x   in                     NISC_nl19d03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAA
  5   1   1   10    - Spl1 5g3  in                         CABK5830.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGC
  5   1   1         - Tbd0 5g                            IMAGE:6979176                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAAGTGGGATGCAGA
  5   1   1         - Neu0 5g                            IMAGE:6996167                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAGTTGAGCCCAGTGACAAATTTGAGATGTTGAGGGCAAAATCCAAGATAAGGGAGGCATTCCCCCTGAACAAGCGAGGTTGATCTTTTGCAGCAAACACCTGGGAAGATGGCANAACCCCTGTCAGAATTACAATNATTCN
  5   1   1   22    - Gas7 5g                              XZG13656.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACATTTGAGAATGTGAAAGCAAAAATCCAAG
  5   1   1         - Gas7      in                         XZG22422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAAAATGTAAAGGCAAAAATCCCAAGATAAGGAAGGCATTCCCCCCGACC
  5   1   1         - Lun1      in                         CABD8962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAG
  5   1   1         - Neu  5g3  in                   TNeu069i08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAAT
  5   1   1         - Neu  5g3  out                  TNeu075d07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTC
  5   1   1         - Neu  5g3  in                   TNeu090o13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCGTTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATGAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGG
  5   1   1   14    - Brn4 5g3  in                        CAAL23626.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGA
  3  -1   1         - Mus1      in                        CABH10612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCACAGGTGGGATGC
  5   1   1   22    - Gas7 5g                              XZG12042.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTCAAGACCCTGACTG
  5   1   1   22    - Gas7 5g                              XZG13431.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTG
  5   1   1   11    - Int1 5g3  in                         CAAP2558.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCGATTCAATCGGCACGAGGAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGC
  3  -1   1         - Liv1      in                         CAAR6001.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTG
  5   1   1   12    - Gas7 5g3  in                          XZG4595.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAAAGATTGATCTTTG
  5   1   1   14    - Brn4 5g3  in                        CAAL10002.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAATCCAAGATAAGGAGGCATTCCCCTGACCGCAAAGGTGATCTTTGCAGCAGCAGCTGG
  5   1   1         - Brn4 5x   in                        CAAL23308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Neu  5g                        TNeu033j18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGC
  5   1   1         - Te5       in                         CAAO5351.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGANAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATNTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAAT
  5   1   1         - Te5       in                         CAAO5529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGA
  5   1   1         - Gas1      in                       IMAGE:6990854                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGGCTTGGGTACCGGTNNCCGGAATTCCCGGGATTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGGATAAGGAAGGCATTTCCCCCCTGAACAGCAGAAGTTGATCTTTGCAGGCAAGCAGCTGGAAGAATGGCAAAACCCTGTCGGATTACAATATTCCGAA
  5   1   1         - Neu  5g3  in                   TNeu106k22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTC
  5   1   1         - Neu0 5g3  in                     NISC_ng26d01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGA
  5   1   1         - TbA  5g                        TTbA018m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGGCGGCAGCAAACATGCAGATACCTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGANAGCAGCTGGAAGATGGCCGCACACTCTCTG
  5   1   1   34    - Brn4 5x3  out                       CAAL10954.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCCCAGTGACACAATTGAGAATGTGAA
  5   1   1   10    - Fat1 5g3  in                          CABC634.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCT
  5   1   1   10    - Mus1 5g3  in                        CABH11055.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGGAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTTAC
  5   1   1   22    - Gas7 5g                              XZG56931.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTAGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCTAGTGATACTATTGAGAATGTGAAGGC
  5   1   1   22    - Gas7 5g                               XZG8270.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAAGTGAGCCCAGTGACANCATTGAGAATGTGAAGGCAAAAATCCA
