Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7207205.5                     113 PI      92         18     1474                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012767117 Xl3.1-IMAGE:8823869.5 - 427 ESTs
                                                                       ....-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8823869.5                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGAGCGAGACGTGCTGCTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGAAAATAAAAAAACTGAAATAGAAAAAAAAAAAAAAAAAAACATCAAGATTTCTAAATTCTGTGT
                                                  Xl3.1-CHK-1012685016                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGACGTGCTGCTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGAAAATAAAAAAACTGAAATAGAAAAAAAAAAAAAxxxxxxCATCAAGATTTCTAAATTCTGTGTTATGCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                          4    12     4    18    38    57    73    98   141   171   179   201   196   215   214   226   224   230   225   230   224   230   229   233   230   234   228   233   229   234   229   237   232   238   231   238   232   237   229   239   241   245   238   245   242   246   242   246   241   246   241   246   241   248   245   251   247   252   250   255   253   256   251   256   251   258   252   259   248   259   249   258   248   259   252   264   250   267   249   269   249   275   247   277   252   280   248   286   248   292   244   290   240   286   225   286   225   285   218   288   215   287   205   284   200   281   192   280   192   285   163   287   169   291   168   295   156   298   172   293   132   283   113   277   112   279   113   276    95   266    98   262    80   245    95   233   105   221   107   210   107   202   100   195   110   185   116   182   116   179   122   181   126   185   128   185   131   179   119   173   122   172   124   169   126   169   130   170   131   168   135   167   134   170   133   167   132   166   137   167   136   167   135   164   135   163   139   161   134   158   132   158   129   156   136   156   134   156   133   156   135   154   136   154   132   152   135   151   133   151   134   150   132   148   131   146   131   146   129   145   129   145   127   145   124   143   124   142   121   140   107   137   103   132    95   126    76   109    61    94    52    85    46    65    17    34     9    23     4    13     4    10
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------A-C
                                               BLH ATG      67    1757                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN      67     284                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MPR      67     284                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR      16      77                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               CDS MIN      16     284                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               EST CLI      60      62                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG      16      22                                                                                                                                                                                                                                                                                                                                                                                                                     
  5   1   0       chi Te1                             IMAGE:6928749.5p GGGGTTGCTGAACTTCCACTTGTAACTATAAGGCGTGGGGTCTCTTAAGATATTGATAAAACTTGTTATAAATGGCCACGTATCAGTAACATCAAGGAAGCCTGATTGAATTGATTTCCACTTAGCAGCTGGCTCCTATATTGGCAGAACTGAGTCCTCTCTTAGTTTTGTGTGGAAAGTTCTGTGAGAGACAGTGTAACAATTCAATATAATTTGCCACCACATACAATTGGAGTTTTAATTTGGGGACCGTTTTCTTTCACAGAAACCTTCAGTGTCTGTGATATTGCCACATGACATATCACCCGTCAGTACGTCCCGAAAGTGTTACGTTACGCCCTCGTCGCAATACGCCTTAATTTTACGACAGGCTGTAGTCTGTTTTCGGCTGCTATATTACGTCGGAGAGCGAGACGTGCTGCTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATTAAGGTTGCCCTCCTCTGCTCCAGAATTCCAGTTTGGGGGTAACAAAATAAAACACCCGAAGTTTCTAAAAGAAATTTCCCCTTAGGGCAAGGTACCCAGCCATTTTTAAGGGCAAAAGAACGGtttttttgccctttttttGAAAAGCAAATGGCCAATTTGCCTCCAATTAATGGTGGGGTAAAATGAATTGAACCTTCCCCCGGGGAAAACCCACCTTCGGTTTCTACCACCCCAAAAGCCCA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048559.5p                                                                                                                                                                                                                                                                                                                                             TTACGCCCTCGTCGCAATACGCCTTAATTTTACGACAGGCTGTAGTACTGTTTTCGGCTGCTATATTACGTCGGAGAGCGAGACGTGCTGCTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATC
  5  -1   2       chi Sp1                             IMAGE:5435264.5p                                                                                                                                                                                                                                                                                                                                                 GGGGGGATACATTCACCGGAACGGTGTGCCTTAGGCTTTTTGGTGCAATTAGACAGTTTGACAAAAAGCAGCGGTACGTTCCGGAATCCCGGAAATTGTGACCCAGGGTCCGGGGCCGGCGGGACTTTGTACACATACCCTGAAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTGCCGAGTG
  5   1   2       bld Ov1  5g                         IMAGE:6316603.5p                                                                                                                                                                                                                                                                                                                                                                                      TGCAGTCTGTTTTCGGCTGCTATATTACGTCGGAGAGCGAGACGTGCTGCTCCTTCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGGAACATCCTTCCGCCAGCCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAAAGTTCCGGGCTGTGTTGGGAGAAGTAAAACCTTGGGGACAAGATGGCCCCGTTTGATGGCAAGAAACTTTGCCCCAGATGCAGCCCAAAAAAGAGACCccccagaaagagaagtcccgcaaagggagccccaaaaacaaaaaggaggcaaaagcaacaaaGGAGGAACCTAACTCCCTGGCCCCCAGCCCCTGGAGGGAT
  5   1   2       bld Int2 5g3  in                    IMAGE:8823114.5p                                                                                                                                                                                                                                                                                                                                                                                               GAAGAGAAGGGAggggggggAAGGTGATAATTAATTCGTCCCCCGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGAGTAACAAATAAGACACCAGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTGGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTcccaagaaagagaagccagcaaggagcccaaaaagaaaaggagaaagagaaagCAGCACAGCTCTGCCCAGCCCTGAGATGACCTGATGATCTGAAAGCTTAGCAGCAGAGCCTAATCAAGGACCATATGCACATCTACTAAAGCTCCTTTTATATGATGAGTTTAGAGAATATTCATGAGATCCTGACTGTTGCTCTTGCTAT
  5   1   2       bld Int2 5g                         IMAGE:8823687.5p                                                                                                                                                                                                                                                                                                                                                                                               ACCCTTGTTAACTAAACATTACTAAACAAATAAAACGTCCCCCGCCCTTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGTCCTGAACCATCCTTCCGCCAGCCTTTTGGTATGTCACAAGTTGTTTGTGACTGTGTGAATCAGCCAGAGTCCGTGCTGTGTTGGGAGAAGTAAACTTGTGACAGATGCACGTTTGATGCCAGAAGTTTGCCAAATGCACCCAAAAAGAACTCCAGAAGAAAGCCAGCAAGACCTAAAAGAAAGAGAAAAATAAAGCACCCTATCCTGCCCAGCCTTAAGAAGACTGATGACTTGAAGGTTTACACTAAGCTAACCAGACCCATGCCTTACTTAGCCCTTTAATGATGATAAAGAATTCATGAAATCCGTAGTGGCTCGCTATTCGACATCCGAGCGGCTATGTACAGTAATTCTAGGATGACTTTAGGGATTGGGTTCAT
  5   1   2       chi Eye1                            IMAGE:6947464.5p                                                                                                                                                                                                                                                                                                                                                                                                       TGATCCTATTTTGCTGGATTCCAAAATAAAAACAGCTGGTACGGTCCGGAATCTTCGAAATACCGGCGGGACTTTGTAACTTTTCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTTGTGAACCTGTGTTGAATCCATCCAGAAGTTCCCGTGCTTGTGCTTGGGAAGAAAGTAAAAACTTTTGTTGACCAGAATTGGTCACAGCTTTTGGATGCCCAAAAAAAGTTTTGCCCGGAGAAATGGCATCCCCCaaaaaaaaggaagacctccccccagtaaaagaagaaaacccaaggctaaaaggaaacccccaaaaaaaaaGGAAACAGCGTGGGGTAAAAAGTAAACAAATAGCCGTGGCGACCTTTAAATACCTTTGGGCCGCAAAccccccccTTTCAAGGGAATGGAACCCTCGGGGAAATGAAACATCCTTGGAAAAAAGGAGCCTTTTTCAGATCTACCGCGCAGAAAGGCCTCTTAAAAATATCCCCAAAGAGAGGTACCCCCCACTTATAATTGTCACAAACTTATTTCGCTCACCCCCATTAAAATAAAAAACCCCTTTCCTC
  5   1   2       bld Tad1 5g                         IMAGE:6879323.5p                                                                                                                                                                                                                                                                                                                                                                                                          GGGATTACGTCGGAGAGCGAGACGTGCTGCTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTTGTGACCTGTGTGAATCAGCCAGAGTTCTGTGCTGTGTTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTTGATGCCCAGAAATTTGCCCGAGATGCACCccaaaaaaagagactcccaagaaagaaaaagccagcaaaaggagccccttnnnttttttatnttttttaaaaaaaaaCC
  5   1   2       bld Int2 5g                         IMAGE:8529080.5p                                                                                                                                                                                                                                                                                                                                                                                                              AAAAANNNACATGGCCANNNGAGAACATAAATAAAATTCGTCCCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCCCAAGAAAGAGAGTCAGCAAGGAGCCCaaaaagaaaagaagaaagaagaaagCACACTGCTCTGCCCAGCCCTGAGATACTGGATAATCTAAAGCTTACACAA
  5   1   2       bld Int2 5g                         IMAGE:8824954.5p                                                                                                                                                                                                                                                                                                                                                                                                              CCCGCCCCACGCTCACAGGAGCCCCGAGCACTCGAATTCGTCCCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaagaaagagaaagagaagCAGCACCTACTCCTGCCCAGCCCTGAGATGACTGATGATCTGAAAGCCTTAGCAGCAGCTAATCAAGACCATATGCACATCTACTAAAGCTCTTTATAATGATGACTTAAGAGAAAATATTCA
  5   1   2       chi Bone      in                    IMAGE:8740887.5p                                                                                                                                                                                                                                                                                                                                                                                                                GTGGGGTTCACTGGGGGGATCACATCGTATTCAGAATTCGTCCCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTaaaaaaaaaaaaaaaaaaaaaaaagaaagaaaaaaaaGGCGGTCGCCAGGCCTGATGATCGCTAGACGCGCTGAGCATCTCACCCTggggggggCCCCAGGGCCTGAATATCCTCTAAACCGCGGCTCAGAGCCTCCTCACCCTTATAAGTGAAGCCTAATTAACGAAGATCCGAACCATGAAATACATATACTTGGATGAATTTGGAAAAACTCCTCACTTAAAATTGCGAATGCAAATAAATTGCTTTATTAGACAAATTAGGAATGCCATTGCTTTTTCTTTGTAAACCAATTACAAGGCTGCCACGAAAGAAACAGAAGT
  5   1   2      seed Int2 5g3  in                    IMAGE:8823869.5p                                                                                                                                                                                                                                                                                                                                                                                                                TGGGGGAGGAATTCGGGATTGGATCGCCACATATTCGTCCCCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaagaaaggaggaaagagaaagcAGCACCTACTCTGCCCAGCCCTGAGGATGACTGGATGATCTGAAAGGCTTAGCAGCGAGCTAATCAAGGACCATATGCCATCTACTAAAGTCTTTATATGGATGATTTAGAGAGAATATTCATGAAGTCTGACTGGTGCTGCTTATTTGGAACATTGCAGAGCTGTCATCTGTACGAGTATCAGGACTGACAGCTAAGCGCATATACAGTGTCAGCTGAACTCGTAATGGTTGCAGTACTAGTGGCGAAACAAATAGACTCATCTGTGTTTA
  5   1   2       bld Ga15 5g3  in                       XL446l18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                    CGGAGAGCGAGACGTGCTGTTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCAAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAA
  3  -1   2       bld Ga11                            IMAGE:3474782.3p                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAGCTCAGAATAAACGCTCAACTTTGGCAGTTCTGACTTCCCCGGGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACA
  5   1   2       bld Thy  5g                         IMAGE:8548631.5p                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAGTNNNNNGGGAGAACCAAAAGAATCGTCCCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCCAAGAAGAGAAGCAGCAAGGAGCCCAAAAGAAAGGANGAAAGAGAAGCGCACTACTCTGCCCAGCCCTGAGAGACTGATGATCGAAAGCTTACACAAC
  5   1   2       bld Tail      in                    IMAGE:8542169.5p                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAAANNCCATGAATNNGNGNAGGGTACTAATTAAATTCNTCCCCGGGACTTTGTACCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAGATGGCACAGTTTGATGCCAGAAGTTGCCGAGATGCGcccaaaaagagactccaagaaagagaacagcaaggacctcaaaagaaaggaagaaagagaagCGCACTACTCTGCCCACCCTGAGATGACTGAGAATCGAAAGCTTACCGCGACTAATCAGGACTA
  5   1   2       bld Tad1 5g                         IMAGE:6878560.5p                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGTGCTGCTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCagccccaaaaagagactcccaagaaagagaaagcccagcaaagagccccaaaaaagaaaaggaggaanaagaagaaaagCAGCC
  5   1   2       bld Int2                            IMAGE:8825019.5p                                                                                                                                                                                                                                                                                                                                                                                                                                CGCCCTTGAGaaaaatagtacacaaacaaaaaaaTCGTCCCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaagagaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAAGATGACCTGAATGAATCTGAAAAGGCTTTAGCAGGCAGAAGCCTTAAATCAAAGAACCATATTCCACATCCTAACCTTAAAAGCTC
  5   1   2       bld Lmb1 5g                         IMAGE:8534938.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 GCNGAGACATAAAAGAATTCGTCCCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCATCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTCTGTGNACAGATGGCACACTTTGATGCACAGAAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCCAAGATAGAGAGCCAGCAAGGAGCCCAAAAAAGACAGGCAGAAAGAGAAAGCNC
  5   1   2       bld Emb4 5g                         IMAGE:4682429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACGCGTGGGCGGACGCGTGGGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGGTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCCAAGTTCCGTGCTGGGGTGGGAAAAGTAAAACTTTGTGACAAGATGGCACAGTTTTGATGCCCAAAAATTTGCCCGAGATGCACCCCaaaaaaaaaaactccccaaaaaagaagaagcccgcccaaggaggcctcaaaaagaaaagggggggaaagaaaaaaaaGGAGCACCCTACTCCTGGCCCCAGACCCCCTGAAGGAAGACCCTGGAAGAAATCCTGAAAAAGGCTTTTACCAGCCAAAAGCCCAAAATTCAAAGGGACCCCCTATTGGCCCTTTCTAACCTAAAAAACCTCCCCTTTTATAAAGGGGATGC
  5   1   2       bld Ga12 5g3  in                         XL181h12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGGCTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGC
  5   1   2       bld Thy  5g                         IMAGE:8548330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAATTNNNNNGNGGAGAACCGATAAGGATCGTCCCCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCccaaaaagagactcccagaaagagaagcagcaaggagcccaaaagaaaaggagaaaagagaagCAGCCTACTCTGCCCAGCCCTGAGATGACTGAGATCTGAAAGCTTACACGAGCTATCAAGACATTGCCTCTCTAAGC
