Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

 This cluster: approximate FL confidence score = 97%

 1012767081 Xl3.1-XL467n09ex.5 - 887 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                   3     5     3     5     3     5     3     5     3     5     4     6     4     6     4     7     4     7     4    13     4    17     7    27    10    45    45   104   149   216   204   276   259   336   304   381   324   388   326   396   335   398   354   404   374   407   378   412   384   414   386   418   387   418   395   421   310   424   397   432   403   435   393   436   422   438   375   439   425   439   422   441   426   444   428   445   432   449   430   457   434   459   432   463   438   465   433   466   433   482   426   486   439   486   439   491   425   496   441   496   413   497   437   499   432   500   426   498   424   500   394   500   351   502   429   504   412   506   392   504   394   510   418   512   392   528   419   543   411   564   436   581   423   592   447   597   402   611   405   610   395   600   354   600   361   586   261   563   294   512   265   491   261   478   258   469   252   444   232   435   247   424   232   409   237   404   268   400   272   401   321   400   280   394   330   395   332   391   342   392   345   389   348   389   346   387   353   386   351   388   359   388   352   385   338   385   353   383   364   389   367   393   362   396   348   395   370   400   362   402   372   400   367   397   367   398   347   403   377   399   371   394   220   393   370   393   378   392   369   392   312   391   343   390   301   389   151   386   241   383   218   380   200   376   119   373   114   364   113   358   118   353    73   306    55   193    39   151    34   118    12    70     7    27     7    15
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCAGAAGGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAGAAGCCTAGTGTGTGTTCTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTACCAGCCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCTGTGGTTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATATGTTGTT
                                                                   SNP                                                                                                                                                                                                                          --C----A----
                                                                   SNP                                                                                                                                                                                                                                      C--G--------
                                                                   SNP                                                                                                                                                                                                                                                  -----------C
                                                                   SNP                                                                                                                                                                                                                                                              ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                          --A-G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                              -T--------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----A------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -AC---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C--------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G--G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C--A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T--C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T--G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G-T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-----G-
                                               BLH ATG     212    1923                                                              
                                               BLH MIN     212     306                                                              
                                               BLH MPR     197     306                                                              
                                               BLH OVR     212      87                                                              
                                               CDS MIN     212      62                                                              
                                               EST CLI     156      62                                                              
                                               ORF LNG     212       8                                                              
  5   1   2       bld DMZ  5g3  in                         xl283c02.5p                                                                                                                                                                                               AGAGATTGTTGGTCTAATGCGGCTTTTTCCAGGGACGAGCTGGTGTCCATTGTGCGGGAGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCNGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAATCCGCCCCAGATGATGG
  5   1   2       bld Ga18 5g3  in                      xlk156d07ex.5p                                                                                                                                                                                                                                            GTCCATTGTGCGGGAGTGTGAGGNANNACGATCAGGAACATGAGGGGNGAACGAGGACGTGGACGTGGCCGCTTTGGNCCAGAATGGGACCTAACGCAGGNTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGNGTGAAANCCGCCCCAGATGATGGCACACTCAGNGAGGNGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGNAACCAAAAT
  5   1   2       chi Emb1                            IMAGE:5154958.5p                                                                                                                                                                                                                                               CCACGCGTCCGGTGTGAGGAACGACGATCAGGAACATGAGGGGTGAACGAGGACGTGGACGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGATTTCCACGTGTGTGAAATGGCCTTCCCTCGTGTGAAACCCGCCCCAGATGATGGCACACTCAGTGAGGCGCTGCTCAAACGGAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCCATTCTTTCTCTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAAAAAGGGACAATGTCCGCTGGCCATAATGTTGCAGACTTGGTTGTCATTCTAAAGATCCTCCCCCAACTGGAAGGCCCGTTCTGCTTTTGGGCATTAAGGTAGTTGAAAACCCTGAGGGACCCAAGAACCCGGCCggaagttttttaaaaaggtttaccaaaagggaaaagggcttttgaaaaacagtttcaacaaaaccccccccctttagggggcccccatcaaaaatgggggccgcccccaaaccttacccaaaaggggggaccccaAAAATTGGAATTTTTGGAACAATCAAAAGGTTTTTAAAAAAAGGcccctgggggcccccctttggggccccccccgggggggttttttaaaaaaaaaaaaacccccccccctttttttaagggggggaggggtgttttttaacccccccctgtgggggaaaaaaaacctttgggggggggggCCGCCTCTCCC
  5   1   2       bld Tbd3                            IMAGE:3548517.5p                                                                                                                                                                                                                                                                                       GGGTGAACGAGGACTTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCATGTTTCAGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCTAGTGAAACCGGCCCCATATGATGGCACACTGACCGAGGAGCTGCTCATACGAAACCAATATCTGTCC
  5   1   2       bld Egg5      out                   IMAGE:3430679.5p                                                                                                                                                                                                                                                                                              CGAGGACGTGGCCGTGGCCGCTTTGGCTCCAGAATGGGACCTAACGCAGGTTTCGGACCCTTCGTCCCTCACATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCCCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCT
  5   1   2       bld Ga15      in                       XL471p20ex.5p                                                                                                                                                                                                                                                                                                                                                                     CATTCCCTTTGACTTCCACGTGTGTGAAATGGCCTTCCCTCGAGTGAAACCGGCCCCAGATGATGGCACACTGAGCGAGGCGCTGCTCAAACGAAACCAAGATCTGGCTCCTACAACAACTGAGCAGGCCTCAATCCTTTCTTTGGTAACCAAAATCAACAACGTTATTGACAATTTGATTGTAGCCCCTGGAACCTTTGAAGTGCAAATTGAAGAGGTGCGACAGGTGGGCTCCTACAAGAAAGGGACCATGACCAGTGGCCATAATGTTGCAGACTTGGTTGTCATCCTAAAGATCCTTCCCACTTTGGAAGCCGTTTCTGCTTTGGGCAATAAGGTAGTGGAGACCCTGAGGACACAAGAACCCGCAGAAGTTCTCACAATGCTGACAAATGAGACTGGCTTTGAAATCAG
  5   1   2       bld Ga15                               XL429b09ex.5p