  5   1   1         - Tbd0 5g3  out                      IMAGE:6976703                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAAAGGTGGGATGCAGATTTTTGTCAAGACCCCGACTGGGAAGACCATTACTCTTGAAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAAATCCAAGATAAGGAAGGGCATTCCCCCCTGGACAGCCAAAGGTTGGATCTTTGGCAGGGCAACCAGCTGGGA
  5   1   1   10    - Hrt1 5g3  in                         CAAQ4438.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGC
  5   1   1         - Lun1      in                         CABD7849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCT
  5   1   1         - Sto1      in                         CABG4906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1   22    - Gas7 5g                              XZG12990.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGATCGGCAGCAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACANCATTGAGAATGTGAAGGCAAAAATCCAA
  5   1   1         - Gas8 5x3  out                         st15a20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCNAAAATCCAAGATAAGGAAGGCATCCCC
  5   1   1         - Gas8 5g3  in                          st18h02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCANATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGACCCNGTGNCCCATTGANATGTGAAGGCAAAAATCCAGATANGGANGGNTTCCCCCTGACCNCAAAGTTGATCTT
  5   1   1         - Neu  5g                        TNeu100b05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAG
  5   1   1         - HdA  5g3  in                   THdA037j02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGGCAGCAAACATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAATACCAATACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCATCTGGGAGATGGTCGCACTCTTTCTGACTACAACATTCATAGAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAAGTGGGATGCAAATATTTGTGAAGACCCTGACTGGGAAAACAAAAACCTTTGAGGGTAAACCAAGTGACACAATTGAA
  5   1   1   10    - Fat1 5g3  in                          CABC727.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGAT
  5   1   1         - Egg  FL   in                   TEgg052p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGA
  5   1   1         - Neu0 5g                            IMAGE:6991821                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAACCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCCGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATTAAGAAAGGCATTCCCCCCTGACCAGCAAAAAGTTTGATCTTTTGCAGGGCAAGCAACCTGGGAAAGATGGGCAGAAACCCCTGGTCAGAATTTACAATATTTCAGAAAAAGAATCCCACCCCCTAACCATTTGGGGTTCCTTCCCCTCCTCCAAAAGGGGG
  5   1   1   10    - Int1 5g3  in                         CAAP9886.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGAC
  5   1   1   14    - Brn4 5g3  in                        CAAL21025.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGA
  5   1   1         - Lun1      in                         CABD5477.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAAGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTG
  5   1   1         - Gas1 5g   ?                      NISC_mq10e09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAAACATGCAGATATTTGTGAAAACGCTCACTGGGTAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTC
  5   1   1         - HdA  5g                        THdA048j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGT
  5   1   1         - Te5       in                         CAAO4709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACC
  3  -1   1         - Int1      in                          CAAP449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGC
  5   1   1   10    - Int1 5g3  in                         CAAP7233.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1   10    - Int1 5g3  in                         CAAP9825.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGAT
  5   1   1   10    - Hrt1 5g3  in                         CAAQ2129.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAG
  5   1   1   10    - Liv1 5g3  in                        CAAR12621.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Ova1 5g3  in                        CABE10495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAG
  5   1   1   10    - Ski1 5g3  in                         CABJ1598.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTTGCAGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGATCCACCCTA
  5   1   1         - Tad5      in                         XZT13746.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAACATGCAGATATTTGTGAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCT
  5   1   1   20    - Te1  5g                              CBWN6180.b1 ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAAT
  5   1   1         - HdA  5g                        THdA045d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACATGCAGATATTTGTGAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCNAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTC
  5   1   1         - HdA  5g                        THdA045d08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACTGCAGATATTTGTGAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTC
  5   1   1         - TbA  5g                        TTbA022j11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCT
  5   1   1         - Gas8 5g3  in                          st64l24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCANAGGTGGGATGCANATTTTTGTCAAGACCCTGACTGGGAAAACATTACTCTNGANTTGANCCNGTGACNCATTGAAATGTGANGCAAAA
  5   1   1         - Lun1      in                         CABD6652.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGTATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGTTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Liv1      in                         CAAR1016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGCCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTC
  5   1   1         - Te5       in                         CAAO9515.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGA
  5   1   1         - Liv1      in                         CAAR6871.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACCATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCA
  3  -1   1         - Hrt1      in                        CAAQ12805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCAT
  3  -1   1         - Int1      in                         CAAP8342.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAAACGCTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCNAGCAGCTGGAAGATGGCAGAACCCTGTCAGA
  5   1   1         - Int1      in                         CAAP1733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCAT
  5   1   1         - Gas7                                 XZG51857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTC
  5   1   1         - Int1      in                        CAAP14254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGG
  5   1   1         - Int1      in                         CAAP9033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAG
  5   1   1         - Gas7      in                         XZG17763.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCCCCCTACATTTGGTTCTTCGTCTCAGAGGTGGGAT
  5   1   1         - Gas7      in                         XZG45728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCTCACTGGGGAATACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAAGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGA
  5   1   1         - Hrt1      in                         CAAQ9203.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCACTGGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCNAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAA
  5   1   1         - Int1      in                        CAAP13422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATT
  5   1   1         - Fat1      in                         CABC7083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCA
  5   1   1         - Gas1      in                       IMAGE:6990733                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACATTACTCTTGAAGTGAGCCAGTGACACATTGAGATGTGAAGCAAAATCCAGATANGAAGCATTCCCTGACAGCAGAGTGATCTTGCAGCAGCACTGAGATGCAGACCTGCGATACATATCGAGATCN
  5   1   1         - Gas7      in                         XZG57325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTAGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTTAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAAGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGGACAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGA
  5   1   1         - Gas7                                   XZG262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCNAGATAAGGAAGGCATCCCCCCTGACAGC
  5   1   1         - Tad5                                 XZT33154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGAATTACATATTCAGAAAGAATCCACCCTACATTTGGNNTCTCGTCTC
  5   1   1         - Neu                            TNeu036o09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGGAGAAGGCATTCCTCCAGACACAAAGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAAGTGGGATGCAGATTTTTGTCAAGACCCTGACTGG
  5   1   1         - Brn4                                CAAL11691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTG
  5   1   1         - HdA                           THdA015a18.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCT
  5   1   1         - Te4       in                         CAAN2596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAG
  5   1   1         - Gas7      in                          XZG4206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCCTGAGGTT
  5   1   1         - Te5       in                         CAAO9797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATGGCCGAACGTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTTACATATTCAGAA
  5   1   1         - Neu                            TNeu005d03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGTTGATCTTTGCTGGCAAACAGCTGGAAGAGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGATGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTC
  5   1   1         - Lun1                                 CABD6258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTGCTGGCAACAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAATCCAAG
  5   1   1         - BrSp      in                     EC2BBA31CB01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTCCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACCATTGAAAATGTAAAGGCCAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGTTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACAT
  5   1   1         - HdA       in                  THdA028b01.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGA
  5   1   1         - HdA       in                  THdA028d01.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGAAGATGGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAAGGTGGGATGCAGATATTTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGT
  5   1   1         - Brn4      in                         CAAL6682.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCTCAGTGATACTATTGAGAATGTGAAGGCAAAAAATCAAG
  5   1   1         - Gas7                                 XZG15855.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCT
  3   1   1         - Gas7 5x   in                         XZG45134.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTCGGTTTCCATTTTTCAAAAGGATTCCCCCCTGCCTTTGTTTTTCGTTTTCGGGGGGGGGGGGCAAATTTTTGGGAGGCCCTTAAGGGGTAAACCAATACCCCTGGGGGTGGACCCAGGGGCCCCCTTGGAAATGGTAAAGGCAAAATTTCAGGCCAAGGGGGGTTTTCCTCCCGCCCCGCGGGGTTTGTTTTTTCCCGGAAAGCAGCTGGAAGAGGGCCCCCCCCTTTTGGTTTCCACCTTTCGGAAGGATTCCCCCCTCCCCTGGTTTTTTTTTTTCGGGGGGGGGGGGCGGTTTTTTGTCAGGCCCCGGCCGGGGAGGCCCTTTCTTTTGGAGGTGGGGCCCGGGGCCCCATTGGGGATGGTAAGGGCAAAATTCCAGGTTAGGGGGGGCTTTCCCCCTGCCCGGCGGGGTTTGTTTTTTCCGG
  5   1   1         - Neu0      in                     NISC_ng05d08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTC
  3   1   1         - Gas8      in                          st14o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAANGGATTCNCTNTGCANTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTCTCTGATTACAACATTCAGAAAGAATCCACCCTGCACCTGGTCCTTCGTTTGAGGGGTGGGGTTTAAAACAATCATTATGCATCTGCTCTGCAT
  5   1   1         - Brn4      in                        CAAL11354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACTGGTTGAGATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCCAGTGATACTATTGAAAATGTGAAGGCAAAAATCTCAG
  5   1   1         - Te6       in                          CABM626.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCCACTCTGCATTTGGTTCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAATCCCAGATAAG
  5   1   1         - BrSp                             EC2BBA19DG09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTCCTCCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACCATTGAAAATGTAAAGGCCAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGTTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTAAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCT
  3   1   1         - Brn4 5x   in                        CAAL23308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTCGTTTCGGGGGGGGGATGCAAATTTTTGGGAGGCCCTTAACGGGTAAAACAATACCCCTGGGGGTGGACCCAAGGGCCCCCTTTGAAAATGTAAAGGCAAAATTTCAGGCCAAGGAGGGTTTTCCTCCCGCCCCGCAGGGTTTGTTTTTTCCCGGAAAGCAGCTGGAAGATGGCCCCCCCCTTTTGGTTTCCACCTTTCAGAAGGAATCCCCCCTGCCCTTGGTTTTTTTTTTCGGGGGGGGGAGGCAGATTTTTGTCAAGCCCCTGCCGGGGAAGCCCTTTTTTTTTGAGGTTGGGCCCGGGGCCCCATTTGGGAATGTAAGGGCAAAATTCCAGGTTAGGGGGGGCTTTCCCCCTGCCCGGCGGGGTTTGTTTTTTCCGGGCAAGCAGCGGGAAGAGGGCCCCCCTTTTTTTGTTTCCACCTTT
  5   1   1         - Tad5      in                         XZT35984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGTTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGG
  5   1   1         - Lun1      in                         CABD2397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCGATTCGGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAA
  3   1   1         - Te1       in                        CBWN13429.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAAAAAAAAAAAA
  5   1   1         - TpA       out                  TTpA002c11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAACGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCATCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCACAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAG
  3   1   1         - Gas7      in                         XZG22422.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATGCAAATTTTTGTGAAGACCTTAACTGGTAAAACAATAACCCTTGGGGTTGAACCAAGTGCCCCCTTTGAAAATGTAAAGGCAAAATTTCAAGCCAAGGAAGGTTTTCCTCCCGCCCAGCAGAGATTGTTTTTTCCCGGAAAGCAGCTGGAAGATGCCCGCCCCCTTTCTGATTCCAACATTCAGAAAGAATCCCCCCTGCCCTTGGTTTTTCTTTTCAGAGGTGGGATGCAGATTTTTGTCAAGCCCCTGCCTGGGAAGACAATTCCTCTTGAAGTTGAGCCCAGTGCCCCATTTGAGAATGTAAAGGCAAAATTCCAAGATAAGGAAGGCTTTCCCCCTGCCCAGCAGAGATTGTTTTTTCCAGGCAAGCAGCTGGAAGATGGCCC
  3   1   1         - Gas7      in                         XZG45728.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGATGCAAATATTTGTGAAGCCCTTAACTGGTAAACCAATAACCCTTGAGGTTGACCCAAGTGCCCCCTTTGAAAATGTAAAAGCAAAATTTCAAGCCAAGGAGGGTTTTCCTCCCGCCCACCAGAGATTGTTTTTTCCCGAAAAGCAGCTGGAAGATGCCCCCCCCCTTTTTGTTTCCACCTTTCAGAAAGAATCCCCCCTCCCCTTGTTTTTTCTTTTCAGAGGTGGGATGCAGATTTTTTTCAAGCCCCTGACTGGGAAGA