  5   1   2       bld Tad1 5g                         IMAGE:6938714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTCCTCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCCCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAAGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCCAGAGTCCCTGCCTGTGTTGGGAGAAATAAAACTTTTGTGACAAGAATGGCACAGTTTGATGCCCAGAAGTTTGCCGAGATGCAGCCCAAAAAAAGAGACTCCCAAGAAAGAGAACCAGCCAAAGAGC
  5   1   2       bld Ooc3 5g                IMAGE:3436315-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATTCCCCCGGGCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCC
  5   1   2       bld Te1  5g                         IMAGE:6930108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCGAGGTACCAGCATTTGAGCGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGGATGCCCAAGAAGTTTGGCCAAGATGCCAC
  5   1   2       bld Te2  5g                         IMAGE:7393582.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCTGGAAACCATCTTTCGCAGCCTTTTGGTATGTCACANNGTGGTTGTGACTGTGTGATCAGCCGAGTTCGTGCTGTGTGGGAGAGTAAACTTTGTACAGATGCACGTTGATTCAAGATTTGCCAAATCATCaaaaagaattccagaagaagccccagggccaaaagaaagagaaagaaagccccGTCTGCCACCTAGAACTG
  5   1   2       add Tad1 5g3  in                    IMAGE:6877982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGGTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAAGAGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAACCAGGTCCTGGAAACCATCGTTCCCGCCAGCCCTTTTGGTAAAGTCACCAAGGTGGGTTTGTGAACCCGGGTGAATCAACCCAAAGTTCCCTTGCTGTGGTTGGGAGAAATAAAACTTTTGTGAACAAAATGGCCCAGATTTGAATGcccaaaaaagtttgcccaaaatgcaacccccaaaaagaaaacctccgccaaaaaaaaaaaaccccccccaaagggaccccccaagaaagaaaaaggggggaaaaaggaaaaaaaagCCCCCA
  5   1   2       bld Tad1      in                    IMAGE:6877575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCCAGAATTCCGTGCTGTGTTGGGAAGAATAAAAAACTTTGTGAAAAGATGGGCACAGTTTTgatgcccaaaaagttttccccaaaatgccagccccaaaaaaaggagactcccccaggaaaagaagaaaccccagcacaaaggaagccccaacaaaaagaaaaaagggaaggaaataaggaaaaaaaacgccccccccccTTATCTC
  5   1   2       bld Tad1      in                    IMAGE:6879140.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAAGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTTGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAATTTGCCGAGATGCAGCCCAAAaagagactcccaagaaaagagaaaccagcaaaggagccccaaaaagaaaaggagggaaaagaagaaagCAGCACCTACTTCTGCCCCAGCCCCCGAAGAAG
  5   1   2       bld Tad1      in                    IMAGE:6880580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTCCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTTGATGCCCAAGAAGTTTGGCCGAGAATGCAGCCccaaaaaagaagaactcccaaggaaagaagaaagcccggcaaaagaagccccaaaaaaaaagaaaaaGGGAGG
  5   1   2       bld Te1  5g                         IMAGE:6930376.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTCTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCCGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCCGTGCTGTGTTGGGAGAAAGTAAAACTTTTGTGACAAGATGGGCACAGTTTTGATGCCCAAGAAAGTTTTGCCCGAGAATGCCAGCCCCCA
  5   1   2       add Te1  5g                         IMAGE:6930811.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCCTTGGTGTTTTAAATTCTCATCCGCAGACACGGACATTCCCTATTCGGCGAAGAGGATCACACCGGGCTTGATATAACTGTTACATGCCCCTCCTCTGGGGGCTCTAAAAAGAAGGGTCCTGGAAACCATCCCGTCCCCCCAGCCCTTTTGGGAAAATGTCCCCAGGGTGGGTTTTGTGGAACCTGGTGTGGAATCAAACCCAAAATTTCCCTGGCTGTTGTTTGGGaaaaaaattaaaaacttttgtggaaaaaaattgccccaactttttgaatgcccaaaaaagttttgcccaaaaaatcccacccccaaaaaaagaaaaaCACCCC
  5   1   2       bld Te1  5g                         IMAGE:6930759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTTGTGACCTGTGTGAATCAGCCAAGAGTTTCCCTGCTGTGTTTGGGAGAAGTAAAAACTTTGTGAACAAGATGGCACAGTTTTGATGGCCAAAAAATTTTGCCCAAGATGCAGCCCCaaaaaaaaaaaCTCCCCCAGAAAGAAGAAACCCGGCCA
  5   1   2       bld Te1  5g                         IMAGE:6930616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAAACATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAATTTGATGCCCAANAAGTTTGCCGAGATGCAGCCCAA
  5   1   2       add Tad2 5g                         IMAGE:6934084.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCTTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCCACTCCTGGGATCATGCCGTATAATAAGCAGGCCACAAAACAAGCCAAGGAGGAAAATCAAGACTGTGGCTTGGGTGTTTTTAGATTCTCATTCTGCCAAAACACGGAACATTCCCTAGTCGGCGAAGAGGGATCCCCCTGGCCCTGAATATAACTGGTTACCAGGCGTCTCCTTCCTGTGGCCTCCTTTAAACCAGGGTCCCGGGAAACCTGATCCTTTTCCGCCCAGACCTTTTTGGGGTAAATTGTGCCCCAACGGGGGGCTTTGTAGGACCCCTGGNTGGAAAAACCCAACCCCAAAAAGTTCCCCCGGGGCTATGGG
  5   1   2       bld Tad2 5g                         IMAGE:6934742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTTGATGCCCAGAAGTTTTGCCCGAGATGCAGCCCCCAAAAAAAGAGACCTCCCAAGAAAAAGA
  5   1   2       bld Tad2 5g                         IMAGE:6932390.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAACAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAACCCAAAATTCCGTGCTGTGTTTGGGAGAAATAAAACCTTTGTGACCAGATGGCACCGTTTGATGCCAAGAAATTTTGCCCCAGAATGCGCCCaaaaaaaaaaactccccaaaaagaaaaaCCAGCAA
  5   1   2       bld Tad1 5g                         IMAGE:6938219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCCCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAACCGGGTCCTGGAAACCATCCCTTCCGCCCGCCCTTTTGGGTAATGTCCACCAAGTGGGTTTGTGGACCTGTGGTGGAATTCACCCGGAGTTTCCCTTGGCTGTGTTTGGGAAAAAGTAAAAACTTTGGTGGACAAAAATGGCACCCAGTTTTGGAGGCCCAAA
  5   1   2       bld Tad1 5g                         IMAGE:6939035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCCTCTCTTCTGTGGGCTCTATAAACCAGGTCCTGGAAACCATCCCTTTCCGCCAGCCTTTTTTGGTAATGTCACCAAGGTGGGTTTGTGGACCTGGTGTTGAATCAACCCCGAAATCTCCATGGCTGTTGTCTGCGGGAGAAAATAAAAACCTTTGTGGGACAAGGATTGGGCCCACATTTTTGAATTGCCCAAAATAAATTCTTGCCCCGAAGCATAGCATACCCCCCTAAAAAAAGAGAACACCTCCCCTCACGAGCAAATGAAAA
  5   1   2       add Tad1 5g3  in                    IMAGE:6878050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGCCACAGAACAAGCCAAGGAGGAGATCCAGACTGTGCTTGGTGTTTTAAATTCTCATCTGCAGACCCGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGGTACATGCTTCTCTTCCGTGGCTCTATAAACAGGTCCTGGAAACCATCCTTTCCGCCAGCCTTTTTGGTAATGTCACAAGGGGGGCTTGTGGACCTGTGGGGAATCAACCCAAAATTCCCTGGCTGTGTTGGGGCCAAAGAAAAAACTTTCGTGACAAAGAAAGGCACAAGTTTTGATGgccacaaaaattttgcccaaaaatgccacccccccaaaaaatatacaccccctaatacaagaaaaaTCCTATCCCACGGGATTTTCACCACC
  5   1   2       bld Tad2 5g                         IMAGE:6934016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCCTTTTGGTAATGCCACAAAGTGGTTTTGTGACCTGTGTGAATTCAACCAGAATTCCCGTGCCTGTGTTGGGGAGAAATTAAAACTTTTGTGACAAAAATGGCCCAAGTTTTGATGGccaaaaaaattttgcccaaaaatgcaacccccaaaaaaagagactccccacgaaaagaaaaaaCC
  5   1   2       bld Tad1 5g                         IMAGE:6938014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAAATTCTCATCTGCCGACACGGACATTCCTAGTCCGCGAGAGGATCACACTGGGTGAAATAACTTGTTACATGCTCTCTTCTGTGGGCTCTATAAGCCAAGGGTCCTGGAAACCATCCTTTCCGCCCAGCCTTTTTGGTAATGGTCACAAGGGGGGTTTTGGTGACCCTGTGTGGAATTCACCCCAGAATTTCCCGTGGCTGGGGTTGGGGAAAAAAATATAAACCTTTTGGTGGACCAAGAATGGGCACCCAGTTTTGGAATGCCCCACACAAAGTTTTTGCCCCTAAGAATGCTACGCCCCCaaaaaaaaCCACAACTTCCCCTCCATAAAAACGA
  5   1   2       bld Tad1 5g                         IMAGE:6940587.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCCCAAGGTGGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGGTTGGGAGAAATAAAAACTTTTGTGACAAGAATGACAGTTTGGATGCCCAAGAAAGTTTTGCCCCAAGATGCCACCCCCCaaaaaaaagaagaacttcccaaggaaaaagaggaaagcccagcaaaagGGGAACCCCCAC
  5   1   2       bld Tad1 5g                         IMAGE:6938946.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCNCTTTTGGTAATGTCACAAAGGTGGTTTGGTGACCTNGTGTGAATCAGCCCAGAGTTCCGGTGCTGTGTTTGGGGAGAAGTAAAAACTTTTGTGGACAAAGATTGGCCACAAGTTTTGGATGCCCAAAGAAAGTTTTGCCCGAAGGATGCCAGCCCCCaaaaaaaaGGAAGGACTCCCC
  5   1   2       add Emb4                            IMAGE:4683970.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           ccacgcgtccgcccacgcgtccgcggacgcgtgggtTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGGTTTGTGACCTGTGTGAAATTCAGCCAGAGTTCCGTGCTGTGTTTGGGAGAAGTAAAACTTTGTGACAAGATGGGACAGTTTTGATGCCCAAGAAGTTTGCCGAGATGCAGCCcaaaaaagagactccccaaaaaagagaagccagcaaaggagccccaaaaagaaaaggagggaaaagaaaaaaGCCGCACCTTATTCCTGCCCCAGCCCCTTGAGAATGACCTGGATGAATCTGAAAAGGGTTTAACAAGCAAAGCCTAAATTAAAGGGACCCATATGCACATCTACCTAAAAAGCTCCCTTTATAATGGAAGAAGTTTAAAGAGGAAATA
  5   1   2       add Tad2      in                    IMAGE:6873399.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACAGCATACCCTGATAACTGGAGGGCATAGAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCCTGGAACCATCCTTCCGCCAGCCGTTTTGGTAATGTCACAAGGTGGCTTTGTGACCCGAGGTGAATCAGCCAGAAGTTCCCTGCCTGTGGTTGGGGAGAAGTTAAAACTTTTGTGGACAAGAAGGGCACCAGTTTTTGATGGCCCAAGAAAAGTTTTGCCCGCAAGAATGGCCACCCCCCCaaaaaaaatgaagaacctcccccccaggaaaaaagaaagaaaggccccgcgcccaaaaagggaaagcgcccccA
  5   1   2       bld Tad2 5g                         IMAGE:6934213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCCCACTGGCTGATATAACTGTTACATGCCTCTCTTCTGTGGCTCTATAAGCAGGTCCGGAAAACATCCTTTCCGCCAGCTTTTTGGTAATGTCCCCAGGGTGGTTTGGGGACCTGTGGTGAATCACCCCAAAAATCCCCGTGCTGTGGTTCGGGaaaaagtaaaaacttttgtgaccaaaatgggcaccagttttgaagccccaaaaaaatttggcccgaaaattcccaccccccaaaaaaaaagaactctccccaagaaaaagaaacaaaccccGCCTCAGAGGGAACCCCCCCAC
  5   1   2       bld Tad2      in                    IMAGE:6874736.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTTGTGACAAGATGGCACAGTTTTGATGCCAAAGAAGTTTTGCCGAGATGCAGCCCCAAAAAAGAGAACTccccaagaaaggagaaacccagcaaagggagcccccaaaaaaggaaaaagggagggaaaaaGAAGCAAC
  5   1   2       bld Tad2      in                    IMAGE:6875056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCCGTGCTGTGTTGGGGAGAAGTAAAACTTTGTGACAAGATGGCACCAGTTTGATGCCCAAGAAGTTTGCCCGAGATGCAGccccaaaaaaagagactccccaaaaaaGAGGAAGCCCGGCAAAGGGAGC
  5   1   2       bld Tad2 5g3  in                    IMAGE:6876456.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAANGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGNTTGCCGAGATGCAGCCCCAAAAAGAGACTCCCcagaaagagaaagcagcaaaggagccccaaaaaagaaaagggagaaaaagaaagaaaGCAGGCACCTAC
  5   1   2       bld Tad2 5g                         IMAGE:6875799.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGGAATGTCACAAGGGTGGTTTGTGACCTGTGGGAATCAGCCAGAGTTCCGTGCTGTGTTTGGGAGAAATAAAACTTTGTGACAAGATGGGCACAGTTTGGATGCCAAGAAAATTTTGCCCGAAATGGCACCCCCAAAAAAGAGACTTCG
  5   1   2       bld Tad2 5g                         IMAGE:6875294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCCGTGCTGTGTTGGGGAGAAGTAAAACTTTTGTGACAAGAATGGCACAGTTTGGATGCCCAAGAAAGTTTGCCCGAGGAATGCAAGCCCCAAaaaaggaagacttccccaanaaaagaagaaagcccagccaaaggggaggcccccaaaaaagA
  5   1   2       bld Tad2 5g                         IMAGE:6875400.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCCTTCGCCAGCCTTTTGGTAATGTCCCCAGGCGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGGGTTTGGGAGAAGTAAAACTTTGTGACCAGACGGCACCGCTTGGATGCCCAAGAAGTTTGCCCGAGATGGCCGTCCCCaaaaaaaaagaactcccccagaaaaaaagaaagcccaccccaacgggagcccccccaaaaaaaggaaaaaGGGCGGGGGAACCACGCAAAAACAAGCCAGCTCCTCCCTTACCCC
  5   1   2       bld Gas9 5g                              BG409788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACGCGTCCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCANGTCCTGGAACCATNCTTNCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATNACCAGAGTTCCGTGCTGGGTTGGGAGAAAGTAAAACTTTGTGACAAGATGGCACAAGTTTGATGCCAANAAGTTTGCCGAGATGCAGCCCAAAAT
  5   1   2       bld Tad2 5g                         IMAGE:6876012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTTCTCCTCGCACGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCCTTTTGGTAATGTCACCAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTTGCTGTGTTGGGGAGAAAGTAAAACCTTTGTGACAAAGATGGCACAGTTTTGATGGcccagaaagtttgcccgaaaatgccagccccaaaaaagagaacttccccaagaaaagaagaaaggccagccaaagggaagccccaaaaaaagaGC
  5   1   2       bld Tad2 5g                         IMAGE:6875987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAACGAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGAGAAACTTTGTGACAAGATGGCACCGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAggaaagagaagcccgcaaaggagccccaaaaagaaaaggagggaaagaagaaagCAGCCCCTACCTCCGCCCCAGCCCCCGAGGATGACCCGGGATGAATTTGGAAAGGGCTTTAGCAGCCAGAGCCCCAAATCCAAGGGGACCCCTAATGCCCCCTTCTACCCTAAAAGGCCCCCTTTTAATTAGGGGAGCGAGTTTTAACAAGGGAATTTTTCCCACATGGGAGAGaaacccccggaacggttggcccccggccctaaaattccggggggaccccccttttccccAAGGAAAAGGCCTGGGCCCCCACCTGGC
  5   1   2       bld Sp1  5g                         IMAGE:5511181.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACGCGTCCGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAAAAGAGACTCCCNAGAAAGAGAAGCCAGCAAAGGAGCCCAAANAAGAAAGGATGAAAGAAGAAGCAGCACTGCTCTGCCCAGCCCTGAGATGAC
  5   1   2       bld Emb4 5g                         IMAGE:5543419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACGCGTGGGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAACCAGAGTTCCGTGCTGTGTTGGGAGAAATAAAACTTTTGTGACAAGATGGCACAGTTTTGAGGCCAAGAAGTTTTGCCGAAATGCCACCCCaaaaaaaaaactccccaagaaagagaaagcccgccaaagggccccaaaaaagaaaaaggacggaaatgaaaaaaagcgagcacctggttcctggccccccccccGCTGGAGGATGACCTGGGAATGAATTCCTAAAAGGGTTTTAGCCGGCCGAAGCCTCTCAATCTAAGGCGACCCCTTTTTGCCTTATTTGAGCTTCAAAGGCTCCCTCTTATAAGAGGGGTGGCGCCGACCCCGACGGATACTTCTGCCCCGGTGG
  5   1   2       bld Int2                            IMAGE:8527924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACCACACATCGGTGNGNNNNGAGATCAATGAATGAATTCGTCCCCCCTGATACTGGAGGGCATAAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAAGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAAGATGGCCAATTTGATGCCCAGAAGTTGCCGAGATGCAGCCAAAAAGAGACTCCCAAAAAGAGAAGCCGCCAAGGAGCCCAAAAATAAAGGATGAAAGAAAAGGCGCCCTACCTTGCCCACCCCGAGGAGACTGGATGATTAAAAGCTTACACAAACTAAACAAGACCATGCACT
  5   1   2       bld Neu3 5g                              AW871961.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGCGTCCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTG
  5   1   2       bld Brn1 5g                         IMAGE:6955830.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCGGGATCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagccaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCCTACTCCTGCCCCAGNCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTTAGCAGCAGAGCCCTAAATCAAGGACCCATATGCACATTCTACCTAA
  5   1   2       bld Sp1  5g                         IMAGE:4965053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCACGCGTCCGGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTcccaagaaagagaagcctagcaaggagtctaaaaagaaaatgaagaaaagaagaagCAGCACTACTTCTGCCCAGCCCTGAGATGACTGGAG
  5   1   2       bld Ga15 5g                            XL435n08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCTCCGGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGA
  5   1   2       bld FaB  5g3  in                    IMAGE:8070368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCTCGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAGAAAGAGAAGCCAGCAAAGGAGCCC
  5   1   2       bld Ov1  5g                         IMAGE:5048968.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGACCCACGCGTCCGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGT
  5   1   2       bld Emb4 5g                         IMAGE:5536401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCcaagaaagagaagccagcaaaggagccccaanaagaaaaggaggaaaagaagaagCAGCACCTACTCCTGCCCCAGCCCTGAGGATGACTT
  5   1   2       bld Emb9                            IMAGE:7974882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGGTCCGGATTCCCGGGATCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTCTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAAGATGGCACATTTTGATGCCAAGAAGTTTGCTGAGATGCCACCCAAATAAGAGACTCTCAAGAAGGAAAACCATGCAAGGATCC
  5   1   2       bld Ooc3 5x3  out                   IMAGE:3436315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACACAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTGTAGATTCTCATATGCAGACACAGACATTCCTAAGTCGCGAGAGG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4965458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACCCACGCGTCCGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTT
  5   1   2       bld Emb4 5g                         IMAGE:5572543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTNGTTGNGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggagggaaagaaagaaagCAGCACCTACTCCTGCCCCAGCCCCCCTGAGGATGAACCTGGGATGAATCTGGAAAAAGGGCTT
  5   1   2       bld Tad2 5g                         IMAGE:6932575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTTGATGCCAAGAAAGTTTGCCCGAGATgcagccccaaaaaaagagactccccaaggaaaagagaaagccaggcaaaaaggagcccccaaaaaaaaC
  5   1   2       bld Tail 5g                         IMAGE:8543384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANNAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAA
  5   1   2       bld DMZ  5g3  in                         xl309p23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGA
  5   1   2       bld DMZ       in                         xl298o11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATATNNAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCG
  5   1   2       bld DMZ       in                         xl297o11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCG
  5   1   2       bld Kid  5g                         IMAGE:7011986.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAAGTTGCCGAGATGCA
  5   1   2       bld Emb4 5g                         IMAGE:4930524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACGCGTGGGGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAAAGTAAACTTTGTGACAGATGGCACAGTTTGATGCCAAGAAGTTTgccgagatgcagcccaaaaaagagactccccagaaagagaaagcagcaaaggagccccaaaaaagaaaaggaggaaaagaagaaagCAGGCACTACTCCTGCCCCAGCCCCCTGAGATGACCCTGGATGGAATCTGAAAAAGGCTTTTANCCAGCAGAAGCCTAAAATCAAAGGGACCCANTATGCCACATTCTAACCTAAAAAGCCTCCCTTTTTAAAAGGGGAAAGGAAATTTTTAAGAAAGGAA
  5   1   2       bld Emb1 5g                         IMAGE:6631927.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACGCGTGGGGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGNGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAAAAGAGACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCCAAAAAAGAANAGGAGGGAAAAGAAGAAAGCAGCACCTGCTCCTGCCCCAGCCCCCTGGAGGAATGACCTGGATGAAAATCTGAAAGGGGCTTTAGCAGCAGGAGCCTAAATCAAAAGGGACCCCATATN
  5   1   2       bld Em10 5g                         IMAGE:8321546.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCGAAGATGGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTTAGGTCATTCAGTGGGTTAGCTTCTCAAACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACATAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTTCTCATCTGCAGACACGACATTCCTAGTTGGCGAGAGGATCACACTGGCTGATAAAACTGTTACATGCTCTCTCTGTGGCTCTA
  5   1   2       bld Thy  5g                         IMAGE:8548882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCgagatgcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaggatgaaaagaagaaagcAGCACCTGCTCTGCCCCAGCCCCTGAGGATGACCTGGATGATCTGAAAGCTTTAGCAGCAGAGCTAAATCAAACGACCCATATGCACATCGTCTTAGAGCTCTTTATATGGATGAGTTCAGAGTAATATCCATGAGAATCCTGGACTGTGGCTCTGCCTTATTTCTGCA
  5   1   2       bld Int2                            IMAGE:8528803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGAGCATCNATTGAATTCGTCCCGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCcaaaaaagagactctcagaaagagagtcagcaaggagccaaaaagaaaggaggaaagaagaagCGCACTACTCTGCCCAGCTCTGAGAGACTGGAGATCTGAAGGCTTACACGAGCTAATCAAGACATTGCCTCACTAAGCTCTAATGAGATT
  5   1   2       bld Int2 5g                         IMAGE:8530900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCCAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCA
  5   1   2       bld Ga18      in                       xlk71a07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCNCGAAGATGGCCGNNNNNNTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTNCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGNTCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGNNCCTGGAANCATCCTTCCNCCAGCCTTTTGGNNATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGANTCCGTGCTGTGTTGGGAGAAGNAAAACTTTNNNACNAGNTGGCNCAGTTTGATGCCANGAAGTTTGCCGAGNNGCANCCCAAAAAA
  5   1   2       bld Tbd5      in                    IMAGE:3579579.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGCCGGCGGGACTTTGTCACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATTGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGATAATCTCCCCTTAGGCNAAGGTACACAGCATTATGAGGGCAATAGACTGGTTTTTCGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCANGTCCTGGAACCATCCTTCCGC
  5   1   2       bld Te1  5g                         IMAGE:6927912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAAGATGGCCGGCGGAACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGCGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTAACATGCTCTCTTCTGTGGCTCTATAAACAGGGTCCTGGAAACATCCTTCCGCCAGCCTTTTTGGTAATGTCACAAGGATGGTTTGTGACCCTGTGTTGAATCAGCCCAGAGTTCCCGTGCCTGGTGTTGGGGAGAAAGTAAAAACTTTTGGGACAAAGATGGCCCACAGTTTGAATGCCCCAAAAAAATTTTGGCCCCAAAATGGCACATCCCCATAATAAAGGAGACCTCCCCCCAGGCAAAAGAGATGAAAACCCCATCCCAAAACGT
  5   1   2       bld Sp1                             IMAGE:5511288.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCACGCGTCCGGGCGGGACTCTGTACACATACCCTGATAACNTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAAAAGAGACTCCCAAGAnagagaagccagcaaaggagcccaaaaaagaaaaggagaaagaagaagCAGCACTGCTCCTGCCAGCCCTGA
  5   1   2       bld Brn1 5g                         IMAGE:7019450.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTGACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTCTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCgagatgcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaaagaagaaagCAGGCACCTTACTCCTGCCCCCAGGCCCCCTGAGGATTGACCTGGAATGGAATCTTGAANAAAGCCTTTTAGCCAGCCAGAAGCCCTTAAATTCCAAAAAGAACCCCATTAATGGCCACAATTCTTAACCCTTTAAAAAGGCCTCCCCCTGTTATATAAAAC
  5   1   2       bld FaB  5g                         IMAGE:8071956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACCTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAAGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAATAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCCccagaaagagaagcagcaaaggagcccccaaaagaaaggaggaaagaagaagCGCCCCTCT
  5   1   2       bld Em10 5g                         IMAGE:8322177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGA
  5   1   2       bld Spl  5g                         IMAGE:8460464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAGTTTGCCGGATGCAGCCCAAAAGAGACTCCCAGAAGAGAGCAGCAAGGAGCCAAAAGNAAGAGAAAGAGAAGCGCCTCTCTCCCAGCCTGAGATACTGATATCTAAGCTACACGACTATCAGACTTCCTCTCTAGCCTTATGAGATAAGAATCAGAATCGAGTCTCTTCGACTGAGA
  5   1   2       bld Tail 5g3  in                    IMAGE:8541791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGGACCATCCTTCCNNGCAGCTTTTGGGTATGTCACAAGGTGGTTTTGTGACTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAGTAAAACTTGTGACAAGAGGCACAATTTGATGCCAGAAGTTGGCGAGATGCCACCAAAAAGAAAATCCCAGAAAAGAAGCCGCAAGGAGCCaaaaaaaaaggagaagaaaaaaCCCCCTCC
  5   1   2       bld Lmb1 5g                         IMAGE:8535503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAAGAGGCACAGTTTGATGCCAAGAAGTTGCCGGATGCAGCCCAAAAGAGACTCCCAGAAAGAGAGCAGCAAGGAGCCCAAAAGAAAGGAGGAAAGAGAAGCGCCTACTCTGCCCAGCCTGAGAGACTGATGATCTGAAGCTTACACGAGCTATCAAGACATT
  5   1   2       bld Lmb1 5g                         IMAGE:8534548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGAGTAACAAATAAGACACCCGAGTTCCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTGCACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGAGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCCCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAGATGGCACAGTTTGATGCAAGAAGTTTGCgagatgcagcccaaaaaagactcccagaagagaagcagcaaggagcccaaaagaaagagaaaAAGAAGCGCACTGCTCTGCCCACCTGAGAGACTGATGATCTGAAGCTTACACAAGCTATC
  5   1   2       bld Spl  5g                         IMAGE:8461413.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAGATGGCACAGTTGATGCCAGAAGTTGCcgagagcagcccaaaaagagactccagaagagagcagcaaagagccaaaaagaaaagagaaagagaagcGCCCTCTCTGCCAGCCTGAGAGACTGAGATCTGAAGCTACACGACTATCAAGACTTGCCTCTCTACTCTAATGAGATAAGAATCAGAATCGAGTCTCTATTGACTT
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8532030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCagcccaaaaagagactcccaagaaagagagccagcaaaagagcccaaaaagaAA
  5   1   2       bld Int2 5g                         IMAGE:8527768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAGATGGCACAGTTTGATGCCAAGAAGTTTGCgagagcagcccaaaaagagactcccagaaagagaagccagcaagagcccaaaagannagagaaaagagaagCGCACTACTCTGCCCAGCCTGAGATACTGATGATCGAAAGCTTACACAAACTATCAAGACTAGCCTCTCTAACTCTAATGATGATAAGAATCATGAACTGAGTCTC
  5   1   2       bld Thy  5g3  in                    IMAGE:8550970.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCagcccaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaagaaaaGAGGAAAGAGAAGCAGCACCTGCTCTGCCCAGCCCTGAGATGACTGATGATCTGAAAAGCTTTAGCAGCAGAGCTAATCAAGGACCATATGCACATCTTCTAAAGCTCCTTATAATGGATGAGTTAAGAGGAATTATTCAAATGAAGAACCCTGACTGTTGCCTCTGCCTATTTGGAGCACTTGACAGAGCTGTTCTCTGTACGCAGATAATTCCGGACTGACAGCCTTAGACTGCACTATACGGTATGTCAGCTTGCCACTGCTACTGGCTTGCAGTCATCTTGTGTGTCGCCACATCAGATG
  5   1   2       bld Panc 5g3  in                    IMAGE:8734289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCgagatgcagcccaaaaagagactcccaagaagagaagccagcaaaggagcccaaaaagaaaagAGAAAGAGGAAGCAGCACCTACTCTGCCCAGCCCTGAGATGACTGATGATTCTGAAATGCTTAGCAGCGAGCTAAATCAAAGACATATGCAATCTACCTAAGCTCTTATATGGATGAGTTTAGAGGAATATTCAATGAAGATACCTTGAACGGTG
  5   1   2       bld Emb4 5g                         IMAGE:5543079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTNGGGAGAAGTANAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAAAAGAGACTCCCAAGaaagagaagccagcaaaggagccccaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCCTGAAGATGACCTGGATGGATCCTGAAAAGGCTTTAGCAGCAAAAGCCTAAATCAAAGGGGACCCATATGCACATCTAACCTAAAAAGCTCCTTTTAATAATGGGATGAGCTTT
  5   1   2       bld Te2N 5g                         IMAGE:7766553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAATAAAACTTTGTGACAAGATGGACAGTTTGATGCAAGAAGTTTGCGAGATGCACCtaaaagagactccagaagagagtcagcaagagtcaaaagaaatgagaagagaagCACACTCTCTGCTAGCCTGAGAGAC
  5   1   2       bld Emb9 5g                         IMAGE:7974558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCTTCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAATCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCATCCAGAGTTCCGTGCTGTGTTGGGAAAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGTCAAAAAATATGCCGAGATGCACCCCAAAAAAGAGACTCCTAAAAAGAATATCTTCTAA
  5   1   2       bld FaB  5g                         IMAGE:8071782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCgagatgcagccccaaaaagagactcccnagaaagagaagccagcaaaggagcccaaaaagaaaagaagaaagaagaagCAGCC
  5   1   2       chi Brn3                            IMAGE:8537361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATNNTNNCCAGCATAGNNNGAGAAGATCAATAAAATTCGTCCCGGAGGGCATACAGCCCCTCATCGCTGCTCACTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGACTTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCgagatgcagcccaaaaaagagactcccagaaagagagccagcaaggagccaaaaagaaaagGAGAAAGAGAAGCAGCACTACTCTGCCCACCCTGAGATGACTGAGATCGAAAGCTTACACAAGCTATCAAGACCTATCCTCTCCAAGCTCTTATGAGATTAAGATATCAGATACTGCGTGCTCTATCTGCCTGAAGAGTGCTCGTCAATATTCAACAACTTAC
  5   1   2       bld Thy  5g3  in                    IMAGE:8549245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGCGAAGATGGCCGGCGGGACTTTGTACCATCCTTTGAGGACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCGTGCTGTGTTGGGAGAATAAAACTTGTGACAGATGGCCAGTTTGATGCAAGAAGTTGCCGAATGCACCCaaaagagactccaaaagagaaccgcaaggaccaaaagaaggagaaaaaaagaGCCTATCTGCCATCCAAGAACTGTGACTAAAGTTCAAAACTACAAGACCATCACACTAACTTAAAGAGTATGAATCAGAAACCATGCTCATCGC
  5   1   2       bld Ga18      in                      xlk149m16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GNNAAGATGGNCGGCGGGNNTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGNTTGCCGAGATGCagcccaaaaaaagagactcccaagaaagagaagncagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGNCCCAGCCCCTGAGGNTGACCTGGATGAATCTGAAAAGNNTNNNNNNCAGANNNTAAATCAAAGGNNCCATATGCNCATCTACCTAAAGCTCCTTTATAATGGANGAGTTTAAGAGGAANATTCAAATGAAGATACCCTGACT
  5   1   2       bld DMZ  5g3  in                         xl253n12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCA
  5   1   2       bld Eye1 5g                         IMAGE:6945459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAAAAGAGACTCCCAAGANAGAGAAGCCAGCAAAGGAGCCCaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCANGCCCCTGAAGATGACCTGGATGAATCTGAAAAGGGCTTTAGCAGCAGAAGCCTAAATCAAAGGGGACCCATATGCACCATCTACCCTAAAAAGCCTCCTTT
  5   1   2       bld Kid  5g                IMAGE:4031569-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7975824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCACCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTGTGACAAGATGGCACAATTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAA
  5   1   2       bld FaB  5g                         IMAGE:8073428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGAAGATGGCCGGCGGGACTTTGTCCCTTACACTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGANCAGATGGCACAGTTTGATGCCAAGAGGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAGGAAAGAGAGCCAGTCAAGGAGCCTCAAAAGAAAAGGAGAAAAGAAGAAGCAACACTACTC
  5   1   2       bld Int2 5g                         IMAGE:8529913.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCCAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAACAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAACCAGAATCCGTGCTGTGTTGGGAGAATAAAAACATTGTGACAAGAAGGACAGTTTGATGCAAGAATTTgccaaatgcacccaaaaaagactcccaaaaaagaaaccgcaaggagcccaaaaaaaagaagaaaaaaaaacacccctctctgccccccccGAGAGACTGGAAATCAAAAG
  5   1   2       bld Spl  5g                         IMAGE:8461638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACtcccaagaaagagaagccagcaaggagcccaaaaagaaaggaggaaagaagaagCAGCACTACTCTGCCCAGCCCCTGAGTGACTGNATGATCTGAA
  5   1   2       bld Spl  5g                         IMAGE:8462795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAGATGGCACAGTTTGATGCCNAGAAGTTGCCGAGATGCAGCCCAAAAAGAGATCCCNAGAAGAGAAGCAGCAAGGAGCCCAAAAGNAAAGAGGAAAGAGAAGCGCACTACTCTGCCCAGCCTGAGATGACTGAGATCTGAAGCTTACACAAGCTATCAAGACATTGCATCTCTAAGCTCTAATGATGATAAGATTCATGATACGCT
  5   1   2       bld Brn3 5g                         IMAGE:8536685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCCCAGAAAGAGAAGCAGCAAAGGAGCTCTAAAAGATAGGAGGAAAGAGAAAGCACACTGCTCTGCTCAGCCCTGAGATGACCTGAGATCTGAAAGCTTACAGCAAC
  5   1   2       chi Thy                             IMAGE:8549810.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGATCAAGCAGATGTCCTGCTGTGTTGGGAGAATTAAACTTTGTGACTAGATGCACAGTTTGATGCCTATAATTTCCCTATATCAGCCCAAAAATCAATCCCATGAAAAATATCAGCAAAGAGCCATAAAATAAAGGAGAAATGAGATAGTTCCCTACTCTGCTCCTTCCCGATGA
  5   1   2       bld Egg1 5g                            PBX0127C09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGAGGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGA
  5   1   2       bld Emb4 5g                         IMAGE:5571649.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGcagcccaaaaaagagactccccagaaagagaagccagccaaaggagcccaaaaaagaaaaggagggaaaagaaaaaaaGGAGCCACTGGCTCCTTGCCCCAGCCCCCTGAAGGATGACCCTGGGATGAAATCCTGAAAAGGGTTTTTACCAACCAGAGCCCTAAATTCAAAGGGACCCCCTAATGCACATTCTTTCCTAAAAAGCTTCC
  5   1   2       bld Kid  5g                         IMAGE:4031569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAATAAAACTTTGTGACCAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATgcagcccaaaaaagagactcccaaggaaagagaagccagccaaagagcccaaaaaaagaaaaggaggaaaaCGAGAAAGCAGCACCTACTCCTGCCCCAGCCCCCTGAGGATGACCTGGGATGAATCTGAAAAAGCTTTTAACAGCCAGAGCCTAAATCCAAGGGACCCATATTGCCCATCTACCCTAAAAAGCTCCTTTTATNATGGGAAGAAGTTTTAGGAAGGAAACATTTCCAATGGAAGAATCC
  5   1   2       bld Emb1 5x                         IMAGE:6631788.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGGAGGAGATNCAGACTGGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAAGAGGATCACACTGGGCTGGATATAACTGGTACATGGCTCTCCTTCTGTTGCTTCTATAAAGCAGGGTCCTGGGAAACCATCCTTCCCGCCAAGGCTTTTTGGGAAATGGCCCCAAAGGGGGGTTTGGTGGACCCGGGGTGGAAATCAACCCAAAAATTTTCCCCGGCTTGGGTTTGGGGaaaaaataaaaaacttttttgggacaaaaaatggggccacatttttgatggcccacaaaaaattttggcccaaaaaatggagccccccaaaaaaaaaaaaggctttcccccaaaaaaaagaaaaaaacccccgccaaaagggggcccccccccaaaaaaaaaaaaggggggggaaaaaaaaaaaaaaaaaGGGGGNTCCCTTTTTTTCTTTGGGGCCCCACAACCCCCTCTGGGGGAGAAGAACCACCGCGGGaaaaaaattttcgaaaaaGAGGGGTTTTTTATACAACG
  5   1   2       bld Sp1  5g                         IMAGE:5506743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAAAAGAGACTCCCCAGAAAGAGAAGCCAGCAAAGGAGCCCCNAAAAGAAANNGANGANAGAAAGAAGCAGCACCTACTCCTGCCCAGCC
  5   1   2       bld FaB  5g                         IMAGE:8073310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAACCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACATTTTGATGCCAAGAAAGTTGCCGAGATGCAGCCAAAAAAGAGACTCCCAAGAAGAGAAGCAGCAAAGGACCCaaaaaaaaaagaagaaagaaaaaaCCCCACTGCTCTG
  5   1   2       bld Ov1  5g                         IMAGE:8330874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAACGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAAGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTTAAACTNTGTGACAAGATGGCACAGTTTGATGCCAAAAAGTTTGCGA
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8533267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGAACAGATGGCACAGTTTGATGCCAAGAAGTTGCCGAGATGCAGCCCAAAAAGAGACTCCcagaaagagaagccagcaagagctcaaaagaaaggaggaaagaagaagcACACTACTCTGCCCATCTTGAGATACTGGAGATCTGAAAGCTTACACGAGCTAATCAAGA
  5   1   2       bld Thy  5g                         IMAGE:8548492.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAGAAAGAGAACCAGNCAAGGAGCCCAANNNAAGAAAGAGGAAAGAAGAAGCAGCACTACTCTGCCCAGCCCTGAGATGACTGATGATCTGAA
  5   1   2       bld Kid                             IMAGE:4033192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACGCGTGGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTNGTTGNGAGAAGTNAAACTTTGTGACAAGATGGCACAGTTTGATGCCCAGAAGTTTGCCGAGAtgcagcccaaaaaagagactcccaagaaagagaagccagcaaacaggagccaaaaaagaaaaaggaggaaaagaaagaaagCCAGCACCTACTTCCTGCCCCAGCCCCCTGGAGGATGACCNTGGNATGNAATCTGGAAAAGGGCTTTAAGCAGCAAGAGCCCTTAAATCAAAAGGGACCCCATAATGGCACAATTCTACCCTAAAAAAGCTTCCCT