  5   1   1         - Brn4      in                        CAAL12185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAATCCCAAGATAAGGAAGGCATTCCCCCTGACCAGCA
  5   1   1         - Te5       out                       CAAO11537.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCTAGTGATACTATTGAAAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Te1                                 CBWN17279.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATATTTGTGAAGACCCTGACAGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACCATTGAAAATGTAAAGGCCAAAATCCAAGACAAAGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGTTTGGAAGATGGCCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGTACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCAAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGGATGCAGATTTCT
  5   1   1       chi Gas7      in                         XZG15941.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATTCGTGCAGGACCGGATCGGCAGCAAACATGCAGATATTTGTGAAAACGCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGACACTATTGAAAATGTGAAGGCTAAAATACAGGATAAAGAAGGCATTCCTCCAGATCAACAAAGGTTGATCTTTGCTGGCAAACAGCTGGAAGATTGCCGAACCTTATCAGACTATAACATCCAAAAGGAATCCACTCTGCATTTGGTTCTCCGTTTGGGAGGTGGGATGCAAATATTTGTGAAGACCCTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGACCCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGC
  5   1   1         - Int1      ?                           CAAP429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGATTCGAATTGGACGAGGGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAACTG
  5   1   1         - Sto1      in                        CABG10200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Te5       in                         CAAO7189.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAACTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAA
  5   1   1         - Ova1      in                        CABE10927.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGCCAAGTGATACTATTGAGAATGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAACTGGA
  5   1   1         - TbA       in                   TTbA022k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAGTGATACTATTGAGAATGTAAAGGCAATAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTNCAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTC
  5   1   1         - Liv1      in                         CAAR3200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAGTGATACTATTGAGACTGTAAAGGCAAAAATCCAAGACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACTCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAATCCCAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAACTGG
  5   1   1         - Gas7      in                         XZG43329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCACAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCTCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGC
  5   1   1         - Te5       in                         CAAO1168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACCATTGAAAATGTAAAAGCAAAAATTCAAGACAAAGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCCGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAAAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAACTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAAACACTAA
  5   1   1         - Te5       in                         CAAO7651.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTC
  5   1   1         - Neu       in                   TNeu089l20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAGAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTGTTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTAAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGC
  5   1   1         - Gas7                                 XZG48942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAAT
  5   1   1         - TpA                            TTpA072i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTANCACATTCANAAAGAATCCACCTTGCACTTAGTTCTTCGTCT
  5   1   1         - Te5       in                         CAAO6953.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGAATCCACACTGCACTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATTTTTGTCAAGACCCTGACTGGGAAGACCATTACTCTTGAAGTTGAGCCCAGTGACACAATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGGTTGATCTTTGCAGGCAAGCAGCTGGAAGATGGCAGAACCCTGTCAGATTACAATATTCAGAAAGAATCCACCCTACATTTGGTTCTTCGTCTCAGAGGTGGGATGCAGATATTTGTGAAGACCCTGACTGGGAAGACCATTACCCTTGAGGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCAAAAATCCAAGATAAGGAAGGCATTCCCCCTGACCAGCAGAGATTGATCTTTGCAGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACAT
  5   1   1         - Gas7                                 XZG21219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTCCCCCTGACCAGCAGAGATTGATTTTTGCTGGCAAGCAGCTGGAAGATGGTCGCACTCTTTCTGACTACAACATTCAAAAAGAATCCACCTTGCACTTAGTTCTTCGTCTCAGAGGTGGGATGCAAATATTTGTGAAGACCCTGACTGGTAAAACAATAACCCTTGAGGTTGAACCAAGTGACACAATTGAAAATGTAAAGGCGAAAATCCAAGATAAGGAAGGTATTCCTCCCGACCAGCAGAGATTGATCTTTGCTGGAAAGCAGCTGGAAGATGGCCGCACACTCTCTGATTACAACATTCAGAAAGA