  5   1   2       bld Ga15      in                       XL508a18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL508a18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCAGCAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAG
  5   1   2       bld FaB  5g                         IMAGE:8073497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCCCAAGAAGAGAA
  5   1   2       bld Bone 5g3  in                    IMAGE:8739750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGTGGTTTGTGACCTGTGTGAATCAGCAGAGTTCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAGATGCACAGTTTGATGCAGAAGTTTGCCGAGATGCAGCCAAAAAGAGACTCCAGAAAAGAAGCAGCCAGAACAAAAGAAATGGAGGAAGAGAGGCAACTATCTGGCCAGCTGAGATGACTGATGATGATGCTTAGCCAGCTATCAGGACCATGGCACTCACGTAGCT
  5   1   2       bld Panc 5g                         IMAGE:8738954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATgcagcccaaaaaagagactcccaagaagagaagccagcaaaggagcccaaaaagaaaagagaaaagagaAGCAGCACTACTCCTGCCCAGCCCCTGAGATGACTGAATGATCTGAAGCCTTAGCAGCGAGCTAATCAAGACCATATGCCACATCTACTAAAAGCTCCTTTTAATATG
  5   1   2       bld Bone 5g                         IMAGE:8744034.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGAtgcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaagaaagGAGGAAAGAGAAGCAGCACCTACTCCTGCCCCAGCCCTGAGATGACCTGGATGATCTGAAAGCTTAGCAGCAGAGCTAATCAAGACCATATGCCATCTACTTAAGCTCTTATATTGATGAGTTAGAGAAATATTTCAAATGAAGGATCCCTGAACTGGTGTGCCTCTCTGGCCTA
  3   1   2       bld Bone      in                    IMAGE:8740887.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTCTTTTTCCAGCCC
  5   1   2       bld Sp1  5g                         IMAGE:5505973.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCCCAGAAAGAGAAGCAGCAA
  5   1   2       bld Te2N 5g                         IMAGE:7766294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGAT
  5   1   2       bld Tail      in                    IMAGE:8542549.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGC
  5   1   2       bld Spl  5g                         IMAGE:8461665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAGAAAGAGAAGCAGCAAGGAGCCCAAAAGAAANNGAGAAAGAAGAAGCGCACTACTCTGCCCAGCCCNTGAGATGACTGAGATCTGAAAGCTTACAG
  5   1   2       bld Spl  5g                         IMAGE:8462293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAGATGGCACAGTTGATGCCAAGAGTTTGCgagatgcagccaaaaagagactccagaagagagcagcaagagccaaaagaaagagaaagagaagCGCCTCTCTGCCAGCCTGAGAGACTGAGATCGAAGCTTACGCGACTATCAGACTTGCATTCTAACTCTAATGAGATAAGA
  5   1   2       bld Ga18 5g3  in                      xlk139h24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATGGNCGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGNTCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGNAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTNNCGAGATgcagcccaaaaaagagactcccaagaaagagaagncagcaaangagcccaaaaaagaaagGAGGAAAGAAGAAAGCAGNACCTACT
  5   1   2       bld Gas5 5g3  in                    IMAGE:3751548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACAGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTA
  5   1   2       bld Tad1 5x                         IMAGE:6936846.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAACCCGAGTTCCGTGCTGTGTTGGGGAGAAGTAAAAACTTTGTGACAAGATTGGCACAGTTTGATTGCCAAGAAATTTTGCCCAAAATGCAACCCCCAAAAAAGAAGACTCCCCaaaaaaaaaagaaagctaggcacaaaggagccccaaaaaaagaaaaaaggaagggaaaaaggaaggaaaaGCC
  5   1   2       chi Emb9      in                    IMAGE:7976606.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGGTCCGGATTCCCGGGATCACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAATCACTCTTTTACATCTTGCTCAGGTTCATTTAGGTGGGTTATCTTCTTATTATAGTCACATTGTCCTTCTGGTCTTCTCTTGGTTATTTTCCTATTCTTGGGATACTGTTACTTTTTTTGCAGGCTGTTATATATTGCTCGGTATTATATCACTACGGTGCTACGGTGTCATATGTTCTTTACGTCACATTCACTATTGATTGTTCTCTCTCATATATATTTATTGTTCtgtttattgttttatatgtacttattttttaattttttgtacctgttttgttttATGTTATGATTCATATTTGTTGATTATGTTTCTACTTTTATTTCTATTATGATTTACGTTTGTAATTTGCATTTTGTGTATGACATAGTTTATCttttttttACTTCTTAGTTGTACTCTTCTTAATATTATGTCTGAATCTTTTTATGTTGTATTTTATTCCAAGTTGGTGTTAGTTcttattttttattttcatgttttatgattttCTA
  5   1   2       bld Bone 5g3  in                    IMAGE:8739322.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGcagcccaaaaaagagactcccaagaagagaagccagcaaaggagcccaaaaagaaagagaaaagagaaaGCAGCACCTACTCCTGCCCAGCCCTGAGATGACCTGATGATCTGAAGCTTTAGCAGCAGAGCTAATCAAAGACCCATATGCCATCTACTAAGCTCTTTTATATGATGGCTTTAAAGAATATCATGAGATTCTGACGTGCTGCTAGTCCGGAACACTTGTGCAG
  5   1   2       bld Gas5                            IMAGE:3750457.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACAGACATTCCTAGTCTGCGAGAGGATCACACTGGCTGATTTAACTGTTACATGCTCTCTT
  5   1   2       bld He1       in                    IMAGE:4406871.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAAGTCCTGAAACCATCCCTTCGCCAGCCTTTTGGTAATGTCAACAGGGGGGTTGTGACCTGTGTGAATCAACCC
  5   1   2       bld Sp1       in                    IMAGE:4175713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCATACGGGGGCACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGNGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACCTTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTA
  5   1   2       bld Brn1      in                    IMAGE:6950753.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAAAGATGGGGACTTTGTACCATACTCTGATAACTGGAGGGATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAgcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGAATGAATCTGAAAAGGCTTTAGCACCAGAACCTAAAATCAAGGGACCCATATGCACATTCTACCTAAAAACTCCCTTTAAAAGGGATGAATTTTAGAGGAAAAAATTCCA
  5   1   2       bld FaB                             IMAGE:8072432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAAAGTTCCCTGCTGTGTAGGGAGAAGTAAAACTTTGTGACAAGATGGACAGCTTGATGCCAAGAAGTTTGCCGAATGCAGCCcaaaaaaagacccccaatataaaaaacctgcaacgaaccctaaaagaaaGGAGGATAGAAGAAAGCCCACCTACTCCTGCCCCGCC
  5   1   2       bld Ov1       in                    IMAGE:8329164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANNAAAGAGACTCCCAAGAAAGAGAAGCCAGNCAAGGAGCCCAAAAAAGAAAGG
  5   1   2       bld Lmb1      in                    IMAGE:8531968.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAA
  5   1   2       bld DMZ       in                         xl241d16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCA
  5   1   2       bld Sp1                             IMAGE:5512358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAAAAGAGACTCCCNAGAAAGAGAAGCCCAGCAAGGAGCCCANANNAGAAAAGANGAANAAGAAGAAGCAGCACCTGCTCCTGCCCCAGCCCTGAGGGATGACTGNATGAATCTGAAAAGGG
  5   1   2       bld Sp1                             IMAGE:5512317.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAANAGAAANNGAGGAAAGAAAGAAGCAGC
  5   1   2       bld Kid                             IMAGE:7011707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCANAnaagagactcccaagaaagagaagcccagcaaggagcccaaaaaagaaaagaggaaagaagaagCAGCACTACTCTGCC
  5   1   2       bld FaB                             IMAGE:8072733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGAACAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGcccaaaaagagactccccagaaagagaagccagcaaaggagcccaaaaagaaaaggaggaaaagAAA
  5   1   2       bld Bone                            IMAGE:8743294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCCAGAAGTTTGCCGAGATGCAGcccaaaaaagagactccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggagaaagaGAAGCAGCACCTACTCC
  5   1   2       bld Tbd2      in                    IMAGE:3201015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCA
  5   1   2       bld He1       in                    IMAGE:4408279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTT
  5   1   2       bld Emb4      in                    IMAGE:4959659.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCTTTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTT
  5   1   2       bld Emb4                            IMAGE:4930513.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCNAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAANCAAGCCAAGGAGGAGATCAAGACTGGGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaagggagggaaagaagaaaagcagcaCCTACTCCTGGCCCAACCCCTTGAGGATGACCTGGGATGAATCTGAAAAGGCTTTTACCACCAGAACCCTAAATCCAAGGGACCCCTATGCCCCATCTACCCTAAAAAGCCTCCTTTTTAAAGGGGATGAAGTTTTAAAAAGGAAAAATTTCTCAAATGG
  5   1   2       bld Emb4                            IMAGE:5572668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGTCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGCAAAGAGAAGCCAGCTCAGGAGCCCCTGAAAGAATAGGTAGGAAAAGGAGAAAGCAGCACCTACTCCTGGCCCCAGCCCCCCTGAGGATGAACCTGCCATGAAATTCTGAAAAAAGGTTTTAGTCAGCAAGAGCCCTAAATCACAAAGGGGACGCCGTATTGCACCTTCCTACCCTAAAAA
  5   1   2       bld Eye1                            IMAGE:6947767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACCAGATGGCACAGTTTTGATGCCCAAGAAGTTTTGCCCGAGAATGcaacccccaaaaaaagagaactccccaaggaaaagaagaaagcccaggcaaaaagggaggccccaaaaaaaaagaaaaaaagggaggggaaaaaaggaaagaaaaaggccaaggcaacccttaactttccctgggcccccccaaagcccccACCTTGGAAGAGGAAATA
  5   1   2       bld Sp1                             IMAGE:5513406.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTCCGTATACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCNCAGAAGTTTGCCGAGATGCAGCCCANAAAGAGACTCCCNAGAAGAGAAGCAGCAAGGAGCCCANAAGAAAGGAGGAAAGAGAAGCAGCACTGCTCTGCCCAGCCCTGAGATGACTGGATGAA
  5   1   2       bld Emb4                            IMAGE:4971078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCCAAAAAGAGACTCCCCAGAAGAGAAGCAGCAAGGAGCTCAAAAGANANGGAGANNAGAGAAGAGCACTACTCTGCCCAGCCCCTGAGTGACNTGATGATCTGAAAGGCTTACAGCGAGCTAATCAGGACCATTGCATCTCTAAN
  5   1   2       bld Te2       in                    IMAGE:7207015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCccaaaaagagactcccagaaagagaagcagcaaggagccaaaaagaaaaggagaaagagaaaCAGCACTGCTCTGCCCAGCCTGAGATGACTGAGATCTGAAGCTTACACAAGCTATCAAGACATTGCCTCTCTAA
  5   1   2       bld Ga15                               XL466c18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCANCACCTACTCCTGCCCCANCCCCTGAGGAATGACCTGGATGAAATCTGAAAAG
  5   1   2       bld Bone      in                    IMAGE:8740073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGACATTCCTAGTCGCGAGAGGATCACACTGGCTGATATACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGTCTGGAACATCCTTCGCAGCCTTTGGTAATGTCACCAGTGGTTGTGACCTGTGGTGATCAGCCAGAGTCGTGCTGTGTTGGAGAGTAAACTTTGTGACAGATGCACAGTTGATGCAGAAGTTTGCAGATGCACAAAAAAGACTCCAGAGGAGCCGCAGGATCAAGAACGAGAAAAGAAGCGACTATCTGCCAGCTGAGAGTACTGTGATGAGCTTAAGCAGCTATCAGACATGCACTACTAGTCCTGTAG
  5   1   2       bld Panc                            IMAGE:8736354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCATGTCCTGAAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAGATGGCACAGTTTGATGCCAGAAGTTTGCCGAGATGCAGCCCAaaaaagagactcccagaaagagaagcagcaaggacccaaaagaaagagaaagaagaGCAGCACCTAATCCTGCCCAGCCCTGAGATGACTGATGATTGAAGCTAGCGCAGCTAATCAGGACATGGCCACTCTCACTTAAGGCTCTTTAATGGAT
  5   1   2       bld Ga18      in                      xlk147m03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCGCGGGANTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGNTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGNAAAANTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGNCGAGATGCAGNccaaaaaagagactcccaagaaagagaagncagnaaaggagnccaaaaaagaaaaggaggaaaagaagaaagNAGNANCTACTCCTGCCCNNGCCCCTGAG
  5   1   2       bld Tbd1                                 AW765041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTC
  5   1   2       bld Lu1                             IMAGE:4633160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTC
  5   1   2       bld Tail      in                    IMAGE:8543141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGagatgcagccccaaaagagactcnncagaagagaagcagcaaggagccaaaaagaaaagagaaaagagaAGCGCACTACTCTGCCCAGCCCTGAGATGACTGATATCTGAAGCTTACACAAGCTAACAAGACATTCCTCACTAACTCTTAAG
  5   1   2       bld Lmb1                            IMAGE:8532591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGTAGCTAGTGCATGAGTCATCGCTTCGTATTCGTCCCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCcaaaaaagagactcccaagaagagaagccagcaaggagcccaaaaaagaaaaggaggaaaagagaaaGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCA
  5   1   2       bld Int2                            IMAGE:8528707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTNAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTGCCGAGATGCACCCaaaaaaagactccaagaaagaaagcagcaaggagccaaaaaaaaaagagaaaaaaGAAGCACACTACTCTGCCCAGCCTGAGATACTGGATATCGAAAGCTTACACAAGCTAACAAGACTATGATCTCTAAATCTTAATGAGT
  5   1   2       bld Ga18      in                      xlk131g09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGCGGNNTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGNCAAGAAGNTTGCCGAGATGCAGCCCaaaaaagagantcccaagaaagagaagncagnaangagnccaaaaaagaaaangagnnaaagaNGNAAGCAGNANCTACTCCTGCCCCAGCCCCTNA
  5   1   2       bld Kid                             IMAGE:7009927.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCCAGAAAGAGAAGCCAGCANAGGAGCCCAN
  5   1   2       bld Thy                             IMAGE:8548153.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCGGGATCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACATGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAaaaagagactcccaagaaagagaagccagcaagggacccaaaaaagaaaag
  5   1   2       bld DMZ       in                         xl288f12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCC
  5   1   2       bld He1       in                    IMAGE:4407420.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGNTACATGCTCTCTTCTGTGGCTCTATAAGCAGG
  5   1   2       bld Emb4                            IMAGE:4959570.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAtttttgtttttgcctttttGAGAGCAGTGCCATTGCTCTTTATGTGGGTAATGATGAGCTCCGCGGAACCACTCGTTTACACCAAGCTCAAGCCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCACGGGTCTTTCCCACTCTTGGGATCCTGCAGGATAATAAGCAGGCCACAGACCAAGCCAAGGAGGAGATCAAGACTGGGCTTGGCGTTTTAAATTCCCATCTGCAGACACGGACCTTCCTACTCGGCCAGAGGATCACA
  5   1   2       bld Eye1                            IMAGE:7020331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggagggaaaagaagaaagCAGCACCCTACTCCTGCCCCAGCCCCCTGAAGGATGAACCTGGAATGAAAATCTGAAAAAGGCTTTTAGCAGCAGAGCCCTAAATT
  5   1   2       bld DMZ       in                         xl329k10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAA
  5   1   2       bld Tbd5      in                    IMAGE:3579860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTGGTAATGTCACAAGGTG
  5   1   2       bld Thy       in                    IMAGE:8550488.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAGTAAAACTTTGTGACAGATGGCACAGTTTGATGCAAGAAGTTTGCGAGATGCAGcccaaaaagagactccagaagagagccagcaagagccaaaagaaaggagaaagagaagCGCACTCTCTGCCAGCCTGAGATACTGATGATCTGAAGCTACACAAGCTATCAAGACATAGCCTACTAAGCTCTAATGATGATAAGATTCAG
  5   1   2       bld Sp1                             IMAGE:4174104.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTNTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCANAAGTCCGTGCTGTGTTGGGAGAAAGTAAACTTTGTGAC
  5   1   2       bld Emb4      in                    IMAGE:4202809.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACTCTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTC
  5   1   2       bld Emb3                            IMAGE:3398747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTCTGTACACATACTCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCANGTCCTGGAACCATCC
  5   1   2       bld He1       in                    IMAGE:4407377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGG
  5   1   2       add Tbd3                            IMAGE:3549819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCTTTGTACACATACTTTGGTAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGGTACCAAATTAGACCACCCGGGTTTTCTTTAAAGGGAAAATTTCCCC
  5   1   2       bld Emb4      in                    IMAGE:4959481.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGTCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTG
  5   1   2       bld Sp1                             IMAGE:5511376.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAANAagagactccccagaaagagaagcccagcaaggagcccaaaaagaaaaggaggaanagaagaagCAGCACTACTCCTGCCCAGCCCCTGAGATGACTGNATGAT
  5   1   2       bld Tbd5                            IMAGE:3581395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAG
  5   1   2       bld Brn1      in                    IMAGE:6949959.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACCGGTCCGGAATTCTCGGGATCAAGCCCCTCATCGCTGCTCAGTATTCGGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTGTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGAATTTCAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTTAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCCTTTATAATGGATGAGTTTAAGAGGGAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGG
  5   1   2       bld Spl                             IMAGE:8461445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAGATGGCACAGTTTGATGCAAGAAGTTGCCGAGATGCACCCAAAAGagactccagaagagagcagcaaggagccaaaagaaagagaaagagaagCGCCTCTCTGCCAGCCTGAGATACTGATATCTAAGCTACACGACTATCAGACCTGCTCTCTAACTCTAAGAGATAAGATTCAGAATCGAGTCTCTTCGACTT
  5   1   2       bld Tbd2                            IMAGE:3199435.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAG
  5   1   2       bld Eye1                            IMAGE:6946919.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTATGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTTCCTGCCCCCAGGCCCCCTGAGGGATGACCCTGGGATGAAATCTGGAAAAGGGCTTTTAAGCAGCCAAGAGCCCTTAAAATCAAAAGGGGACCCCCATATGGCCACCCATTCCTAACCTTTAAAAAAGGCCTA
  5   1   2       bld Emb4                            IMAGE:5515197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTACACATACCCTCGATTTCATGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACtcccaagaaagagaagcccagcaaggagcccaaaaaagaaaaggatgaaaagaaga
  5   1   2       bld Ga18      in                      xlk123g10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGNCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGNTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGNAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTNCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAG
  5   1   2       bld Neu7      in                         XL008k01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTACACATACCCTGNAAACTGGNAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCC
  5   1   2       bld FaB       in                    IMAGE:8070668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAA
  5   1   2       bld Tail                            IMAGE:8544149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAaaaagagactcccagaaagagaagcagcaaggagcccaaaagaaaggaggaaagaagaaCAGCACTGCTCTGCCCAGCCCTGAGAGACTNGAGATCTGAAAGCTTACACAAGCTATCAAGACATAGCCTCTCTAACTCTTTA
  5   1   2       bld Skin      in                    IMAGE:8641059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCccaaaaaagagactcccagaaagagaagccgcnaggagcccaaaaagaaaaggaggaaagaagaAGCAGCACTACTCC
  5   1   2       bld Tbd5      in                    IMAGE:3581453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACATACCCTGNTAACTGGTAGTCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGTGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGNCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCT
  5   1   2       bld Thy                             IMAGE:8549542.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACATGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAATAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAATAGAAAAGGAGGAAAAGAGAAAGCAGCACTTCTCCTGCCCAGCCCCTGAGATGACTGTAGGATCTGAAAGGCTTTGCACAAGACT
  5   1   2       bld Egg4      in                    IMAGE:3743410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATGCCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAAGTCCTGGAACCATCCTTCCGCCAGCCTTTGGGTAATGTCACAAGGGTGGTTTGCGGGAACCACTCTTGTGATAACAGAGTTCTGCTGGTTGGAGAA
  5   1   2       bld Thy                             IMAGE:8549851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGcccaaaaaaagagactcccaagaaagagaagccagcaaggagcctaaaaagaaaggaggaaagaAGAAGCAGCACTACTCTGCCCAGCCCTGAGATGACTGNATGATCTGAAAGGCTAGCACAGAGCTAATCAAGGACCATATGCCTCTACTAACTCTTATATGATAGTTAGAGAATATCATGAGAACTGATGTGTCTGCTATCG
  5   1   2       bld He1       in                    IMAGE:4407760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGGTGTTTAGGATTCTCATCTGCAGACCCCGACATTTCCTAGTCGGCGAAGAGAACAACCCTGCCTGAATATACCTGTTACCTGCCTCTCTTCTGGTGCCTCTTAAAGCCAAGTCCCTGGAACCCACCTTTCCCCCCACCC
  5   1   2       bld Li1       in                    IMAGE:5129785.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGT
  5   1   2       bld Te2                             IMAGE:7393755.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAACAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGAAAACTTTGTGACAAGATGGCACATTTGATCCAAGAATTTGCCGAGATGCGCCCAATCAGAACTCTCAGAAGAGAGCTGCAAGGAGCCATTAGATAGAGGAAAGAGAAGCGCACTGTCTGCCAGCCTGAGAGACTGATGATTA
  5   1   2       bld Int2                            IMAGE:8529068.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATACCCTGATAACTGGAGGGCATACAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGATCAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCCCagaaagagaagcagcaaggagctcaaaagaaaggagaaaagagaagcGCACTACTCTGCCCACCCTGAGAGACTNGAGATCTGAAGCTTACACAAGCTATCAAGACATAGCCTCACTAAGT
  5   1   2       bld Sp1       in                    IMAGE:4963158.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTT
  5   1   2       bld Emb4                            IMAGE:5440332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCANAGGAGCCCANAAAGAAAAGGGAGAAAAGAAGAAAGCAGCACCTGCTCCTGCCCCAGCCCCTGANGATGACT
  5   1   2       bld Ga12      in                         XL161h12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGATAACTGGNAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCAT
  5   1   2       bld DMZ       in                         xl258h11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAA
  5   1   2       bld Bla1      in                    IMAGE:3379499.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACNNCACTCG
  5   1   2       bld Sp1                             IMAGE:5513732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGATAACTGGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaagaaaaggaagaaaagagaaagCAGCACCTACTCCTGCCCCAGCTCCTGAGG
  5   1   2       bld Eye1                            IMAGE:4743140.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGGGTTTTAGATTCTCATCTGCAGACCCGGACCTTCCTATTCCGCCAGAGGATC
  5   1   2       bld Te2                             IMAGE:7391990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGcagcccaaaaagagactcccagaaagagaagccagcaagagcccaaaagaaaggaggaaagAAGAAGCACACTACTCTGCCCAGCCCTGAGATGACTGGAGATCTGAAGGCTTAGCACAAGCTA
  5   1   2       bld Spl                             IMAGE:8462728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATACTGGAGGGCATACAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCCAGAAGAGAAGCCAGCAAGGAGCCAAAAAGAAAGGAGGAAAGAANGAAGCGCACTACTCTGCCCAGCCCTGAGATGACTGGAGATCTGAAAGCTTAGCACAAGCTAATCAAGACATTGCCTCTACTAAGCTCTATATGATGATAGAGATATCATGAATACG
  5   1   2       bld Lmb1                            IMAGE:8533959.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCgagatgcagcccaaaaaagagactcccagaaagagaagcagcaaggagcccaaaagaaaagGAGAAAGAGAAGCACACTACTCTGCCCAGCCTGAGAGACTNGAGATCTGAAAGCTTACACAAGCTAATCAAGACATTGCCTCACTAACTCTTAATGATGATAAGA
  5   1   2       bld Thy                             IMAGE:8548822.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCccaaaaaagagactcccaagaaagagaagccagcaaggagcccaaaaaagaaaaggaggaaaagaagaagCAGCACCTGCTTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAATCAAAGGACCAATATGCACCATCTTCTTAAAGCTTCCTTTTACATGGAATGAGTTTAAGAAGGAAATAATTTCAAATTGAAGAATACTCTTGACTGGTGCTCTGGCTTATTTCTCGTGAGACCTTTGACCAAGAAGGGCTTGGGTCTCTTCGGGTAACGGCGTA
  5   1   2       bld Te2       in                    IMAGE:7390368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCACAACAGAGACTCCCAAGATAGAGAAGCCAGCACAGGAGCCCATATAAGAAAAGGAGGATAAGAAGAAGCAGCACTACTCCTGCCCAGCCCCTGAGATGACTGNATGATCTGANNAGCTTAGCACAGAGCTAATCAAGGACCATATGCCTCTACTAAGCTCTTATATGGAGAGTAA
  5   1   2       bld Emb9                            IMAGE:7978505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGAATTTCAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTTACACAAAGCTCAGGTCATTCAGTGGGTTTAGCTTCTTCGACAGTCACAATGTTCCTTCGGGCCAGCGCATGGGGTTTTTCCCACTCCTGGGATCATGCATTATATAAGCAGGGCACAGAAACAGCCCAGGGAGAAGATCTAAACGTGCTTGGGTGG
  5   1   2       bld Tad1                            IMAGE:6879083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCTCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAACCCaaaaaaaagagactcccaagaaaagagaagccagcaaaagagccccaaaaaagaaaaagaaggaaaaagaagaaagCAGCACCTACTCTTGCCCCAGCCCCCTGAGGATGACCCTGGATGAATCTGAAAAAGGCTTTAAGCAGCCAGAGCCCA
  5   1   2       bld Emb9      in                    IMAGE:7975013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACCTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTGCCGAGATGCAGCCCAAAAAGAGACTCccaagaaagagaagccagtaaggagcccaaaaagaaaggaggaaagaagaaagCGCACTATTCTGCCCCACCCTGAGAAGACG
  5   1   2       bld DMZ                                  xl332g13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTG
  5   1   0       chi Brn1      in                    IMAGE:4740678.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTTTTGTTAAAGACGGTTTTTGCCTTTTTCATAGCACTGCCATTGCTCATTATCCGTCTAATGCTCACCTCCCCCCAACCTCTCTTTTTCACCACCCTCTTGTCTTTCATCCTGTTACCTTTTCC
  5   1   2       bld Eye1                            IMAGE:4743222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAATACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACC
  5   1   2       bld Int2                            IMAGE:8529074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTTCTAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAAGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGAACAGATGGCACAGTTTGATGCCAAGAGTTTGCCGAGATGCAGCCCaaaaaaagactcccaagaagagaagccagcaagagcccaaaagaaaaggangaaagaagaagCAGCCCTACTCTGCCCAGCTCTGAGATGACTGATGATCTGAAAGCTTTACACAAGCTAATCAAGACCTTGCCTCAC
  5   1   2       bld Te2                             IMAGE:7210411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAAGAGACTcccaagaaagagaagccagcaaaggagcccaaaaaagaaaggaggaaaagagaaagCAGCACTGCTCCTGCCCAGCCCCTGA
  5   1   2       bld Neu7      in                         XL003g06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCT
  5   1   2       bld Lmb1                            IMAGE:8534779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GANGAGGCATCAAATAGAATTCGTCCCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagctcaaaaaagaaaaggaggaaaagaagaagCAGCACCTACTCCTGCCTCAGCCCTGAGGATGACTGGATGATCTGAAAGGCTTAGCAGCAGAGCTAATCAAGGACCATATGGCATCTACTAAAGCTCCTTATATGATGAGTTAGAGGAATATCAATGAGATCCTGACGTGTCTGCTTATCTGGAGCCTTG
  5   1   2       bld Bone                            IMAGE:8742332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaaggagcccaaaaaagaaaatgagaaaagagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGGAGCCTAAATCAAAGGACCCATATGCACATCTACTAAAGCTCTTTATAATGGATGAGTTTAAGAAGGAATATTCAATGAAGATACCCTGACTGTGCTCTGCCTATTCTGGAGTATGACAGGAGCTGTCAATCTGTACGCGAGATATAAATTCCGAGAGAGCGTTGAACACAAG
  5   1   2       bld Ga15                               XL513o06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCAAGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaanaaagcAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAA
  5   1   2       bld Brn1                            IMAGE:4740757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTA
  5   1   2       bld FaB       in                    IMAGE:8070563.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTGCCTCCTCTGCTCCAGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCgagatgcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAA
  5   1   2       bld DMZ                                  xl279g05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCNAGGTACCAGCATTTGAGGGCAAANACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCANGTCATTCAGNGGGTTAGCTTCTCAGACNGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAANCAGGCCACANAA
  5   1   2       bld Bone                            IMAGE:8741774.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAgcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggagaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCTGAGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATTCTACTAAAGCTCTTATAATGGATGAAGTTTAAGAAGAAAATATTCAATGAGAACCCTGACTGTTGCTCTGCTATTCCGGACACTTTGACAGAGCTGTCATCTGTACGCGAGATATAAATTCGAGAGAGCTGAC
  5   1   2       bld Tad2      in                    IMAGE:6875558.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTTCTAAAGAAATTCCCCTTACGCAAGGAATTTCAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTCACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAANAAAGAGActcccaagaaagagaagccagccaaggagccccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGGAGATGACCTTGGATGAATCTGAAAAGGCTTTACCAGCAAAAGCCCTAATCAAAGGGACCCCTATTGCCCATCTACCCTAAAAGCTCCCTTTTTTAATGGGATGGAGTTTTAAGAAGGAAATTATTCCAAATGGAAAAAACCCCCGGACTGGTTGCCCTCTGCCCTTTAATTTTCTGGGGAAAGCCA
  5   1   2       bld Lmb1                            IMAGE:8534145.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAATTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAaaaaagagactcccaagaaagagaagccagcaaaggagccccaaaaagaaaaggaagaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAAGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAACCTATATCAAAGGAGCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAATATTCACATGAAGATACCTGACTGTTGCTCTGCTT
  5   1   2       bld Tad1      in                    IMAGE:6879942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAAGAAATTCCCTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAAGAGACTCCCAAGAaagagaagccagcaaaggagcccanaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTNGAGATGACCTGGATGAATCTGNAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTTATAATGGGATGAGTTTAAAGAGGGAAATATTCCAAATGAAGATAACCCTGGACTGTTTGCTCTGGCCTTA
  5   1   2       bld Spl       in                    IMAGE:8463604.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTAGGCAAGGTACCAGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAAT
  5   1   2       bld Te2                             IMAGE:7394559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCACTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGAGAACCACTCGTTTACACCAAGCTCACGTCATTCATTGGGTTAGCTTCGTCACACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCACTATAATAAGCAGGCCACAGAACAAGCCAAGGAAGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCATCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCACCCACAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTGGTGACAAGATGGCACAATTTGATGCCCAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTcccaagaaagagaagccagcaaaggagcccaaaaaacaaaaggaggaaaagaagaaaGCAGCACCTACTCCTGCCCCAGCCCCTGATGATGACCTGAATGAATCTGAAAAGGCTCTAGCAGCAGATCCTAAATCAGAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATAC
  5   1   2       bld Lmb1                            IMAGE:8535821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATTTGAGGGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCNNTTATATGGATGAGTTTAGAGGAAAATATCAATGAAGATACCTGACTGTGCTCTGCCTATTNCTGGNACACTTNGACAGAAGGCTGTCATCTGTACCAGATATATTTCAGAGACTGACCAGCTT
  5   1   2       bld Tad1                            IMAGE:6938727.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGCGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCgagatgcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCACCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCCTTTATTATGGATGAGTTTTAAGAAGAAAATTTTTCAATGAAAGATACCCCGGAACTGTTGCTCCTGCCCTTATTT
  5   1   2       bld Sp1       in                    IMAGE:4964945.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTGCTCCTGCCCCAGCCCCT
  5   1   2       bld Tail      in                    IMAGE:8541928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCCTAATCAAGGACCATATGCACATCTACCTAAAGCTCCTTNATATNATGAGTTTAGAGGAAATATCAATGAGATACCTGACTGTGCTCTGCCTATTCTGGGACACTTNGACAGAGGGTGTCATCTGTACCAGATATAATTCAGAGACTGACCAGCTTAGACTGCACTATAAGAGTCAGCTCAACAA
  5   1   2       bld Lmb1      in                    IMAGE:8533084.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACGGTTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAGGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTTCCTAAAAGCTCCTTTATAATGGATGAGTTTAGAGGAAATATTCAATGAAGATCCCTGACTGTGCTCTGCCTATTTCTGGACACTTTGACAGAAGCTGTCATCTGTACCAAGTAAATTTCAGAGACTGAA
  5   1   2       bld Tad2                            IMAGE:6872408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTTGCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCTAGAAGTTTGCCGAGATGCAGCCCAAAAAAgagactcccaagatagagaagccagcaaaggagcccagaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTTAGCAGCAGAAGCCTAAATCAAAGGGACCCATTATGCACAATCTACCCTAAAAAGCCTCCTTTTTATAATGGGATTGAGGTTTTAAGAAGGAAAATATTTC
  5   1   2       bld FaB                             IMAGE:8070533.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCTTTTTGAGAGCAGTGCCATTGCTCATTATGTGGGTAATGATGAGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCcaaaaaagagactcccaaaaaaagaaaagccagcaaaagaggccaacaaagaaaaaggaggaaaagAAGAGCGCATCCCCTGCTCCTGCCCCCGCCCCATGAGGATGACCTGAGGGACTCTGAAAAGGGCTGAAACAACTACACCCTAAACCCCAGGGGCCATATGGCACCTCTCCCTAACTGCTCTG
  5   1   2       bld Eye1                            IMAGE:6958912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTCATTATGTGGGTAATGATGCGCTCCGTGGAACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTTGACAAGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCCTTTATGAGCTGCAACTTTAATTTCAGGTATGTTCCCGCGGTCTAGACCAACTGCGTAAAAACTGGCTTTTGCAGTG
  5   1   2       bld Tad2                            IMAGE:6875490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACCACTCGTTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCCAAaaaaagactcccaagaaagagaagccagccaaggagcccaaaaaagaaaaggaggaaaaaaagaaaGCAGCACCTACTCCTGCCCCCAGCCCCTGAGGAAGACCTTGGATGAATCTTGAAAAGGGCTTTAACAGCAAGAGCCCTAAATCAAAAAGGACCCCATATTGCACCATCCTAACCTAAAGAAGCTCCTTTTTATAAATGGGAATGAAGTTTTTAAGGAAGGGAAATATATTCCAAATTTGAAGGAATTCCCCCTTGAAATGGGTTTGCCTCCTTGGCCCTTTTAATTTCCTGGGGGAAAGCACCTTTTTTTGACAAAAGAGGAAAGGGCCTTGGGGTCCCCAATCCTGGGGGAAACC
  5   1   2       bld Thy                             IMAGE:8551333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTCTAGGTGNNNNGGGATTCATGATTGAATTCGTCCAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAGTCTTTATGAGCTGNCACTTATTACAGGTATGTTCAGCGTCTAGACAACTGCGTAAACTGGCTTGCAGTGTCATCTGTCGGGGACACATACAGCTCATCTCGGGTGTGGTGTCGAG
  5   1   2       chi Tad2                            IMAGE:6876588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTACACCAAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATACCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCTaaaaaaaanaaaaaaaaaaaaaaaaaaaCCTTGTCGGCCGCCTCGGCCctcgagaagctttctagaccattcgtttggcgcgcgggcccagTAGGTAAGTGAACATGGTCATAGCTGTTTTCTAGGAGATCCTGGTCATGACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGGAACCCGAGCGTTCTGAACAAATCCAGATGGGAGTTTCTGAGGGTCATTACTGGGATTTATCAACCAGGGAGTCCAAGCCGAAGCTTCGATATTCAAAATTACGCCCCCCGCCCCTGCCCACCTCTATTGGCAAGAAACTGGTTGGGAAATTTC
  5   1   2       bld Lmb1                            IMAGE:8535532.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCcaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTTCCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTCCAGAGGAGCTGACACAGCCCTTATGAGCTGCACTTNATTTACAGATGGGTGACTCGTGCAGCTGGAAGACTACTGTATGTTCAGCTCTAACAACTGCGTAACTGCC
  5   1   2       bld Skin                            IMAGE:8644469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCTCAGGTCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGNTCATCTGGTACGCAGAGTATAATTTTCAGAGGAGCTGACACAGCCTTTATGAGCTGNCACTTATTACAGGTATGTTCAGCGTCAGACAACTGCGTAAACTGGCTTGC
  3   1   2       bld DMZ       in                         xl298o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCTCAGGTCATTCAGTGGGTTAGCTTTTCAGACAGTCACATTGTCCNTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACCAGGTATGTTCCAGCGTCTAGACAAA
  5   1   2       bld Tad1      in                    IMAGE:6877335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCATTCAGTGGGTTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCAAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaagggaggaaagaagaaagCAGCACCTACTCCCTGCCCAGCCCCCTGAGATGACCTGGATGAATCTGAAAAAGGCTTTAGCAGCAGAGCCTAAATTCAAGGAACCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAAAGGAATATTCCAATGGAGAATACCCTGACTGTTGCTCTGCCCTTATTTCTGGGAACACCTTTGAACAAGGAAAGGCTGGGCCCATCTGGGGACCCCAAAGTATTAATTTTCCCAGAAGGAACTGGAACCAAAGCCCTTTATTGAAACTTGGCAACTTTTATTTACCGGGGGATTGGGTTCCCAAGCGGTCTaaaaaaaaaaaTTA
  5   1   2       chi Te1                             IMAGE:6929526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTAGCTTCTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCaaaaaagagactccctagaaagagaagccagcataggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGGCTTTAGCAGCAGAGCCTAAATCAAAGGGACCCATATGCCCATCCACCTAAAAACCTCCTTTATAATGGGATGAGTTTAAAGAAGAAAATATTTCAAATGAAAGAAACCCCTGAACTGGTTGGCTCCTGCCCTTATTTTTCTGGGGAAGCCACTTTTTGGACAAGGGAAAAGGGCCTGGGTCCCCAACCCCGGGGTAACACCA
  5   1   2       bld Lmb1                            IMAGE:8533685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTNCAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAAGAAGCTGGGCCATCTGGTACGCAAAGTATAAATTCCAGAGAGCTGACACAGCCTTATGACTGCACTTATACAGGATGTTCTGCGCCTGAAAACGCGTAAAATGCTTGCGTGTCTCTGTTCGGACACAATACACTCACCTGTGGTGGTGGTA
  5   1   2       bld Brn3                            IMAGE:8537201.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCAGACAGTCACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAgcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAATTTCCAGAGAGCTGACACAGCTTNATGACTGCACTTAATACAGTATGTTCAGCTCTAACAACTGCTAAATGCTTGCATGTCTCTGTCGGACACATACACTCTCCTGTGGTGTGTCAAGCAGACTGCTTCCTCCGAATGCATGATCATCCACTGAAGCGATGTTGGAGC
  5   1   2       bld Bone                            IMAGE:8741694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACATTGTCCCTCCGGCCAGCGCATGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAGAGGAAATATTCAAATGAGATACCCTGACTGTTGCTCTGCTATTTCTGGAGCACTTTGACAAGAGCTGTCATCTGTACGCAGAGTATAATTTCAGAGGAGCTGACCAGGCTTATGAGCTGGCACTATACAGATGTCACGTCTAGACAACTGCGTAACTGCTGGCAAGTCATCTTGTCCTGAACACAATACGTCATCTGGTTGGGGTCAGGCTAGACTGCTTACCTCTGAACTGCATGA
  5   1   2       bld Tad2                            IMAGE:6933483.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGTTTTTCCCACTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCCGTCTAGACAAACTGCGTAAAAACTGGCCTTTGT
  5   1   2       bld Lmb1                            IMAGE:8535700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGGTTTTTCCCCTCTTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGAACACAGCCTTTATGAGCTGNCACTTATTACAGGTATGTTCCAGCGTCTAGACAACTGCGTAAACTGGCTTTGCAGTGTCATCTGTTCGGGACCNACATACAGCTCATCTCTGTGTGTGGTGT
  3   1   2       bld DMZ       in                         xl297o11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGGGATCATGCAGTATAATAAGCAGGCCACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACCAGGTATGT
  5   1   2       bld Emb4                            IMAGE:5514306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACAGAACAAGCCAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATgcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCNACATAACAGCTCCATCTCTGGTGTGTGGGTGTTTCAGAGGCCAGACCTTTGCTTTACACTCTCTGAAGACTGGCA
  5   1   2       bld Lmb1                            IMAGE:8533356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATgcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACATACAGTCCATCTCTGGTGTGTGGGTGTCAGAGGCCAGACTTGCTTTACCTCTCTGAGACTGGCAATGATACGATCTACACTGAGAAGCTGATATG
  5   1   2       bld Tbd3                            IMAGE:3548665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCACAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCGAGATGTTGGCCCAGATGCATCCCAAAGAATAGACTCCCAGAAGA
  5   1   2       bld Ga12      in                         XL181l01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGGAGGAGATCAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCANCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGC
  3   1   2       chi Tad2      in                    IMAGE:6871891.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTCTTTTTTGGCCCAAGCCGTTATTGGGTATATTGTTCCCACAAAGGGGGTGGTTTGTGGGGCCCATTTTCTGGAATCTCGCGCCAATAATTTTCCCGGGGCCTTTTTCTTGGGGAAAAAAGTTAAAAGCTTTTGTGCGACCAAGTTGTGGTCCACAGTTTTTATATTGCCCTAAGAACAGTTTCTGGCAGAAAATATGCAATTCCTCCAAATAAAAAATATGACTCTCCCCCAGGGAAATATGATGAATAGCCCCAGACTAAAAGGGAGGCCCCCCAAAAAAAATGGAAAAAAGTGTTGGGAAAAATAAGAATGGATTAGTGCAAGCCCCCCCTTATTTCCCTGGGCCCCCAAGCCCCCTTGAAGGATTGAACCTTGGGATGGAATTCTGAAAAAGGGCTTTAAGCAGGCAGAGCCTTAAATTCAAAGGGACCCATATGCCATTCTACCTAAAAGCTCCTTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTGTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCCCCTTTTTTGGAATnTTTTTCCTTTTTCTTTTTTTTTTGTTTATTATTTTTTATTTTGTTTTTTTTGTTTTTTG
  3   1   2       bld Ga18      in                      xlk131g09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNNGAGATCNANNNTGTGCTNGNTGTTTTAGATNCTCATCNGNAGANNNGGACANTCTAGTCGNCGAGAGGATCACNCTGGCTGANATANCTNNTNCATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGNNNNANCCTTCCGCCAGCCTTTNNGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTNCGTGCTGTGTTGGGAGAAGTAAANCTTTGTGACAAGATGNCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGNNCCTACTCCTNNCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGNNTTTAGCANNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTNNNNTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAANCTGCGTAANNCNCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGCAANNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGNCCNTTTAACTTANCGAGACANNAAACGG
  3   1   2       bld Tail 5g3  in                    IMAGE:8541791.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGACACAGCCAAAGAGAGAATCAAACTGCTTGGTTTAGAATTCATTGCAGACCGACATCTAGTCGGCGGAAGGATCACACTGCTGATTAACTGTACATGCTTTCTTCTTGTGCTTATAAGCAGGTCCTGGAAACAATCTCGCAGCCTTTTGGTATGTCACACGATGGTTTGTGACTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAAGAGACTCCCACGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAGAAGGAGGAAAAGAAGAAAGCAGCACATACTCTTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCGTAAATCAAAGGACCCATATGCACATCTACATAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCTTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTCTAACTTAAGAGACAGCAAAACGGAAATTAAAAAA
  3   1   2       bld Ga18 5g3  in                      xlk139h24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGNTCANGNCTGTGCTNNNTNTTTTAGNTNNTCATCTGCAGANNNGGACNNTNCTAGTCGNCGANAGGATCACACTGGCTGATNNACTNNNCATNCTCTCTTCTNTGGCTCTANAAGCAGGTCCTGGNNCCATCCTCCGCNAGCCTTTTGGTAATGTCACAAGGTGNTTTGTGACCTGTGTGAATCAGCNAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAnCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGNNCCTACTCCTNNCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGNCTTTAGCANNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTNNNCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAANCTGCGTAANNNNCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGNNNAANNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGNTCCCTGAAATACGCGAGTCTGGTTTTCACATCTNTTCCAACATCCAGANCCTTTTAACTTAACGAGACANNAA
  5   1   2       bld Thy       in                    IMAGE:8549183.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAGACTGTGCTTGGTGTTTTAGATTCTCATCTGCTGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCcaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTTCCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATACAACTCATCTCTGGTGTGGGGTGTTCAGAGCCAAGACTTGCTTTTCATCTCTAAAATGGCAATTGATACGAACTACAATGAAAAACTGGAGTGTATGAGATGAAACCTGTTAAGAACTTT
  3   1   2       bld Ga18      in                       xlk71a07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TNNTTTNNNNTNCTCANCNGCAGNCNCGGACNNNTCNNNNNTCGGCGAGAGGNTCACNCNTGGCTGANATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCCNGGANCCANNNNTNCCGCCAGCCTTTTGGTANNGTCANAAGGTGGTTTGTGACCCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGNNCCTACTCCTNCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGNCTTTAGCAGNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGNNNNCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAANCTGCGTAANNNNCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGNNNAANNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGNTCCCTGAAATACGCGAGTCTGGNTTTCACNTCTNNTCCANCNNCCAGNC
  5   1   2       chi Tad2      in                    IMAGE:6871891.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGTTTTAGATTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAGCTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTTATGAGCTGCAACTTAATTACAGGGTATGTTCCCAGCGTCTTAGACAAAACTGCCGTAAAAACTGGGCTTTTGGCCAGGTGGTCATCCTTTGTGTCGGGGGACCCAAACAAATAAACCGCGCTTCCCAATCCTTCTTTGGTTGGTTGTGGGGGTTGGTTTCCAAAAAGGACGCCAAAGAGACACCCTTGGCCTTGTTTTTTACAACCTTCCCTCCTTGGGaaaaaaaaCCTGGGGGCACAAACAC
  3   1   2       bld Ga18      in                      xlk147m03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNTTTNAGATTCTCATCNGCAGACACGGACANNNTAGTCNNCGNNNGGATCACACTGGCTGANNNACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCNNNNANCNANCCTTCCGCCANCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTNGNAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGNACCTACTCCTNNCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGNCTTTAGCANNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGNNNTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAANCTGCGTAAANCGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGCNANNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCANCNTCCAGNCCTTTTAACTTANCG
  3   1   2       bld Tail      in                    IMAGE:8541928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATCATGCAGTATAAGCAGCCAAGAACAGCAGGGGAATCAGCTGGCTGGTTAATTCTTGCGACCGACATCTAGTCGCGAAGATCCCTGCTGATTACTGTACATGCTTCTTGGCTGTAAGCAGTCTGACATCTCGCAGCTTGTAAGTCACAGTGGTTGTGACTGTGTGATCAGCAGAGTCGTGCTGTGTGGGAGAAGTAAACTTTGTGACAAGATGGCACAGTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCGTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACTGACAATACAGA
  5   1   2       bld He1       in                    IMAGE:4408165.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCTCATCTGCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGCCTGATATAACTGGTACATTGCTTCTTTTGTGGCTCTATAAGCAAGGTCTGGAAACATCCCTCCGGCCGGCCTTTGGGTATGTTCCAAAGGGGGGTTGG
  3   1   2       chi Tad2      in                    IMAGE:6875056.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATGTTAAAACTTGGGTTAAACAATGCTTTTTTTCTTTCAGGGTGGGGCTTGGTATTAAAGCCCAGGTTTCCCTGGGAACCCAATTCTCTTCCGGCCCAGCCCATTTTTGGGTAAATGTCCCCAAGGGGTGGTTTTGTGAACCTGGTTTGAATTCAGCCCAGAGTTCCCGTGTTGTTTTGGGGAGAAAGTAAAACTTTGTGCAAGGATGGCCCAGTTTGAGGCCAGGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCGTGCCCCAGCCCTTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACATAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCCTGGACATGGAAAGACAAATATGGGATAAAAAGNACGCTGTTTCATAATAAAAnnnnnnnnnnnnTTTT
  3   1   2       chi Brn1      in                    IMAGE:6950753.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAACCGAGTTCTTTTGCGTCGCCGAGGGCCTTTTTTGGGGTAAAATGTTCCACCAAAGGTTATAGATTTGCTTTAACCCTCTAGATGAAATTCACGCCCAGGGAGTTTTGCGTGGGAGTTGGTTTTGTGGCGAAAAAGTAAAAAACTTTTGCTGACCCAAAGGCTGGATCAAAAGATTTGGAGTGAGCAAATGAATGTTTTTCTAGTTGATTGTCATTCCCCAAAAAAAATAAGATCTCCCCAGGGAAAAGGGGAAGTCCAGGCAAAAGGAAGCCCAAAAAATGCAAAAAGGAGGAAAAGGAGGAAAAGCCAGCACCTAATTCCTGGCCCCAGGCCCCTGAGGATGGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGGCCTAAATCAAAGGGACCCATATGCACATCTACCTAAAAGTTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCTTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCATTTAACTTAACGGAAAAGCTTGGCCGTTGCTAACACTTGGGGAGAGGGGGGGAGGGGGCGGGGGGGnGGGGGTNAGTAT
  3   1   2       bld Bone                            IMAGE:8739575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTAGTGGTATACAGCTTGGCCTGTTAGTATCATATGCGAACGACATCTAATGCGCGAGGATCACATGCTGATATACTGTTACATGCTTCTTCTGGCTTATAGCAGTCTGACATCTCGCCAGCTTGTAGTCACAGTGTTTGTGACCTGTGTGAATCAGCCAGAGTCCCGTGCTGTGTGGGAGAGTAAAACTTTGTGACAAGATGGCACAGTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCTCACGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCTTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCCAACCCCCCCAGAC
  5   1   2       bld Tad2                            IMAGE:6935497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTCTGCCGAGATGCAGCCCAAAAAAGAGACTCCCaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTTCGGGACCAAACAATAACCAGCTCCATCCTCTGGTGGTGTGGGGTGTTTCAGAGGGCCAAAAACCTTTGCTTTTTACACTCCTCCTGAAAGAACTGGGCCAAAATTGGATTC
  5   1   2       bld Te2N                            IMAGE:7205383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGACACGGACATTCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACAAATCCTANCACTGGAGAAAGCTGGATAGTGTTAGTGAGGAGTGCAAAACCCTTGG
  3   1   2       bld Tad1      in                    IMAGE:6877575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATAATACCATAGCGTTTGTTTCGGGGTGGATCCATAAAACCCGGTTTCCCTGGGGAACCATTCCTTTTGCGCCCAGCCCTTTTGGGAAATGTCCACACAAGGTGGTTTTGTGACCCCCGGGTGGAATTCCACCCAGGAGTTCCCGGGGCCTTATTGGGGAAAAGGTAAAATTTTGGTGACCAGAAGGGCCCCAGTTTGATTCCCAAGAAGTTTCGCCGAGATGCAGCCCCAAAAAAAGAGACTCCCCAGAAAAGAGAAGCCCAGCAAAGGGAGCCCAAAAAAGAAAAGGAGGAAAAGAGGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGCCCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCCGAAATACGCGAGTCNTGTTTTCACATCCGTTCTTCAGAAA
  3   1   2       chi Tad1      in                    IMAGE:6879140.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGGCGGATTATTTTTGCGGGGCCAGGGCCATTTAGGGGAAAAATGGTCCACAGAAGGGTTAGTATTGGGTAAACCCATGTGTGTAAATTCAAGTCCGAGAAATTTGGCGATAAAATATTTTTGGAAGGAGGGTTAAAAGGTAAGGTGGACAGAGGAGGGGCACAGGTTTAAAAGGCCCAAGGAAGTTTAATCCGGGGAGGAAAGCCCCAGGAAAAAGTTGACTTCCCAAGAAAGGGAAAAAGCCAGCGAAAGGGAGCCCCAAAAAAAGGAAAAGGGAGGGAAATGTAAGAAAAGGCGGCACGTATTCGTGCACCCAGCCCCTTGAGGGATGATCTTGGATGAATGTGAAAAGGGTTTTAGCAGGCAGAGCTTAAATTCAAAGGACCCATGTGCACATCTACTTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCATTATGTGTGGGAGCACTTTGGCAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGTTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAGGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCGACATCTGTTCCAACATCCNCCCTTTTTTTGGAAAAANGAGAGACCNGGGGAAAGGGGTCGGAAAGTACGGGGAGATGGGATGGTATAGTATAAGGGG
  5   1   2       bld Ga15                               XL496l07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCTAANCAGCGAGAGGATCACACTGGNTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCNCAAGGTGGNTTGTGACCTG
  5   1   2       bld Emb4                            IMAGE:4680760.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCTAGTCGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAA
  3   1   2       bld Tad1      in                    IMAGE:6880580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          NACCGGAAGTCTCCTGGGAAAACCATTTTCCCTTTTTCGGGCGCAAGGCCCTTTTTTGGGAAAAAGTTCCCCCACAAGCGCGGGTTTTTGTAACCCTTCTGCGGAATTCCAGCCCCAACGTTTCCCCTTCCTGTGTTTGGGAAGAAAGTTAAAACCTTTGGGGACAAGAGTGGCCCCATTTTTGATCCCAAAGAAGTTTTGCCGAGAAGCCACCCCAAAAAAAGAGACTTCCCAAGAAAGAGGAAGCCGGCAAAGGAGCCCAAAAAAGGAAAGGGGGGAAAAGAGGAAAAGCAGCACCTACTCCTGCCCCAGCCCCCGAGGATGACCTGGATGAATCTGAAAAGGCTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATCCAAATGAAGATACCCTGACTGTTGCTCTCCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGCAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCCGAAATACGCGAGTCT
  5   1   2       bld Lmb1                            IMAGE:8535738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCTATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACANCAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGGACCACATAACAGCTCCATCTCTGGTGTGTGGGTGTCAGAGGCNNAGACTGCTTTTCACTCTCTGAGACTGGCAATTGATACGAATCTACACTGAAGAAGCTGAAGTGGTATGAGATGCAAACTTGTCAAGATCTTGCTTGGAGAAATTAGATGGGCAGCC
  3   1   2       bld Tad1 5g3  in                    IMAGE:6877982.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCCGCACCCCAACCCCCCTTTTTGTGGGTGAAAAAGGTGTCCCACAAGAGGGGTGGGGTTTTTGTTGAACCCTTGGTGGTGGAAATTCCAGGCCACAGAAGTTTTCCGGTGGCTTGTGTTTTGGGGAAGAAGTTAAAAAACTTTTGTGGACCAAAGAATGGCCACAGGTTTTGATGCCCCAAGGAAGTTTTGCCCGAGATCGCAGCCCCAAAAAAAAGAGACTCCCCAAGAAAAGAGAAGCCAGGCAAAAGGAGCCCAAAAAAAGAAAAGGAGGGAAAAGAGAAAAGNCAGCACCTACTCCTGCCCCAGCCCTTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCAC
  5   1   2       bld DMZ                                  xl299f07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAGAGGATCACACTGGCTGATATAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCA
  3   1   2       chi Tad2                            IMAGE:6873909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTTCCCGCCCAAGCCCTTTTTTCTGGGTAAAATGTTCCCCCAAAGGTGGGTGTTTTGGTGAACCCTTGGTGGGATATTCAAGTCCCAGGAGGTTTCCCGTCCGTCGGCGTTGGGGGAGGACATTAAAAAATTTTTTGGGAACAAAGATTGGCCACCGTTTTGGATGCCCAAGAAAGTTTTGCCGAGGATTGCAGGCCCCAAAAAAAGAGGACTCTCCAAGAAAAGGGGAAGCCCAGCAAAGGGAGCCCAAAAAAAGAAAAAGGAGGGAAAAGAAGGAAAGCAGCACTTACTCCTGCCCCAGCCCTTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATGTGATCCAACATCCACANCCTCCCTTTTTTGGACGNCNCTCCTTTCTGCGCCTTGCTACCCTCCCCAACTTCAGCCACCCNAACCATCTTCTTTTC
  5   1   2       bld Brn3                            IMAGE:8538370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGATCCACTGGCTGATTAACTGTTACATGCTCTCTTCTGTGGCTCTATAAGCAGGTCCTGGAACCATCCTTCCGCCAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCcaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGNCAATTGATTACGAATCCTA
  3   1   2       bld Panc 5g3  in                    IMAGE:8734289.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAACACGGACCATTCTATGTGGCGAGAGATCACATTGCGATATACTGTACTGCTCTTCTGATCTAAGCAGTCCGAACATCTCCGCAGCTTTGTTAAGTCACAAGATGTTGTGACCTGTGAATCAGCCAGAGTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGACAAGATGGCACAGTTGATGCCCACGAAGTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGAAAAAGAAGAAAGCAGCACTTACTCTTGCCCCAGCCCCTGAGGATGACCGGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCTTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACAATCCCAGAC
  3   1   2       bld Tad2      in                    IMAGE:6875558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTCCGTTTTCTCCGTCCAAAGCCCTTTTTTGGGGTAAAAGTTTCCACACAGGGTGTGGTTTTTGTTCCACCCGGTTGGTGAATTCCCACCCCAAGAGTTTTCCCCTTCTTTTGTTTGGGGAAGGAATGTTAAAAACCTTTTGTGACCAAGAATGGGCCCCAATTTGTATGCCCAAGGAAGTTTTTCCGAGATTCCAGCCCCAAAAAAGGAGATTCCCCAGGAAAGGGAGGCCCAGCCAAAGAGCCCCCAAAAAGGAAAAGGAGGAAAAGAGGAAAGCAGCACTTACTCCTGCCCCAGCCCCTTGAGGATGACCTGGATGATTTGGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACA
  3   1   2       bld Lmb1      in                    IMAGE:8531968.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGAACTTCCTAGTCGCGAAGATCACTGCGATGACGGTACATGCTTGTTCTGTGACTGATAGCAGGTCCTGACCATCTTCGGCAGCCTTGGTAAGTCACAAGGTGGTTGTGACTGTGTGAATCAGCCAGAGTCCGTGCTGTGTGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACTACTCTTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAAACGGAAAAATAAAA
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8532030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTCACACACCTTGGCTGGATTATAAACTGTTACATGCTTCTCTTTCGTGGCTCTATAAGGCAGTCTGAACCATCATCGCAGCTTTTGTAATGTCACAAGTGTTTGTGACTGTGTGAATCAGCCAGAGTCCGTGCTGTGTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGTAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCTCAACATCCCAGAGCCTTTTAACTTAACGAGACAGCAAAACGGGAAAAAAAAAAAA
  3   1   2       bld Tail      in                    IMAGE:8543141.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATTCACACCTGGCGTGATTATTACCGTTACATGGTCTCTTTCCTGGCTCATAAGCAGTTCTGAACATCATACGCAAGCCTTTTTGTTAATGTCACAAGTGTTTGTGACATGTGTGATTCAGCCAGAGTTCCGTGCTGTGTTGGAGAGTAAAAACTTTGTGACACGATGGCACAGTTTGATGCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACTACTCTTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCGTAAATCAAAGGACCCATATGCACATCTACATAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATATGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCTTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACTAACGAGACAGCAAAGGAAAAAAAA
  3   1   2       bld Tad2      in                    IMAGE:6873399.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACGGTTACATGCTCTTTTTCTGTGGCCTNTATAAAGCAGGTCCTGGGAACCATCTTTCCGGCCAGCCTTTGGTAAATGTCACAAGGGTGTTTTGTGACCTGTGGAAATCAGCCAGAGTTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCATGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCGGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCNGAAATACGCGAGTCC
  3   1   2       bld Bone      in                    IMAGE:8740073.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCCGAAGAATCACCATGCGTGGATATATCGTTACATGGCTTTTTCTGAGCTATAGCAGTCCCGAACCATCCTCGCAGCTTGTAAGTCACAAAGATGGTTGTGACTGTGTGGAATCAGCCAGAGTTCCGTGCTGTGTGGAGGAAGTAAAACTTTGTGACAAGATGGCACAGTTGATGCCAAGAAGTTGCCGAGATGCAGCCCAAAAAAGAGACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACTACTCTTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACACCCAGAGCCTTTTAACATAACGGAGACAGGCAGAATGGGAAAATAGATGC
  3   1   2       bld Tad2                            IMAGE:6872444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTAACAAGCTTCTTTTTCTGTGGGCTCCATAAAGCAGGTTCCTGGAACCAATCCTTCCCGCCCAGCTTTTTGGTAATTCAACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTGGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACGTACTCNTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCCGGTTTTCACAT
  3   1   2       bld Tad2 5g3  in                    IMAGE:6876456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACTGTTACATGCTTTCTTTCTGTGGCTCTATAAGCAGGTTCCTGGAACCATCCTTTCCGCCCAGCTTTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAGCTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTGGTCCCTGAAATCGCGAGTTG
  3   1   2       bld Bone 5g3  in                    IMAGE:8739750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGAGGATACACGCTGGCTGATATAACTGTTACATGGCTTTTTCTTGGCTTTTAGCAGGTTCTGAACCATCTTCGCAGCTTTGTATGTCACAAGTGTTTGTGACTGTGTGATCAGCCAGAGTCGTGCTGTGTGGAGAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAAACGGAGACAGCAAAAAGGGAAAAATTATAAAAA
  3   1   2       bld Int2 5g3  in                    IMAGE:8823869.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCAACTGAGTGGTAATATACTGTTACATGCTTCTTCTATGGACTCTTAAGCAGGTCCTGGAAACTATCTCGCCAAGCTTTGGTAATGTCACAAGGTGGTTGTACTGGTTGAATCAGCCAGAGATCGTGCTGTGTGGGAGAAGTAAACTTTGTGACAAGATGGCACAGTTTATGCCAAGAAGTTGCCGAGATGCAGCCCAAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACTACTCTGCCCCAGCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACAATCTGTTCCAACATCCAAGGAC
  3   1   2       chi Tad2      in                    IMAGE:6874736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAAAGTGTTTTTTGCGCACTCGTGAGAATGCGCAAAATCCCCCTCTTGAAAAAAAAGGGGGGATAAGTCTCCCCCCAAGGCGAAAAGGGGTGTAGCGCCCCATAGGCCAAAAGGGGAATGCCCCCCAAAAAAAAATGTATAAAAGGGGGGGGGGAAAAAAGGTAAGGAAAAGGTCAGGCCCACCCTTTATTTCCCTTGGCCCCCCAAAGCCCCCCTTGGAAGGGATTGAACCTTTGGGAATGAAAATTCTGGAAAAAAAGGGTTTTTTTAGCCAGGCAAGGAGGCCCTTGAAAATTCAAAAAAGGGACCCCCAATAATGCAACATTTTTACCCTAAAAAAGGTTCCTTTTATAAATGGGATGAGGTTTAAAGAGGGAAAATATTTCAAATGGAAAGATACCCCTGACTGTTTGCTTCTGCCTTTATTTTCTGGGGAGGCACTTTTTGAACAAGGAAAAGGCTGGTCCATTCTGGTACGGCAGAGTATAAATTTTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCGCTCCAACGGAAAGGGGAAACAATACTTTGTAGCTCTTTTATCTCACGACTGTGACGCCCACGCTCGACACACACAACA
  3   1   2       bld Brn1      in                    IMAGE:6949959.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCATGCTCTCTTCTGGGCCTCTATAAGCAGGTCCCTGAAACCATCCTTCCCCCCAGCCTTTTGGTAAATTCAACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGATTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGA
  3   1   2       bld Bone 5g3  in                    IMAGE:8739322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACTGTTAAACATGCTCTTCTTCTGGGCTATATAAGGCAGGTCTCGAACATCTCGGCAAGCTTTGTAATGTCCAAGTTGGTTTGTGACTTGTGGAATCAGCCAGAGTTCGTGCTGTGTTGGAGGAAGTAAAACTTTGTGACAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCTCGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTTAACTTACCGGAGAACCATCCCAAAAT
  3   1   2       bld Tad1      in                    IMAGE:6879942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTATAAAGCAGGTTCCGGGAACCATCCTTTCCGCCAAGCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGGCCAGAGTTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGGGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCNTGTTTCACA
  5   1   2       chi Tad2                            IMAGE:6935804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCCCTTTCTCCTCGCGCGAAGATGGCCGGCGGGACTTTGTACACATACCCTGATAACTGGAGGGCATACAAGCCCCTCATCGCTGCTCAGTATTCGGGGTTTCCCATCAAGGTTGCCTCCTCTGCTCCGGAATTCCAGTTTGGGGTAACAAATAAGACACCCGAGTTTCTAAAGAAATTCCCCTTAGGCAAGGAGCCCaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTTCGGGACCAACAATAACAGCTCCATCTCTTGTGTGTGGGTGTTCAGAAGCCCAGACCTTGCTTTTTACACTCTCTGAAAGACTGGGAAAATTGATTACCAAACCCTACAAACTGGAAGAAAGCCTGGATAGTGGTTAATGAAGAAGTGCCAT
  3   1   2       bld Tail      in                    IMAGE:8542169.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTTCTATAGGCAAGGTCCTGAAACATCCTCGCCAGCTTAGGTATGTCACAGGTGGTTGTGACTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTGGGAGAAGTAAACTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCTCAACATCCAGAGCCTTTTAACTTAACGAGCCACCAAAACGGAAATTAGAAAAAAA
  3   1   2       bld Tad1 5g3  in                    IMAGE:6878050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACCTTCCTTTCGCCCAGCCTTTTGGGTAATGTCACAAGGGTGTTTGTGGACCTGTGTGAATCACCCAGGAGTTCCCGTGCTGTGTTGGAGAAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGATTTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCNGTTCCAACATCCAGAGC
  3   1   2       bld Int2 5g3  in                    IMAGE:8823114.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGACGAGTTCTAGAGCATCCTCGCCCAGCCTTTTGGTAATGTCACAAGTGGTTTTGACCTGTGTGAATCAGCCAGAGTTCGTGCTGTGTGGAGAGTAAACTTTGTGACAGATGGCACAGTTGATGCCAAGAAGTTGCCGAGATGCAGCCCAAAAAAGAGACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCAGCTCTTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCGTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATTATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCTTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTATCTTGGTCCCCTGAAATAAGCTAAAGATTGA
  3   1   2       bld Tad1                            IMAGE:6877629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCTTTCCGCCCAGCCCTTTGGGTAATGTCACCAAGGTGGTTTGGACCCGTGTGAATCACCCAGAGTTCCGTGCTTGGTTGGGAGAAGTAAAATTTGTGACAAGATGGCACAGTTTGATCCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGATTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAGGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCCTGTTTTCACATCGGAA
  3   1   2       bld Tad1      in                    IMAGE:6877335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGCCCAGCCTTTTGGGTAAATGTCACCAAGGGTGTTTTGTGACCCTGTGTGATTCAGCCCAGAGTTCCCGTGCTGTGTGGGGAGAAGTAAAACTTTGTGACAAGATGCCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCTTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTGGA
  3   1   2       bld Emb9      in                    IMAGE:7976606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTAACGATCTTGGAGAACAGTATAAGCACTTTTGGTATACATCTAACTCTCCCACTTGTAGTACAGGTTTGACTTGATCACAGATCGGATTGTGGAAATAAATTGTACAGATGCCATTTATCCAAGAGTTGCGAAAGCAGCCCAAAAGAACTCCCAGAAGAGAAGCCACAAAGAGCCCAAAAAAGAAAGGAGGAAAGGAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAACC
  3   1   2       bld Brn1                            IMAGE:6951396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCTTTGGGTAATGTCACAAGGTGGTTTGTGACTTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAG
  5   1   2       chi Thy                             IMAGE:8549228.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTTTTGGTAATGTCACAAGGTGGTTTGTGACCTGTGTGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGcagcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAACCCTGGTCAAGATACTTTGCCTGGAAGAGAATTCAGAATGTGGCAGCCCTTTACAGGGCAGATCTCAAATGAAAGAGCTACCTGTCCTGAAACGCATCTGTTTCATCTGTCCACTCCGAGCTTACTACGGACCACGGAAAAAACGATAAAC
  3   1   2       bld Spl       in                    IMAGE:8463924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTCCAGGATATTCTGTTTTGGTTTACGTCTGACTCTTGCAGCTTGTAGTCCAGTGTTTGACTGGGATAGCAGATCGTGTGGTTGGGAGTAACTTGGACAGATGCACATNGAGCCAGAAGTTGCGAGATGCAGCCAAAAGAGACTCCCAGAAAGAGAAGCAGCAAAGAGCCAAAAAAGAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACTAACGAGACAGCAAACGATATAAAAGT
  3   1   2       bld Thy       in                    IMAGE:8550488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGATAGTACGTTTTGGTTTACGTCGACATCTCGCACCTTGTAGTACAGTGTTGTACTGTGATCGCAAGTCGTGTGGTGGAGAGTAAATTGGACAGAGGCCAGTTATGCAAGAGTTGCGAGAGCACCCAAAAGAGACTCCAGAAAGAGAGCCAGCAAAGAGCCCAAAAAAGAAAAGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACTAACGGACAGCAAACGAAATAAACA
  3   1   2       bld Spl       in                    IMAGE:8463604.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCTCGCAGCCTTTGTAGTACAGTGTTTGTGACTGTGGATCAGCAGAGTCCGTGCTGGTGGAGAAGTAAACTTGTGACAAGATGCACAGTTGATGCCAAGAAGTTGCCGAGATGCAGCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACTTAACGGACGCAAACGAAATAAAAGA
  3   1   2       bld Thy  5g3  in                    IMAGE:8550970.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCCTTGTATTCACAGTGTTTTGACTGTTGATCAGCAGAGTCCGTGTGTGTGGAGAATAAACTTTGGACANGATGCACAGTTGATGCCAGAAGTTTGCCGAGATGCAGCCCAAAAAGAGACTCTCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTTCCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACTAACGAGACAGCAAACGGAATAAACTA
  3  -1   2       bld Tbd5      in                    IMAGE:3579808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGTTCTCCCCGGGCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTNTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTGCATCTCTGGTGTTGTGGTGGTTCAGANGCCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAGATTGATTACGAATGCTACAACTTGGAGAAGCTGGATAGTGGGTAGTGAGAATGCCAAACCCTTGATCAAGAAATACTGTGCCTTGGGAAGGAGATTCCAAGGAATGCGGCCAGCCCTTTACCCAGGGCAAGATCATCAAATTGTTAGGGAGGT
  3   1   2       bld Ga18      in                      xlk123g10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGANTCANCNAGNNNNCCGTGCTGTGNNNNAGAAGTAANNTTTGTGACANGATGGCACAGTTTGATGCNAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAnnCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCANCTACTCCTNNCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCANNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGNNNTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAANCTGCGTAAANNNNNTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGNNNNANNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGNTTTCACATCTGTTCCANNNNCCAGNNCNNNNNCTTAACGAGNC
  3   1   2       bld DMZ       in                         xl329k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACTAACG
  3   1   2       bld DMZ       in                         xl258h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCCAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCNTTAACTANCG
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8533267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGTTCGTGCTGTGTGGAAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCTCAACATCCAGAGCCTTTTAACTTAAGAGACAGCAAACGAAAAAATAAAAG
  3   1   2       bld DMZ  5g3  in                         xl309p23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTT
  3   1   2       bld FaB  5g3  in                    IMAGE:8070368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAATCAGCCAGAGTTCCGTGCTGTGTTGGGAGAAGTAAAACTTTGTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTAACGAGACAGCAAACGGCAGTTAAAAAGCCG
  3   1   2       bld FaB       in                    IMAGE:8070563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCTGCTGGTTGGGAGAAGTAAAACTTGTGACAAGATGGCACAGTTTGATGCCAGGAGGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCACGAAAGAGAAGCCCGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACTTAACGAGACGACTATTAGCGCATTTCACCACA
  3   1   2       bld Ga18      in                      xlk149m16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTGNNTNGNAGAANTAAAACTTTGNGACANGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGNCCAAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGNACCTACTCCTNNCCCAGCCCCTGAGGATGNCCTGGATGAATCTGAAAAGNNTTTAGCANNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTNNTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACNNNNNNGTAANNNNNTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGCNANNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGNTCCCNGAAATACGCGAGTCTGGNTTTCACATCTNTTCCANCNTCCAG
  3   1   2       bld FaB       in                    IMAGE:8070668.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTGTGTTGGGAGAAGTAAAACTTTGTGACAAGATGGCACAGTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCATCGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCTAACGGATTAGAAAAG
  3   1   2       bld DMZ  5g3  in                         xl253n12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGAGAAGTAAAACCTTGTGACAAGATGGCCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACT
  3   1   2       bld Ga15                               XL425b02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGAAGTAAAACTTTGTGACAAGATGGNCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTTCCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTAACGA
  3   1   2       bld Ga12 5g3  in                         XL181h12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGAAGTAAANCTTTGTGACAAGATGNCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACNTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTT
  3   1   2       bld Lmb1      in                    IMAGE:8533084.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGAAGTAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTTCCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACACCCAGAGCCTTTAACTAACGAGACAGCAAACGGAAATTACACT
  5   1   2       bld Te2                             IMAGE:7211767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAACTTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCACATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTTCAACATCCAGAGCCTTTTTAACTTACGAGACAGCAAACGGaaaataaaaaaactgaaatagaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGGCCGCTTATTTAACCTCGAAGGAAGGGGCCCCTATTTGTGGGTCCGTATTTATAAAC
  3   1   2       bld Te2       in                    IMAGE:7207015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAACCTTGTGACAAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCACGAAAGAGAAGCCAGCAAAGGAGCCCTAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATGTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGTGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATTTTTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCTTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTAGTTTTCACATCTGTTCCGAGATCCAGAGCTCTCCCCTTAACGCGACAGCAAACGGAAAATAAAAA
  5  -1   2       bld Tail                            IMAGE:8544971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAGTCGTGTGGTGGAGAGTAACTGTGACAGATGCACGTGATGCCAGAAGTTGCgagagcagcccaaaagagactccagaaagagagccagcnaagagcccaaaaagaaaggAGGAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGaaaataaaaaaactgaaatagaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCG
  5  -1   2       bld Thy                             IMAGE:8549602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCGTGTGGTGGAGAGTAACTTGGACAGATGCCAGTTGAGCAGAAGTTGCGAGAGCAGCCAAAAAGAGATCCAGNNAAGAGAGCCAGCAAGGAGCCNAAAAAGAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCNTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGaaaataaaaaaactgaaatgaaaaaaaaaaa
  3   1   2       bld Emb9 5g3  in                    IMAGE:7975824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGACAAGATGGCACAGTTTGATGCCACGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCTCACGAAAGAGAAGCCAGCAAAGGAGCCCACAAAAGAAAAGGAGGGAAAGAAGAAAGCAGCACCTAGTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACACCCCGAGCATTAAAAAGCCAAACACAACCAAAAAACCG
  3   1   2       bld DMZ       in                         xl288f12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAAGATGNCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTNTAAC
  3   1   2       bld DMZ       in                         xl241d16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAAGATGGCACAGTTTGATGCCCAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAACTAAC
  5   1   2       bld Te2N                            IMAGE:7767465.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCcaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTT
  5   1   2       bld Lmb2                            IMAGE:8639451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGATGGCACAGTTTGATGCCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCCcaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCATGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCACATGAGAAGG
  5  -1   2       chi Sp1                             IMAGE:5507131.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCTTTTACCAAATTCCGTTGGGAAAAAATTTTAAAGGgcccttttcccaaattttcggggcccccaaaaaggtccccaaaggaacccccaagggcccaaaaaaaaggggaaaaaaaagcgcccttcccttccccccccTGGGATGCCCGGTAAATTTGAAAGGCTTTGCAGCCGGGCTTAATTAAAGGGCCCTTATGCACATTTTCCTAAAAGCTCCTTTTTAATGGATGAGGTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGAAGAGCTGGTCCATCTGGTACGCAGAGTATAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTAANTAACGAGACAGCAAACGCA
  3   1   2       chi Skin      in                    IMAGE:8641059.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCGCTTTGTTTCCATTAAGTTTGTCGGATCGCCCCAAATAAAATCTCCCATAGATGTGTAGCTAGCAAGGGACCCAAACAACGACTGTGGAAAAGAAGAAGTCAGCACCTACTCCTCCCCCAGCCCCTGAGGATGACCTGGATGCATTTTAAAAGGCTTTTGCGGCAGAGCCTAAATCAAAGGGCCCCTATGCACATCTACCTAAAAGCTTCCTTTATAATGGAGGAGTTATAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGATCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTATGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATATTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTGAGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTATGTCATGCTCCCCCNCCCNCCNCNNNNATTTnnnnnnnnnnCACCCCA
  3   1   2       bld Te2       in                    IMAGE:7390368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGATGCCATGAAGTTTGCCGAGATGCAGCCCAAAACAGAGACTCCCACGAAAGAGAAGCCAGCAAAGGAGCCCACAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACTTACTCCTGCCCCAGCCCGTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCGTAAATCAAAGGACCCATATGCACATCTACGTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGTCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACTCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTGTTTCTAATCGGGCGCAGAGCTATAACCAT
  5  -1   2       bld Spl                             IMAGE:8462310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACTTGGACAGTGCACAGTGATNAGAAGTGCGAGAGCAGCCAAAAGAGATCCCagaagagagccagcaaggagccaaaaagaaaggagaaaagagaaagcagcacNACTCCTGCCCCAGCCCCTGAGGATGACCTGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGaaaataaaaaaactgaaatagaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGCCGCGGCCAGATTCCC
  5   1   2       bld Emb4      in                    IMAGE:4957287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAGAAGTTTGCCGAGATGCAGCCCAAAAAAGAGACTCccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAAGAGAATTCAAA
  5   1   2       bld Lmb2                            IMAGE:8639480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAAGTTTGCCGAGATGCAGCCCAAAAaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATT
  3   1   2       bld Thy  5g3  in                    IMAGE:8549245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCGAGAAGCAGACCCAAAAAAAGAGACTCTCAAGAAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAAGAAAAAGGAGGAAAAGAAGAAAGCAGCACCTAATTCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACATAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTATGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCAAAGTCTGGTTTTCAACCATCATGTTCCCCAC
  5   1   2       bld Tad2                            IMAGE:6871957.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAGATGCAgcccaaaaaagagactcccaagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCCTGAAAATACGGCGAGTCTGGGTTTTTCACCATTCTGTTTCCCAACAATCCCAGGAAGCCCTTTTTAAACTTTAAACGGAGGACCCAGCAA
  3   1   2       bld Neu7      in                         XL008k01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAAAAAGAGACTCCCAAGAAAGAGAAGCCAGCAAAGGAGCCCAAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGAAAATAAAAAAAC
  5  -1   2       bld Thy                             IMAGE:8547565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTCCCAAGAAAGAGGAGCCAGCaaaggaggcccaaaaagaaaggaggaaaagaagaaagCAGCACTGCTCCTGCCCCAGCCCTTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTCCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATTTTTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTTTTTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATTTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTTTGGTTTTCACATTTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGaaaataaaaaaactgaaatagaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGGACGAATTTGTATTTTTTTTTTCTTTTTTTAAGATAA
  5   1   2       bld Brn3                            IMAGE:8538553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    caagaaagagaagccagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTNCAATGAGAAGGAGGCTACCTTGGTCCCTGAATACGCGAGTCTGGTTTTACATCTGTTCAACATCCGAGCTTTTACTTACGAGACGCAACGGAAATAAAACTGAATTGaaaaaanaaaaaaaaanaaaaaanaaaaaannnnnaaaaNNGGGGGGNNGGGAGAATNNAANNGGGGGGCCGGCCTATTCTCACCTTC
  3   1   2       bld Gas5 5g3  in                    IMAGE:3751548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAAAGAGAAGCCAGCAAGGGAGCCCTAAAAAGAAAGGAGGGAAAGAAGAAAGCCAGCACCTACTCTTGCCCCAGGCCCCTGAGAATGACTTGAATGAATCTGAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGAAAATAAAAAAAAAAA
  3   1   2       bld Ga18      in                      xlk115i16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAAGAGAAGCCAGCAAAGGAGnCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGNACCTACTCCTNNCCCAGCCCCTGAGGATGACCTGGATGAATCTGNNNNNNCTTTAGCANNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGNNNNNTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAANCTGCGTAAANNNCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGNNNNANNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGNCCTTTTANCTTAACGAGACANNA
  3   1   2       bld Ga18      in                       xlk54c20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNNAAGAGAAGCCAGNAAAGGAGCCCAAAAAAGAAANGGAGGAAAAGAAGAAANCAGNACCTACTCCTNNCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGNNTTTAGCANNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGNNNNCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACNNNNNNGTAANNNNNTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGNNNANNNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGNTCCCTGAAATACGCGAGTCTGGNTTTCACATCTGTTCCAACATCCAGNCCNTTTAACTTANCGAGNC
  3   1   2       bld Ga18                              rxlk60j17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ANNNGAAGCCAGCAAANGNNGCCCAAAAAAGAAANGGAGGAAAAGANGAAAGCAGNNCCTACNCCTNNCCCAGCCCCTGAGGATGNCCTGGATGAATCTGAAAAGNCTTTAGCANNAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGNNNNCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAANTTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCANCTTAATTACAGGTATGTTCCAGCGTCTAGACNNNNNNGTAANNNGCNTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGNNNANNNCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGNCCTTTTAACTTANCGAGNCANNA
  5   1   2       bld Ga18      in                      xlk115i16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         gaaagagaagncagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTNNNNCANNNNTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGNCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGNNNNTCATCTTGTTCGGGANCAACAATAACAGCTCCATCTCTGGNGTGTGGGTGTTCAGAGGCCAAGANCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGNCAAAGAATACTTTTGCCTGGGANNGAGAATTCAAGAATGTGGGCAAGCCCTTTTAACCAGGGNCNAGATCTTCAAATGAGAANGNGNNTACCTTGGTCCCTGAAANACGCGANNCTNGNTTCACATCTGTTCCANCATCCAGAGNCTTTTAACTTAACGAGACAGCAAANGNAAATAAAAAANTGAANT
  3   1   2       bld Ga12      in                         XL181l01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGAAGCCAGCAAAGGAGCCCAAAAAAGANAAGGAGGAAAAGNAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACNTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGANGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCNTACAACTGGAGAAAGCTGGATAGTGGTANTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTNNCCTGGGAAGGAGAATTCAAGAATGNGGGCAAGCCCTTTAACCAGGGCAATATCTTCAAATGAGAAGGAGGCTACCNTGGTCCCTGAAATACGCGAGTCGTGGTTTTCACATCTGNTCCAACATCNCAGAGCCT
  3   1   2       bld DMZ       in                         xl286n16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGAAGCCAGCAAAGGAGCCCAAAAAAGAAAAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACAT
  5   1   2       bld DMZ       in                         xl286n16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGAAGCCAGCAAAGGAGCCCaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCC
  5   1   2       bld Ga18      in                       xlk54c20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            aaagagaagncagcaaaggagcccaaaaaagaaaaggaggaaaagaagaaagCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTNNNNNNCAGNNNNAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTNNNNNTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGNAGGCTACCTTGGTCCCTGAAATACGCGAGNCTNGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACANCAAACGGAAATAAAAAAACTGAAATA
  3   1   2       bld Thy       in                    IMAGE:8549183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGGAGCCCAAAAAAGAAAAAGGAGGAATAGAGAAAGCAGCACTTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGAATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGAACCCATATGCACATCTTCCTAAAAGCTCATTTATAATGGATGAAGTTTAAGAGGAAATATTCAAATGAAGATACCCATGACTGTTGCTATGCCTTATATCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTATGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTAATGGTTTTCACAATCATATTCCAAAACAAATG
  5  -1   2       bld Int2                            IMAGE:8529194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCCGCAAAGGGCCCAAAAAGAAAGGGGGAAAAGAGAAAGCGGCCCTCTTCCTGCCCCAGCCCCTGAGGATGACCTGGAAGAATCTGAAAAGGCTTTAGCGGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAATGAGACAGCAAACGGaaaataaaaaaactgaaatggaaaaaaaaaaaaaaaaaaaaaaaaGGGC
  5   1   2       bld Ov1       in                    IMAGE:8328704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  aaaagaaaaggaggaaaagaagaaagCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGaaaaataaaaaaaCTGAAATA
  5  -1   2       bld Spl       in                    IMAGE:8463924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGAGGAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGaaaataaaaaaactgaaatggaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL161h12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAAGAAGAAAGCAGCACCTACTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGG
  3   1   2       bld Tbd5      in                    IMAGE:3579579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCAGAGAGTCTGCTCGTGCTCCCGCCCCAGCCCCTGAGAGGTCACCTGGACGAATCTCTACAGCTTGAGCAGCAGAGCCTAATTGAAAGGACCTATACGCACATCTACCTAAAAGCTCCTCTATAATGGATGAGTTCAAGAGCAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTAAGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGCCCGACAATACGAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTGTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCA
  3   1   2       chi Tbd5      in                    IMAGE:3579860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCGCCTCCCTCCCTTGCCCCTGCCCCTACGAATCCCTCGTTCGATCCGCGAGCGCTCAGCCACCACAGCCCCTATCAACGGGACCCCATCGCCCATCCACCTGAAGCTCCCTTATAATGCTCAGTTCTAAGAGGCAATATTCCAATTCAGATCCCCCGACCGTTGCTCCGCCCTATTTCTGGGAGCCTTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCCACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCA
  3   1   2       bld Ov1       in                    IMAGE:8329164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGCACCTGCTCCTGCCCCAGCCCCTGAGGATGACCTGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTATAAATTTCCAGAGGAGCTGACACAAGCCTTTATGAGCTGCAACTTAATTACAGGTATGTTCCAGCGTCTAGACAAACTGCGTAAAACTGGCTTTGCCAGTGTCATCTTGTTCGGGACCAACAATAACAGCTCCATCTCTGGTGTGTGGGTGTTCAGAGGCCAAGACCTTGCTTTTACACTCTCTGAAGACTGGCAAATTGATTACGAATCCTACAACTGGAGAAAGCTGGATAGTGGTAGTGAGGAGTGCAAAACCCTGGTCAAAGAATACTTTGCCTGGGAAGGAGAATTCAAGAATGTGGGCAAGCCCTTTAACCAGGGCAAGATCTTCAAATGAGAAGGAGGCTACCTTGGTCCCTGAAATACGCGAGTCTGGTTTTCACATCTGTTCCAACATCCAGAGCCTTTTAACTTAACGAGACAGCAAACGGAAAAAAAAAAAAAAAG
  3   1   2       bld Ov1       in                    IMAGE:8328704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCTGCCCCAGCCCCTGAGGATGACTNGGATGAATCTGAAAAGGCTTTAGCAGCAGAGCCTAAATCAAAGGACCCATATGCACATCTACCTAAAAGCTCCTTTATAATGGATGAGTTTAAGAGGAAATATTCAAATGAAGATACCCTGACTGTTGCTCTGCCTTATTTCTGGGAGCACTTTGACAAGGAAGGCTGGTCCATCTGGTACGCAGAGTA